The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_008150	Yersinia pestis Antiqua, complete sequence	4702289	290846	352330	4702289	transposase,plate,protease	Escherichia_phage(42.86%)	44	NA	NA
WP_000255944.1|290846_291869_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_001297096.1|291868_292648_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_002228141.1|292900_293485_+	DUF4232 domain-containing protein	NA	NA	NA	NA	NA
WP_002208945.1|293601_294087_-	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_002208944.1|294228_295146_-	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_002208943.1|295381_296713_-	HslU--HslV peptidase ATPase subunit	NA	A0A191ZC11	Erwinia_phage	29.8	1.2e-43
WP_002208942.1|296783_297308_-|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_002208941.1|297407_298253_-	cell division protein FtsN	NA	NA	NA	NA	NA
WP_002216730.1|298318_299347_-	DNA-binding transcriptional regulator CytR	NA	NA	NA	NA	NA
WP_002208938.1|299699_301898_-	primosomal protein N'	NA	NA	NA	NA	NA
WP_002216737.1|302140_302356_+	50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_002208936.1|302880_303336_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002208935.1|303684_304002_-	met regulon transcriptional regulator MetJ	NA	NA	NA	NA	NA
WP_002208934.1|305541_307977_+	bifunctional aspartate kinase/homoserine dehydrogenase II	NA	NA	NA	NA	NA
WP_002208933.1|308209_309094_+	methylenetetrahydrofolate reductase	NA	NA	NA	NA	NA
WP_100067904.1|309271_310626_-|transposase	IS3-like element IS1661 family transposase	transposase	A0A1B1P773	Bacillus_phage	44.7	1.1e-55
WP_002211645.1|310897_312322_+	MFS transporter	NA	NA	NA	NA	NA
WP_002211646.1|312580_314761_-	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_002211647.1|314832_316161_-	lysine N(6)-hydroxylase/L-ornithine N(5)-oxygenase family protein	NA	NA	NA	NA	NA
WP_002211648.1|316157_317906_-	aerobactin synthase IucC	NA	NA	NA	NA	NA
WP_002211649.1|317902_318853_-	acetyltransferase	NA	NA	NA	NA	NA
WP_002211651.1|320747_321971_+	MFS transporter	NA	NA	NA	NA	NA
WP_002211652.1|322260_323094_-	intradiol ring-cleavage dioxygenase	NA	NA	NA	NA	NA
WP_002211654.1|323470_324847_-	peptidase	NA	NA	NA	NA	NA
WP_002211655.1|325408_326152_+	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002215903.1|326132_326783_-	acyl-homoserine-lactone synthase	NA	NA	NA	NA	NA
WP_002215902.1|327957_328608_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_002215900.1|329058_329454_+	lipoprotein	NA	NA	NA	NA	NA
WP_002211661.1|330372_330528_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002211662.1|331729_332230_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_002215896.1|332272_333817_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_002211664.1|333828_335181_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_002210015.1|335177_335864_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_002228049.1|335863_337600_+	OmpA family protein	NA	NA	NA	NA	NA
WP_002210014.1|337603_338095_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_011566237.1|338512_341161_+	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	29.4	1.8e-91
WP_002210012.1|341157_343506_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	33.3	3.1e-18
WP_002210011.1|343520_345743_+	hydroxyethylthiazole kinase	NA	NA	NA	NA	NA
WP_016257642.1|345886_346243_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002216110.1|346416_346611_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002210010.1|347835_348471_+	DUF2345 domain-containing protein	NA	NA	NA	NA	NA
WP_002210009.1|348486_350784_+	M23 family metallopeptidase	NA	NA	NA	NA	NA
WP_002210008.1|350770_351538_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086016632.1|351633_352330_+|transposase	IS1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	48.5	1.3e-60
>prophage 2
NC_008150	Yersinia pestis Antiqua, complete sequence	4702289	603298	662101	4702289	integrase,transposase,tRNA,protease	Saccharomonospora_phage(17.65%)	54	603154:603213	662187:662898
603154:603213	attL	TTGTGCCCAGAAAACCCCCAGCTAGGCTGGGGGTTCAGTAAAGCTTTCAGCTTTGGGTCA	NA	NA	NA	NA
WP_002213759.1|603298_603757_+|transposase	IS200/IS605-like element IS1541A family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	8.5e-13
WP_002212133.1|604033_604759_+	UMP kinase	NA	NA	NA	NA	NA
WP_002212134.1|604894_605452_+	ribosome recycling factor	NA	NA	NA	NA	NA
WP_002212135.1|605665_606862_+	1-deoxy-D-xylulose-5-phosphate reductoisomerase	NA	NA	NA	NA	NA
WP_002212136.1|607085_607844_+	(2E,6E)-farnesyl-diphosphate-specific ditrans,polycis-undecaprenyl-diphosphate synthase	NA	R9W0U9	Flavobacterium_phage	40.7	1.4e-23
WP_002212137.1|607853_608702_+	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_002212138.1|608730_610086_+|protease	sigma E protease regulator RseP	protease	NA	NA	NA	NA
WP_002212139.1|610122_612510_+	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
WP_002212140.1|612667_613165_+	molecular chaperone Skp	NA	NA	NA	NA	NA
WP_002212141.1|613168_614191_+	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_002217656.1|614348_614879_+	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_002212143.1|614882_615671_+	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
WP_002212144.1|615674_616859_+	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
WP_002212145.1|616855_617452_+	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	41.4	3.8e-29
WP_002228634.1|617614_621097_+	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	37.2	3.6e-204
WP_002212147.1|621109_622069_+	acetyl-CoA carboxylase carboxyl transferase subunit alpha	NA	NA	NA	NA	NA
WP_002212148.1|622252_622651_+	VOC family protein	NA	NA	NA	NA	NA
WP_002212149.1|622652_624035_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_002212150.1|624271_624589_+	cytochrome c	NA	NA	NA	NA	NA
WP_002218374.1|624853_625114_-	Rho-binding antiterminator	NA	NA	NA	NA	NA
WP_002212152.1|625100_625301_-	YaeP family protein	NA	NA	NA	NA	NA
WP_002212153.1|625542_626091_+	YaeQ family protein	NA	NA	NA	NA	NA
WP_002212154.1|626093_626510_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_002212155.1|626594_627278_+	envelope stress response activation lipoprotein NlpE	NA	NA	NA	NA	NA
WP_002212156.1|627411_629130_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_002220063.1|629233_629941_-|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
WP_002212158.1|629937_630345_-	Rcs stress response system protein RcsF	NA	NA	NA	NA	NA
WP_002212159.1|630462_631278_-	MetQ/NlpA family lipoprotein	NA	NA	NA	NA	NA
WP_002212160.1|631341_631995_-	methionine ABC transporter permease MetI	NA	NA	NA	NA	NA
WP_002212161.1|631987_633019_-	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	35.4	1.7e-32
WP_002220062.1|633205_633772_+	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_002210693.1|639911_640715_+	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SKP9	Klosneuvirus	29.2	3.6e-27
WP_002220059.1|641574_642357_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_002228041.1|642398_643787_-	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.8	4.5e-09
WP_002210697.1|643858_644614_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_002210698.1|644658_645378_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_002210699.1|645432_645897_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	53.9	9.1e-47
WP_002210700.1|645966_646731_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.8	1.9e-41
WP_002210701.1|646976_648461_-	NCS1 family nucleobase:cation symporter-1	NA	NA	NA	NA	NA
WP_002210703.1|648799_649033_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001297096.1|649083_649863_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_000255944.1|649862_650885_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_002215951.1|651489_651807_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A141GEX6	Brucella_phage	48.1	2.0e-13
WP_002210705.1|651812_652127_+	putative addiction module antidote protein	NA	NA	NA	NA	NA
WP_002210707.1|652475_653564_-	AAA family ATPase	NA	A0A2H4JFA4	uncultured_Caudovirales_phage	60.4	1.4e-114
WP_002215950.1|653560_654520_-	toprim domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	41.0	1.6e-50
WP_002215949.1|654512_655055_-	ash family protein	NA	NA	NA	NA	NA
WP_002210709.1|655054_655255_-	AlpA family transcriptional regulator	NA	A0A1V0E8E5	Vibrio_phage	51.7	1.6e-08
WP_002210710.1|655247_656135_-|integrase	integrase domain-containing protein	integrase	NA	NA	NA	NA
WP_002215946.1|656942_657170_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002215945.1|657331_659002_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002210712.1|659052_660141_-	DUF4297 domain-containing protein	NA	NA	NA	NA	NA
WP_002210713.1|660219_661419_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	50.2	2.2e-108
WP_002213759.1|661642_662101_-|transposase	IS200/IS605-like element IS1541A family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	8.5e-13
662187:662898	attR	TGACCCAAAGCTGAAAGCTTTACTGAACCCCCAGCCTAGCTGGGGGTTTTCTGGGCACAAAAAAGCCCGCAAACCTAGAAGGGATGCGGGCTTTCCGTACTTCACCGGACTTATCTGGTAATAACCGGTTTAACATTTGGTGGAGCTGGGGGGATTTGAACCCCCGTCCGAAATTACTACACCGTCGGCACTACATGCTTAGTCCAATCATTACATTCGCCGGCCAGCTGCGGATGGACACGCTACTGACAAACTATCCTGATTAGTTTTAATGCTTCCACCCCAGGCAAGGTTTCCACACGAGCTCTTTTAGGTTTGACCTCTCTTGATCCCCGTCCTAAGAGCGGAGGCTAGGGAGAGAGGGCTCTAAGCAGGTTATTAAGCTGCTAGTGCGTAGTTTTCGTCGTTTGCAACTATTTTTTTTGCGGTTTTTTACGAGGCCACCGCACCTCGGCATGCACCTTGGGTTTCGCGAATCCCGTCGAATCCAGAATCAGCCCCAAAGAACTCAGCTAGTATAACAGAACTATGTCCTGCGATGCCAGTTACTTAACGATTTGCGTGCTTCATGATGCGCGCTTTGTCTAACTTCCACTCACGATCTCTAATATCATCGCGCTTGTCGTTATCTTTTTTACCTTTTGCTACGCCGATTTTAACTTTCACCCAGGCATTTTTCCAATACATGGAGAGAGCGACAACCGTGTAGCCT	NA	NA	NA	NA
>prophage 3
NC_008150	Yersinia pestis Antiqua, complete sequence	4702289	741997	902400	4702289	plate,transposase,tRNA,protease	Escherichia_phage(18.92%)	116	NA	NA
WP_002211351.1|741997_743947_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	37.7	8.8e-35
WP_002211350.1|744227_744491_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	59.7	3.6e-16
WP_002211349.1|744851_745172_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	42.7	8.2e-15
WP_002211348.1|745197_747474_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	41.7	7.4e-166
WP_002213759.1|747766_748225_+|transposase	IS200/IS605-like element IS1541A family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	8.5e-13
WP_002211347.1|748596_748815_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_011566242.1|748904_749690_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_002211344.1|749908_751633_-	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	31.8	3.3e-17
WP_002217690.1|751635_753402_-	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	24.9	6.8e-26
WP_002211341.1|753860_754823_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	45.7	4.9e-63
WP_002211340.1|755589_756084_+	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_002220033.1|756206_760106_+	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.8	1.5e-89
WP_002211338.1|760298_760907_+	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_002228009.1|760917_762261_+	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	39.4	5.4e-76
WP_002211336.1|762502_763795_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	43.5	4.0e-92
WP_002211334.1|765336_766071_-	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	27.4	3.6e-21
WP_002211333.1|767057_767732_+	glycosyltransferase family 25 protein	NA	A0A2H4UUT1	Bodo_saltans_virus	40.5	7.8e-31
WP_002211332.1|767849_770132_-	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.2	1.6e-157
WP_002211331.1|770187_771045_-	formate transporter FocA	NA	NA	NA	NA	NA
WP_002211330.1|771741_773508_-	30S ribosomal protein S12 methylthiotransferase accessory protein YcaO	NA	NA	NA	NA	NA
WP_002211329.1|773656_774694_+	L-asparaginase 2	NA	NA	NA	NA	NA
WP_002211328.1|774962_776057_+	YadA-like family protein	NA	B0FIT1	Escherichia_phage	32.7	3.7e-06
WP_002211327.1|776077_777925_+	YadA-like family protein	NA	NA	NA	NA	NA
WP_002211326.1|778291_779377_+	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	46.1	4.4e-84
WP_002211325.1|779539_780826_+	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_002211324.1|781138_781831_+	(d)CMP kinase	NA	NA	NA	NA	NA
WP_002211323.1|782004_783678_+	30S ribosomal protein S1	NA	NA	NA	NA	NA
WP_002211322.1|783738_784023_+	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	40.2	2.4e-10
WP_002211321.1|784569_786861_+	ComEC family protein	NA	NA	NA	NA	NA
WP_002211320.1|786896_788645_+	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	31.5	8.7e-66
WP_002211319.1|788641_789628_+	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_001297096.1|790678_791458_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_000255944.1|791457_792480_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_002211317.1|793812_794022_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	50.0	3.0e-10
WP_002211315.1|794569_794752_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002211314.1|794748_795501_+	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_002211313.1|795863_796757_+	YcbJ family phosphotransferase	NA	NA	NA	NA	NA
WP_002211311.1|797529_798315_+|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
WP_002211310.1|798311_799634_+	chromosome partition protein MukF	NA	NA	NA	NA	NA
WP_002211309.1|799614_800343_+	chromosome partition protein MukE	NA	NA	NA	NA	NA
WP_002211308.1|800339_804797_+	chromosome partition protein MukB	NA	NA	NA	NA	NA
WP_002213759.1|805012_805471_+|transposase	IS200/IS605-like element IS1541A family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	8.5e-13
WP_002217987.1|805754_807611_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_002211305.1|807834_808383_+	YcbK family protein	NA	A0A0K1LLY2	Rhodobacter_phage	34.7	7.8e-05
WP_002211304.1|808443_809091_+	MBL fold metallo-hydrolase	NA	A0A1X9I5D3	Streptococcus_phage	32.3	2.2e-22
WP_002430096.1|809244_809361_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002211303.1|809514_810705_-	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_002211301.1|812342_813743_-|tRNA	asparagine--tRNA ligase	tRNA	A0A167RLM0	Powai_lake_megavirus	35.2	6.5e-80
WP_002228013.1|814241_815447_-	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_002220013.1|816162_818778_+	aminopeptidase N	NA	NA	NA	NA	NA
WP_002211296.1|819413_820424_+	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_002211295.1|820606_821158_+	cell division protein ZapC	NA	NA	NA	NA	NA
WP_002211294.1|821183_822296_-	MOSC N-terminal beta barrel domain-containing protein	NA	NA	NA	NA	NA
WP_002211293.1|822395_824516_+	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
WP_002211292.1|824521_826435_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	28.9	1.5e-47
WP_002211291.1|826563_827850_+	membrane integrity-associated transporter subunit PqiA	NA	NA	NA	NA	NA
WP_002211290.1|827836_829489_+	intermembrane transport protein PqiB	NA	NA	NA	NA	NA
WP_002211289.1|829485_830064_+	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_002228015.1|830333_830501_+	ribosome modulation factor	NA	NA	NA	NA	NA
WP_002213775.1|830698_831157_+|transposase	IS200/IS605-like element IS1541B family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	8.5e-13
WP_001297096.1|832317_833097_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_000255944.1|833096_834119_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_002211286.1|834752_834941_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002220006.1|835206_835725_-	bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase	NA	NA	NA	NA	NA
WP_002224683.1|835793_837545_-|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_002226586.1|837755_838211_+	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_002213775.1|838379_838838_-|transposase	IS200/IS605-like element IS1541B family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	8.5e-13
WP_002213066.1|839027_840089_-	porin OmpA	NA	NA	NA	NA	NA
WP_002213065.1|840446_840953_-	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_002213064.1|841181_841817_+	TfoX/Sxy family DNA transformation protein	NA	NA	NA	NA	NA
WP_002213063.1|841918_844057_-	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_002213062.1|844086_844533_-	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_002221095.1|844726_846781_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	25.8	1.5e-16
WP_002213060.1|846841_847306_-	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_002213058.1|847484_848165_-	DUF2057 family protein	NA	NA	NA	NA	NA
WP_002213056.1|848480_848897_+	CoA-binding protein	NA	NA	NA	NA	NA
WP_002213054.1|849005_849323_-	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_002213052.1|849383_850574_-	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	W6LLI2	Streptococcus_phage	28.1	2.1e-26
WP_002213049.1|850667_850946_+	acylphosphatase	NA	NA	NA	NA	NA
WP_002213046.1|850997_851327_-	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_002213039.1|854972_857390_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_002213038.1|857543_858290_-	SDR family oxidoreductase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	31.4	3.3e-14
WP_002213036.1|859020_859239_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002213034.1|859502_860027_+	beta-hydroxyacyl-ACP dehydratase	NA	NA	NA	NA	NA
WP_002213032.1|860016_861300_+	beta-ketoacyl-[acyl-carrier-protein] synthase family protein	NA	NA	NA	NA	NA
WP_002213030.1|861301_862039_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_002213028.1|862054_863293_+	hydroxymethylglutaryl-CoA synthase family protein	NA	NA	NA	NA	NA
WP_002213026.1|863285_864005_+	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_002213025.1|864006_864759_+	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_002213024.1|864761_865550_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_002228570.1|865636_866077_+	lipocalin-like domain-containing protein	NA	NA	NA	NA	NA
WP_002213017.1|866114_866363_+	acyl carrier protein	NA	NA	NA	NA	NA
WP_002213016.1|866461_867310_+	ACP S-malonyltransferase	NA	NA	NA	NA	NA
WP_000255944.1|868021_869044_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_001297096.1|869043_869823_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_002213014.1|870257_870758_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_002214707.1|870800_872351_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_002213011.1|872362_873715_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_002210015.1|873711_874398_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_002214568.1|874397_876134_+	OmpA family protein	NA	NA	NA	NA	NA
WP_002210014.1|876137_876629_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_002211927.1|877016_879659_+	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	31.6	1.6e-92
WP_002211928.1|879661_882010_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	32.1	4.5e-17
WP_002211929.1|882025_884326_+	M23 family metallopeptidase	NA	NA	NA	NA	NA
WP_002211930.1|884322_885096_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002211931.1|885249_885510_+	DUF2345 domain-containing protein	NA	NA	NA	NA	NA
WP_002211932.1|885525_887709_+	M23 family metallopeptidase	NA	NA	NA	NA	NA
WP_002214564.1|887881_888352_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002211935.1|890516_891749_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002211936.1|891745_895168_+	type VI secretion system membrane subunit	NA	NA	NA	NA	NA
WP_002211938.1|896830_897889_+	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_002211939.1|897903_898359_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002211940.1|898579_900343_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_002211941.1|900306_901392_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_002214552.1|901366_901948_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_002211943.1|901947_902400_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
>prophage 4
NC_008150	Yersinia pestis Antiqua, complete sequence	4702289	1056166	1154232	4702289	coat,transposase,plate,protease,tail	Escherichia_phage(15.79%)	80	NA	NA
WP_000255944.1|1056166_1057189_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_001297096.1|1057188_1057968_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_002210809.1|1058272_1059388_-	porin OmpF2	NA	Q1MVN1	Enterobacteria_phage	54.5	2.1e-110
WP_002210810.1|1059657_1061838_+	ATP-dependent DNA helicase DinG	NA	A0A127AW80	Bacillus_phage	26.3	1.1e-44
WP_002210811.1|1061905_1063345_-	catalase	NA	A0A2K9L0T1	Tupanvirus	38.8	4.9e-99
WP_002210812.1|1063705_1064248_+	YfaZ family protein	NA	NA	NA	NA	NA
WP_002221775.1|1064504_1065713_-	tyrosine transporter TyrP	NA	NA	NA	NA	NA
WP_002210814.1|1066331_1067525_+	nicotinamide mononucleotide deamidase-related protein YfaY	NA	NA	NA	NA	NA
WP_002210815.1|1067582_1068092_-|protease	serine protease inhibitor ecotin	protease	NA	NA	NA	NA
WP_002210816.1|1068126_1068384_-	2Fe-2S ferredoxin-like protein	NA	G9IAA2	Pseudomonas_phage	54.9	4.0e-20
WP_002210817.1|1068387_1069518_-	ribonucleotide-diphosphate reductase subunit beta	NA	G9IAA3	Pseudomonas_phage	78.6	7.6e-172
WP_002210818.1|1069680_1071969_-	ribonucleoside-diphosphate reductase subunit alpha	NA	I3UMG3	Colwellia_phage	64.9	1.1e-286
WP_002210820.1|1072462_1073191_-	bifunctional 3-demethylubiquinone 3-O-methyltransferase/2-octaprenyl-6-hydroxy phenol methylase	NA	NA	NA	NA	NA
WP_002210821.1|1073452_1076128_+	DNA topoisomerase (ATP-hydrolyzing) subunit A	NA	G3M9Z5	Bacillus_virus	34.4	4.0e-102
WP_002228028.1|1076315_1079189_+	two-component system sensor histidine kinase RcsC	NA	A0A1V0SGX0	Hokovirus	28.3	3.8e-42
WP_002210824.1|1079256_1079910_-	transcriptional regulator RcsB	NA	NA	NA	NA	NA
WP_002216094.1|1079912_1080485_-	Hpt domain-containing protein	NA	NA	NA	NA	NA
WP_002216093.1|1080652_1082605_-	phosphotransferase RcsD	NA	NA	NA	NA	NA
WP_002210825.1|1082628_1083783_-	MFS transporter	NA	NA	NA	NA	NA
WP_002210826.1|1084885_1086001_+	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	57.6	9.6e-111
WP_002228026.1|1087431_1088598_-	D-alanyl-D-alanine- carboxypeptidase/endopeptidase AmpH	NA	NA	NA	NA	NA
WP_002208870.1|1088872_1090399_-	MFS transporter	NA	NA	NA	NA	NA
WP_002208869.1|1090775_1091804_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_002208868.1|1091877_1093665_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	63.5	4.0e-10
WP_002208867.1|1094071_1095007_-	omptin family outer membrane beta-barrel protein YcoA	NA	NA	NA	NA	NA
WP_002264765.1|1095178_1095415_-	DinI family protein	NA	K7PKR6	Enterobacteria_phage	63.8	4.8e-20
WP_002208864.1|1095620_1096343_-	LexA family transcriptional regulator	NA	F1C599	Cronobacter_phage	51.9	2.2e-63
WP_002215470.1|1096616_1097096_+	antitermination protein Q	NA	S5M7R9	Escherichia_phage	61.0	2.3e-37
WP_002208862.1|1097306_1098611_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	46.0	1.7e-90
WP_002208861.1|1099319_1100132_+	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_002208860.1|1100107_1100902_+	hydroxypyruvate isomerase family protein	NA	NA	NA	NA	NA
WP_002208859.1|1101532_1101823_+	hypothetical protein	NA	H6WRZ3	Salmonella_phage	46.3	7.7e-12
WP_002208858.1|1101868_1102486_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_002208857.1|1102490_1102685_+	DUF2635 domain-containing protein	NA	B5TK66	Pseudomonas_phage	60.4	3.5e-08
WP_002208856.1|1102681_1104190_+|tail	phage tail sheath subtilisin-like domain-containing protein	tail	B5TK67	Pseudomonas_phage	44.2	2.4e-104
WP_002208855.1|1104211_1104580_+|tail	phage tail tube protein	tail	NA	NA	NA	NA
WP_002208854.1|1104581_1104881_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_002208853.1|1105001_1106495_+|coat	coat protein	coat	NA	NA	NA	NA
WP_002208852.1|1106761_1108168_+	DNA circularization protein	NA	Q8SBG8	Shigella_phage	33.7	2.1e-17
WP_002208850.1|1108164_1109220_+|tail	tail protein	tail	M1PVV2	Vibrio_phage	27.2	1.3e-37
WP_002215460.1|1109235_1109832_+|plate	phage baseplate assembly protein	plate	NA	NA	NA	NA
WP_002208848.1|1109828_1110284_+	phage GP46 family protein	NA	A0A0C4UR04	Shigella_phage	43.8	4.3e-17
WP_002208847.1|1110287_1111424_+|plate	baseplate J/gp47 family protein	plate	B5TK75	Pseudomonas_phage	30.5	4.5e-31
WP_002215458.1|1111420_1111681_+	DUF2313 domain-containing protein	NA	NA	NA	NA	NA
WP_002208846.1|1111677_1112025_+	DUF2313 domain-containing protein	NA	A0A2P9JZK7	Alteromonadaceae_phage	41.3	6.4e-21
WP_002208845.1|1112121_1112901_+|tail	tail fiber protein	tail	Q9MCR6	Enterobacteria_phage	52.4	7.1e-52
WP_002208843.1|1113198_1113939_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002208842.1|1114229_1115666_+	6-phospho-beta-glucosidase	NA	NA	NA	NA	NA
WP_002208841.1|1115791_1116154_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002208840.1|1116853_1117342_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011566260.1|1117744_1118767_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.7	1.2e-200
WP_001297096.1|1118766_1119546_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_002230704.1|1120818_1121202_-	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	66.7	7.8e-36
WP_002208837.1|1121432_1123229_-	DUF3413 domain-containing protein	NA	NA	NA	NA	NA
WP_002208836.1|1123256_1123484_-	YejL family protein	NA	NA	NA	NA	NA
WP_002208835.1|1123661_1124666_+	nucleoid-associated protein YejK	NA	A0A1V0E8C0	Vibrio_phage	47.7	3.1e-84
WP_002213759.1|1124866_1125325_+|transposase	IS200/IS605-like element IS1541A family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	8.5e-13
WP_002208834.1|1125463_1125748_-	50S ribosomal protein L25	NA	NA	NA	NA	NA
WP_002208833.1|1125909_1127667_-	DEAD/DEAH box helicase	NA	M4Q3N1	Vibrio_phage	42.4	2.3e-98
WP_002208832.1|1128180_1128888_+	16S rRNA pseudouridine(516) synthase RsuA	NA	NA	NA	NA	NA
WP_002208831.1|1128991_1130191_+	Bcr/CflA family multidrug efflux MFS transporter	NA	S4TR35	Salmonella_phage	25.1	1.3e-23
WP_002208829.1|1131157_1131502_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002208828.1|1131562_1133155_-	microcin C ABC transporter ATP-binding protein YejF	NA	G9BWD6	Planktothrix_phage	32.8	1.3e-20
WP_002353954.1|1133156_1134182_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_002208826.1|1134184_1135285_-	microcin C ABC transporter permease YejB	NA	NA	NA	NA	NA
WP_002208825.1|1135294_1137103_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_071525527.1|1137184_1138702_-	cyclic di-GMP phosphodiesterase	NA	NA	NA	NA	NA
WP_002208822.1|1139352_1139937_-	bifunctional murein DD-endopeptidase/murein LD-carboxypeptidase	NA	A0A1V0DZX6	Clostridioides_phage	39.8	2.8e-13
WP_002208820.1|1140378_1141080_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_002208819.1|1141138_1142122_-	GTP-binding protein	NA	NA	NA	NA	NA
WP_002208816.1|1142929_1143673_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002208815.1|1143816_1145289_-	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	32.2	7.1e-45
WP_002264754.1|1145873_1147067_+	mannonate dehydratase	NA	NA	NA	NA	NA
WP_002228019.1|1147206_1147779_-	elongation factor P-like protein YeiP	NA	NA	NA	NA	NA
WP_002208812.1|1147882_1149127_-	tryptophan permease	NA	NA	NA	NA	NA
WP_002208811.1|1149501_1149756_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_002208810.1|1149824_1150640_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.6	8.8e-13
WP_002208809.1|1150650_1151616_-	C-terminal binding protein	NA	A0A1J0F959	Only_Syngen_Nebraska_virus	30.3	5.2e-28
WP_002208808.1|1151612_1152755_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_100067904.1|1152877_1154232_-|transposase	IS3-like element IS1661 family transposase	transposase	A0A1B1P773	Bacillus_phage	44.7	1.1e-55
>prophage 5
NC_008150	Yersinia pestis Antiqua, complete sequence	4702289	1191902	1234714	4702289	transposase,protease,holin	Planktothrix_phage(16.67%)	40	NA	NA
WP_000255944.1|1191902_1192925_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_002210745.1|1192983_1193109_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002210746.1|1193290_1194043_-	2,3-diphosphoglycerate-dependent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_002210747.1|1194389_1194725_-	phosphate starvation-inducible protein PsiF	NA	NA	NA	NA	NA
WP_002216812.1|1195017_1195914_-	galactose-1-epimerase	NA	NA	NA	NA	NA
WP_002216814.1|1195934_1196087_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002210748.1|1196080_1197232_-	galactokinase	NA	NA	NA	NA	NA
WP_002210749.1|1197228_1198281_-	galactose-1-phosphate uridylyltransferase	NA	NA	NA	NA	NA
WP_002210750.1|1198290_1199307_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	44.8	3.0e-79
WP_002210751.1|1199666_1200485_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_002210753.1|1200701_1202192_-	molybdate ABC transporter ATP-binding protein ModF	NA	A0A1M7XV31	Cedratvirus	26.8	2.8e-12
WP_002210754.1|1202301_1203093_-	molybdenum-dependent transcriptional regulator	NA	NA	NA	NA	NA
WP_002217291.1|1203358_1203511_+	multidrug efflux pump-associated protein, AcrZ family	NA	NA	NA	NA	NA
WP_002210756.1|1203745_1204525_+	molybdate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002210757.1|1204524_1205220_+	molybdate ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_002210758.1|1205213_1206293_+	molybdenum ABC transporter ATP-binding protein ModC	NA	G9BWD6	Planktothrix_phage	35.1	1.4e-21
WP_002210759.1|1206348_1207170_-	pyridoxal phosphatase	NA	NA	NA	NA	NA
WP_002210760.1|1207460_1208465_+	6-phosphogluconolactonase	NA	NA	NA	NA	NA
WP_002220188.1|1208649_1209930_-	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	32.1	2.4e-17
WP_002210762.1|1210028_1211066_+	biotin synthase BioB	NA	NA	NA	NA	NA
WP_002210763.1|1211065_1212217_+	8-amino-7-oxononanoate synthase	NA	NA	NA	NA	NA
WP_002210764.1|1212200_1213004_+	malonyl-ACP O-methyltransferase BioC	NA	NA	NA	NA	NA
WP_002216554.1|1212996_1213719_+	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_002210766.1|1213870_1214581_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	25.3	3.5e-13
WP_002220186.1|1215670_1217686_+	excinuclease ABC subunit B	NA	NA	NA	NA	NA
WP_002210768.1|1217977_1218223_+	VF530 family DNA-binding protein	NA	NA	NA	NA	NA
WP_002210769.1|1218353_1219277_-	uridine diphosphate-N-acetylglucosamine-binding protein YvcK	NA	A1IMD5	Streptococcus_phage	27.8	3.7e-23
WP_002210771.1|1219808_1220789_+	GTP 3',8-cyclase MoaA	NA	NA	NA	NA	NA
WP_002210772.1|1220889_1221369_+	cyclic pyranopterin monophosphate synthase MoaC	NA	NA	NA	NA	NA
WP_002210773.1|1221365_1221611_+	molybdopterin synthase sulfur carrier subunit	NA	NA	NA	NA	NA
WP_002210774.1|1221613_1222066_+	molybdopterin synthase catalytic subunit MoaE	NA	NA	NA	NA	NA
WP_002213775.1|1223154_1223613_+|transposase	IS200/IS605-like element IS1541B family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	8.5e-13
WP_002220180.1|1223841_1225545_-|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.5	9.4e-57
WP_002218281.1|1225567_1227040_-	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_002218278.1|1227097_1227694_-	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_002228035.1|1228058_1230107_+|holin	choline transporter	holin	A0A2I7QNT1	Vibrio_phage	28.5	1.4e-19
WP_002214199.1|1230338_1231232_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002214197.1|1231269_1232118_-	DMT family transporter	NA	NA	NA	NA	NA
WP_002214195.1|1232463_1233327_+	xanthosine phosphorylase	NA	Q5YBA4	Grouper_iridovirus	40.7	2.3e-51
WP_002213759.1|1234255_1234714_+|transposase	IS200/IS605-like element IS1541A family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	8.5e-13
>prophage 6
NC_008150	Yersinia pestis Antiqua, complete sequence	4702289	1607397	1724027	4702289	integrase,transposase,tRNA,tail	Escherichia_phage(16.67%)	110	1619762:1619821	1662236:1662955
WP_002211212.1|1607397_1609128_-|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	34.2	3.8e-90
WP_002211210.1|1609758_1610334_+	VOC family protein	NA	NA	NA	NA	NA
WP_002211209.1|1610565_1611330_+	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_002211208.1|1611522_1612494_-|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
WP_002211207.1|1612490_1613294_-	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	NA	NA	NA	NA
WP_002211206.1|1613484_1613880_-	MAPEG family protein	NA	NA	NA	NA	NA
WP_002211205.1|1614059_1614875_-	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	68.5	2.9e-48
WP_002211204.1|1615932_1617729_+|tRNA	aspartate--tRNA ligase	tRNA	A0A2K9L3L6	Tupanvirus	27.3	2.8e-11
WP_002211203.1|1617728_1618172_+	dihydroneopterin triphosphate diphosphatase	NA	NA	NA	NA	NA
WP_002211202.1|1618229_1618973_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_002211201.1|1619181_1619703_+	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	32.4	6.5e-09
1619762:1619821	attL	TTTTTTGTGCCCAGAAAACCCCCAGCTAGGCTGGGGGTTCAGTAAAGCTTTCAGCTTTGG	NA	NA	NA	NA
WP_002213759.1|1619910_1620369_+|transposase	IS200/IS605-like element IS1541A family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	8.5e-13
WP_002211199.1|1620696_1621311_+	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_002211198.1|1621472_1622477_+	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	27.8	4.7e-08
WP_002211197.1|1622531_1623317_-	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
WP_002228434.1|1623313_1624072_-	zinc ABC transporter ATP-binding protein ZnuC	NA	G3M9Y6	Bacillus_virus	30.3	1.2e-16
WP_002227944.1|1624147_1625104_+	zinc ABC transporter substrate-binding protein ZnuA	NA	NA	NA	NA	NA
WP_002228437.1|1625124_1626441_+	murein DD-endopeptidase MepM	NA	G3MBP9	Bacillus_virus	44.5	2.4e-15
WP_002211194.1|1626707_1627670_+	lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase	NA	NA	NA	NA	NA
WP_002211193.1|1628014_1629457_-	pyruvate kinase	NA	NA	NA	NA	NA
WP_002211192.1|1629786_1630656_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002211191.1|1631008_1632493_+	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	36.6	1.2e-79
WP_002211190.1|1632734_1633376_+	bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase	NA	NA	NA	NA	NA
WP_002211188.1|1634090_1634534_+	multidrug/spermidine efflux SMR transporter subunit MdtJ	NA	NA	NA	NA	NA
WP_002211187.1|1634520_1634850_+	multidrug/spermidine efflux SMR transporter subunit MdtI	NA	NA	NA	NA	NA
WP_002211186.1|1634981_1635326_-	RidA family protein	NA	NA	NA	NA	NA
WP_002211185.1|1635456_1637361_+	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	32.6	4.5e-92
WP_002211184.1|1637432_1638131_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_002211183.1|1638267_1638873_+	Slp family lipoprotein	NA	NA	NA	NA	NA
WP_087768167.1|1638873_1638981_-	gluconate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_002220632.1|1639515_1641204_+	long-chain-fatty-acid--CoA ligase FadD	NA	A0A2H4PQM9	Staphylococcus_phage	28.9	3.0e-31
WP_002211181.1|1641363_1642485_+	ribonuclease D	NA	NA	NA	NA	NA
WP_002211180.1|1642721_1642991_-	cell division topological specificity factor MinE	NA	NA	NA	NA	NA
WP_002211179.1|1642994_1643807_-	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_002220631.1|1643831_1644518_-	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_002211743.1|1645238_1645511_+	YcgL domain-containing protein	NA	NA	NA	NA	NA
WP_002215627.1|1645651_1646737_+	lytic murein transglycosylase	NA	NA	NA	NA	NA
WP_002211740.1|1646807_1647464_+	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_002211739.1|1647566_1648013_+	YcgN family cysteine cluster protein	NA	NA	NA	NA	NA
WP_002211738.1|1648039_1649278_-|integrase	site-specific integrase	integrase	Q20GI2	Phage_258-320	53.3	2.3e-121
WP_000255944.1|1649347_1650370_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_001297096.1|1650369_1651149_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_002211721.1|1651263_1652376_+	hypothetical protein	NA	I6PD76	Cronobacter_phage	58.2	6.0e-121
WP_002211720.1|1652497_1653271_+	hypothetical protein	NA	A0A1B0VMG1	Pseudomonas_phage	62.3	2.8e-69
WP_002211719.1|1653284_1654490_+	Ig-like domain-containing protein	NA	A0A1B0VMF8	Pseudomonas_phage	79.2	1.8e-142
WP_002211718.1|1654537_1655020_+	hypothetical protein	NA	G8C7P9	Escherichia_phage	46.1	6.4e-27
WP_002211717.1|1655016_1655271_+	hypothetical protein	NA	J9Q7U0	Salmonella_phage	53.1	2.2e-18
WP_002211716.1|1655272_1655623_+	hypothetical protein	NA	I6PD77	Cronobacter_phage	56.0	6.9e-31
WP_002211715.1|1655624_1656209_+	hypothetical protein	NA	G8C7Q1	Escherichia_phage	52.1	3.6e-48
WP_002211714.1|1656205_1656613_+	DUF4128 domain-containing protein	NA	NA	NA	NA	NA
WP_002211713.1|1656678_1657599_+	Ig-like domain-containing protein	NA	I6PBN6	Cronobacter_phage	49.1	4.4e-61
WP_002211712.1|1657611_1657923_+	hypothetical protein	NA	I6PDG2	Cronobacter_phage	58.3	1.4e-30
WP_071525538.1|1657970_1658231_+	DUF1799 domain-containing protein	NA	A0A0S2SY90	Pseudomonas_phage	50.0	3.7e-13
WP_002211711.1|1658231_1661735_+|tail	phage tail tape measure protein	tail	K7PMB9	Enterobacterial_phage	33.2	5.2e-118
WP_002211710.1|1661737_1662079_+|tail	phage tail protein	tail	Q6UAW6	Klebsiella_phage	50.0	1.7e-21
WP_002213759.1|1662384_1662843_+|transposase	IS200/IS605-like element IS1541A family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	8.5e-13
WP_002211709.1|1662963_1663716_+|tail	phage minor tail protein L	tail	A0A1W6JNX9	Morganella_phage	67.7	9.4e-102
1662236:1662955	attR	TTTTTTGTGCCCAGAAAACCCCCAGCTAGGCTGGGGGTTCAGTAAAGCTTTCAGCTTTGGGTCAGTTATAAAAACCCCTTTTGATTTGTTAAAACAGTTTGCGGTCTGGCAACTGCAAATGTTCAACAAGAAATCAAAAGGGGGTCCCAATGAGGGATGAAAAGAGCTTAGCGCACACCCGATGGAACTGTAAATATCATATAGTTTTTGCGCCGAAGTACCGAAGGCAGGTGTTCTACAGGGAAAAACGCAGAGCGATTGGCAGTATTTTAAGAAAACTGTGCGAATGGAAAAACGTGAATATCCTGGAAGCAGAATACTGTGTGGATCACATCCATATGCTTCTGGAGATCCCGCCCAAGATGAGTGTCTCGGGATTTATGGGGTACCTGAAGGGAAAGAGCAGTCTGATGCTTTATGAGCAGTTTGGCGATTTGAAGTTCAAATACCGTAACAGGGAGTTTTGGTGTCGAGGGTATTACGTTGATACGGTAGGGAAAAACACGGCCAGGATACAAGAATACATAAAGCACCAATTGGAAGAGGATAAAATGGGTGAGCAACTCTCGATCCCGTATCCCGGTAGCCCGTTTACGGGCCGTAAGTAATCCATAGATGCAAATGTCAGATCGCGATGCGCCTGTTAGGGCGCGGCTGGTAACAGAGCCTTATAGGCGCATATGAAAAACCTCCGGCTATGCCGGAGGATATTTATTTATG	NA	NA	NA	NA
WP_002211708.1|1663718_1664429_+	C40 family peptidase	NA	K7P6F5	Enterobacteria_phage	76.8	1.3e-108
WP_002211707.1|1664689_1665322_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002211706.1|1665400_1665832_-	Arc family DNA-binding protein	NA	G9L6D6	Escherichia_phage	58.4	2.5e-30
WP_002211705.1|1665955_1666123_+	hypothetical protein	NA	G9L6D7	Escherichia_phage	61.8	5.2e-13
WP_002211704.1|1666196_1667204_+	Bro-N domain-containing protein	NA	A0A2H4J0P1	uncultured_Caudovirales_phage	33.0	4.1e-36
WP_002214482.1|1667302_1667854_+	zinc ribbon domain-containing protein	NA	S4TR42	Salmonella_phage	58.0	9.5e-27
WP_002211701.1|1667996_1668212_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002211700.1|1668267_1668888_+|tail	tail assembly protein	tail	K7PGY0	Enterobacteria_phage	57.0	3.2e-55
WP_002211699.1|1668929_1669094_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002359202.1|1669062_1669284_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002211698.1|1669459_1672663_+	host specificity protein J	NA	F1C571	Cronobacter_phage	60.5	0.0e+00
WP_002211697.1|1672662_1673661_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002211696.1|1673677_1674595_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002211695.1|1674605_1675025_+|tail	tail fiber assembly protein	tail	B6SCW7	Bacteriophage	42.0	5.7e-08
WP_002209743.1|1675245_1676454_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	50.8	5.4e-51
WP_002211693.1|1677935_1679135_-	cysteine desulfurase	NA	A0A1X7QGF3	Faustovirus	29.6	2.4e-38
WP_002211692.1|1679151_1679892_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002214494.1|1680983_1681340_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002227934.1|1681756_1682287_-	disulfide bond formation protein DsbB	NA	NA	NA	NA	NA
WP_002211689.1|1682522_1684097_-	sodium/proton antiporter NhaB	NA	NA	NA	NA	NA
WP_002211688.1|1684340_1685060_+	fatty acid metabolism transcriptional regulator FadR	NA	NA	NA	NA	NA
WP_002211687.1|1685277_1686813_-	SpoVR family protein	NA	NA	NA	NA	NA
WP_002211686.1|1687277_1688582_+	D-amino acid dehydrogenase	NA	NA	NA	NA	NA
WP_002216508.1|1688597_1689800_-	multidrug effflux MFS transporter	NA	S4TR35	Salmonella_phage	29.1	7.6e-29
WP_002211685.1|1690064_1690934_-	pirin family protein	NA	NA	NA	NA	NA
WP_002211684.1|1691131_1692037_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002211683.1|1692071_1693190_-	DMT family transporter	NA	NA	NA	NA	NA
WP_002216501.1|1693297_1694572_-	YeaH/YhbH family protein	NA	A0A140HLI1	Bacillus_phage	37.1	1.5e-11
WP_002211681.1|1694721_1696656_-	protein kinase YeaG	NA	NA	NA	NA	NA
WP_002430110.1|1697099_1697849_+	MipA/OmpV family protein	NA	NA	NA	NA	NA
WP_002211679.1|1697921_1698797_-	D-hexose-6-phosphate mutarotase	NA	NA	NA	NA	NA
WP_002224141.1|1699110_1700106_-	glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_002211677.1|1700453_1700867_+	peptide-methionine (R)-S-oxide reductase MsrB	NA	NA	NA	NA	NA
WP_002217933.1|1700937_1701210_+	YeaC family protein	NA	NA	NA	NA	NA
WP_002211676.1|1701343_1701991_-	bifunctional nicotinamidase/pyrazinamidase	NA	A0A2K9L6K4	Tupanvirus	33.0	1.8e-21
WP_002211675.1|1702005_1703022_-	asparaginase	NA	NA	NA	NA	NA
WP_002211674.1|1703138_1704989_-	signal peptide peptidase SppA	NA	NA	NA	NA	NA
WP_002211673.1|1705151_1705703_+	NAD(P)H nitroreductase	NA	NA	NA	NA	NA
WP_002211671.1|1705927_1706974_+	selenide, water dikinase SelD	NA	NA	NA	NA	NA
WP_002211670.1|1707035_1708961_+	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	30.4	4.2e-37
WP_002211669.1|1708957_1709248_+	DUF1496 domain-containing protein	NA	NA	NA	NA	NA
WP_002211668.1|1709260_1709647_-	pyrimidine (deoxy)nucleoside triphosphate diphosphatase	NA	NA	NA	NA	NA
WP_002211667.1|1709744_1710551_-	exodeoxyribonuclease III	NA	NA	NA	NA	NA
WP_002211665.1|1711360_1712221_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002209743.1|1713092_1714301_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	50.8	5.4e-51
WP_002210667.1|1714263_1715133_-	formyltetrahydrofolate deformylase	NA	M4QRX9	Synechococcus_phage	37.3	5.5e-13
WP_002210666.1|1715216_1715681_-	YchJ family protein	NA	NA	NA	NA	NA
WP_002210665.1|1717014_1718031_+	two-component system response regulator RssB	NA	NA	NA	NA	NA
WP_002210664.1|1718337_1719684_+	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	38.3	1.9e-81
WP_002210661.1|1720118_1720517_-	DNA-binding transcriptional regulator H-NS	NA	NA	NA	NA	NA
WP_002210659.1|1721266_1721857_+	thymidine kinase	NA	A0A1Z1LYD5	Serratia_phage	55.8	1.5e-54
WP_001297096.1|1722225_1723005_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_000255944.1|1723004_1724027_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
>prophage 7
NC_008150	Yersinia pestis Antiqua, complete sequence	4702289	1989460	2045579	4702289	coat,transposase,tRNA,protease	Tupanvirus(15.38%)	51	NA	NA
WP_002211831.1|1989460_1991848_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_002220280.1|1991861_1992845_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.5	7.6e-35
WP_152328947.1|1993201_1993249_-	pheST operon leader peptide PheM	NA	NA	NA	NA	NA
WP_002211833.1|1993343_1993700_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_002211834.1|1993737_1993935_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_002227898.1|1994031_1994583_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	33.7	2.6e-16
WP_002211836.1|1994586_1996515_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.1	1.1e-127
WP_002216696.1|1996905_1997118_+	KTSC domain-containing protein	NA	A0A0K1LMB5	Caulobacter_phage	42.0	9.9e-09
WP_002211839.1|1997876_1998128_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002211840.1|1998445_1999129_+	MarC family NAAT transporter	NA	NA	NA	NA	NA
WP_002216686.1|1999250_1999913_-	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_002211842.1|2000124_2001093_+	iron/manganese ABC transporter substrate-binding protein YfeA	NA	NA	NA	NA	NA
WP_002211843.1|2001089_2001980_+	iron/manganese ABC transporter ATP-binding protein YfeB	NA	A0A1V0SKJ1	Klosneuvirus	27.5	2.9e-09
WP_002211844.1|2001979_2002864_+	iron/manganese ABC transporter permease subunit YfeC	NA	NA	NA	NA	NA
WP_002211845.1|2002860_2003754_+	iron/manganese ABC transporter permease subunit YfeD	NA	NA	NA	NA	NA
WP_002216683.1|2003821_2004034_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002211846.1|2004058_2004934_+	fructosamine kinase family protein	NA	NA	NA	NA	NA
WP_002211847.1|2005062_2005617_-	YniB family protein	NA	NA	NA	NA	NA
WP_002220277.1|2006027_2006693_+	hexitol phosphatase HxpB	NA	NA	NA	NA	NA
WP_002209743.1|2006943_2008152_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	50.8	5.4e-51
WP_002210828.1|2008199_2008550_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_002210829.1|2008885_2009722_+	5-dehydro-4-deoxy-D-glucuronate isomerase	NA	NA	NA	NA	NA
WP_002210830.1|2009813_2010575_+	2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.9	3.1e-20
WP_002220274.1|2010910_2011450_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001297096.1|2011459_2012239_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_000255944.1|2012238_2013261_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_002220836.1|2013319_2014537_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002210832.1|2014577_2015468_+	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_002210833.1|2015460_2016381_+	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_002210834.1|2016394_2017522_+	ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	26.5	1.6e-12
WP_002210835.1|2017537_2018830_+	carbohydrate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002210836.1|2019127_2019838_+	porin	NA	NA	NA	NA	NA
WP_002210837.1|2020317_2020866_+	metal-dependent hydrolase	NA	A0A127AVX7	Bacillus_phage	32.9	4.0e-09
WP_002210838.1|2021069_2022461_+	L-cystine transporter	NA	NA	NA	NA	NA
WP_002210839.1|2022675_2023527_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1W6DX33	Sphingobium_phage	28.8	1.3e-11
WP_002210840.1|2023911_2024703_-	DNA-binding transcriptional regulator KdgR	NA	NA	NA	NA	NA
WP_002210841.1|2024889_2026056_-	oligogalacturonate lyase	NA	NA	NA	NA	NA
WP_002210842.1|2026382_2027750_+	MFS transporter	NA	NA	NA	NA	NA
WP_002210843.1|2027803_2028607_-	molecular chaperone	NA	NA	NA	NA	NA
WP_002210844.1|2029762_2032375_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_002215118.1|2032456_2033236_-	fimbrial chaperone	NA	NA	NA	NA	NA
WP_002210846.1|2033388_2033931_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_002210847.1|2034588_2035470_-|protease	protease HtpX	protease	NA	NA	NA	NA
WP_002210848.1|2035943_2038016_-	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	34.8	4.0e-86
WP_002210849.1|2038035_2038749_-	RNA chaperone ProQ	NA	NA	NA	NA	NA
WP_002210850.1|2038844_2039342_-	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_032484561.1|2039573_2040812_+	membrane integrity lipid transport subunit YebS	NA	NA	NA	NA	NA
WP_002220828.1|2040789_2043432_+	PqiB family protein	NA	NA	NA	NA	NA
WP_002210852.1|2043910_2044465_+|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
WP_002216613.1|2044470_2045001_+|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
WP_002216611.1|2045021_2045579_+|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
>prophage 8
NC_008150	Yersinia pestis Antiqua, complete sequence	4702289	2330939	2400928	4702289	transposase,tRNA,plate	Escherichia_phage(28.57%)	59	NA	NA
WP_002209727.1|2330939_2331821_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_002264667.1|2331820_2332831_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_002209725.1|2333000_2334128_-	4-phosphoerythronate dehydrogenase PdxB	NA	A0A285PXZ1	Cedratvirus	27.9	6.1e-20
WP_002209724.1|2334174_2334960_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_002209722.1|2335185_2336103_+	DMT family transporter	NA	NA	NA	NA	NA
WP_002209721.1|2336387_2337425_+	flagella biosynthesis regulator Flk	NA	NA	NA	NA	NA
WP_002209720.1|2337766_2338297_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_002209718.1|2339087_2339780_+	aspartate/glutamate racemase family protein	NA	NA	NA	NA	NA
WP_002209717.1|2340187_2341411_-	beta-ketoacyl-ACP synthase I	NA	NA	NA	NA	NA
WP_002209716.1|2341582_2343652_+|tRNA	bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	tRNA	NA	NA	NA	NA
WP_002209715.1|2343829_2344108_-	YfcL family protein	NA	NA	NA	NA	NA
WP_002209714.1|2344165_2344708_-	elongation factor P hydroxylase	NA	NA	NA	NA	NA
WP_002209713.1|2344807_2345614_-	TSUP family transporter	NA	NA	NA	NA	NA
WP_002225365.1|2345617_2346445_-	penicillin-insensitive murein endopeptidase	NA	NA	NA	NA	NA
WP_002209711.1|2346450_2347536_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	47.4	2.7e-89
WP_002209710.1|2347612_2348545_-	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_002227846.1|2348914_2349445_+	endonuclease SmrB	NA	NA	NA	NA	NA
WP_002225709.1|2349609_2349783_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002209707.1|2349862_2350354_-	phosphohistidine phosphatase SixA	NA	NA	NA	NA	NA
WP_002209705.1|2350922_2353247_-	fatty acid oxidation complex subunit alpha FadJ	NA	NA	NA	NA	NA
WP_002209704.1|2353246_2354557_-	acetyl-CoA C-acyltransferase FadI	NA	NA	NA	NA	NA
WP_002227845.1|2354843_2355140_-	YfcZ/YiiS family protein	NA	NA	NA	NA	NA
WP_002209702.1|2355553_2356819_+	long-chain fatty acid transporter FadL	NA	NA	NA	NA	NA
WP_002209701.1|2356925_2357690_-	phospholipid-binding lipoprotein MlaA	NA	NA	NA	NA	NA
WP_002209700.1|2357725_2358952_-	c-type cytochrome biogenesis protein CcmI	NA	NA	NA	NA	NA
WP_002214855.1|2358951_2359464_-	cytochrome c-type biogenesis protein CcmH	NA	NA	NA	NA	NA
WP_002209699.1|2359460_2360027_-	DsbE family thiol:disulfide interchange protein	NA	NA	NA	NA	NA
WP_002209698.1|2360023_2361994_-	heme lyase CcmF/NrfE family subunit	NA	NA	NA	NA	NA
WP_002209697.1|2361990_2362485_-	cytochrome c maturation protein CcmE	NA	NA	NA	NA	NA
WP_002209696.1|2362481_2362784_-	heme exporter protein CcmD	NA	NA	NA	NA	NA
WP_002209695.1|2362780_2363518_-	heme ABC transporter permease	NA	NA	NA	NA	NA
WP_002209694.1|2363580_2364240_-	heme exporter protein CcmB	NA	NA	NA	NA	NA
WP_002209693.1|2364209_2364866_-	cytochrome c biogenesis heme-transporting ATPase CcmA	NA	A0A1V0SE00	Indivirus	24.7	4.8e-09
WP_002209692.1|2365310_2365778_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002209691.1|2366393_2366936_+	LemA family protein	NA	NA	NA	NA	NA
WP_002209690.1|2366940_2368980_+	DUF2207 domain-containing protein	NA	NA	NA	NA	NA
WP_002209688.1|2369355_2369697_+	alkylphosphonate utilization protein	NA	NA	NA	NA	NA
WP_002209687.1|2369771_2370119_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002264654.1|2370143_2370623_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_002209685.1|2370719_2371526_-	ImpE family protein	NA	NA	NA	NA	NA
WP_002354537.1|2371545_2372388_-	TagK domain-containing protein	NA	NA	NA	NA	NA
WP_002209684.1|2372393_2372654_-	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_002214843.1|2375884_2379712_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_001297096.1|2380572_2381352_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_000255944.1|2381351_2382374_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_002211571.1|2383052_2384402_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_002211572.1|2384405_2384945_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_002211573.1|2385218_2385704_-	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_002211574.1|2386029_2387532_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_002211575.1|2387555_2388080_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_002211576.1|2388184_2388793_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_002211577.1|2388777_2389968_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_002209743.1|2389992_2391201_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	50.8	5.4e-51
WP_002215157.1|2391222_2392773_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_002211579.1|2392900_2393662_-	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_002211580.1|2393818_2394364_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_002215317.1|2394564_2397240_-	type VI secretion system ATPase TssH	NA	A0A223W0B1	Agrobacterium_phage	32.3	1.0e-81
WP_002211582.1|2398022_2399903_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_002211583.1|2399902_2400928_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
>prophage 9
NC_008150	Yersinia pestis Antiqua, complete sequence	4702289	2663080	2671630	4702289	transposase	Bacillus_virus(33.33%)	7	NA	NA
WP_002212210.1|2663080_2664280_-	glycine betaine/L-proline ABC transporter ATP-binding protein ProV	NA	G3M9Y6	Bacillus_virus	37.0	7.1e-27
WP_002212211.1|2664955_2665927_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	A0A0N7CCA3	Skermania_phage	74.3	3.1e-137
WP_002212212.1|2666051_2668202_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	V9VI16	Lactococcus_phage	51.8	1.1e-211
WP_002215935.1|2668183_2668588_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	G3MBF1	Bacillus_virus	32.8	3.5e-10
WP_002212214.1|2668601_2668838_-	redoxin NrdH	NA	V5UN81	Mycobacterium_phage	53.3	5.9e-18
WP_002212215.1|2669358_2669724_+	acid shock protein	NA	NA	NA	NA	NA
WP_002209743.1|2670421_2671630_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	50.8	5.4e-51
>prophage 10
NC_008150	Yersinia pestis Antiqua, complete sequence	4702289	2823600	2868750	4702289	integrase,transposase,protease,tRNA	uncultured_virus(18.18%)	46	2839104:2839118	2866709:2866723
WP_002209743.1|2823600_2824809_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	50.8	5.4e-51
WP_071525544.1|2824872_2826375_+	penicillin-binding protein 1C	NA	NA	NA	NA	NA
WP_002209745.1|2826587_2826833_-	helix-turn-helix domain-containing protein	NA	A0A2I7S995	Vibrio_phage	64.2	7.2e-19
WP_002209746.1|2828354_2828756_+	DUF1240 domain-containing protein	NA	NA	NA	NA	NA
WP_002209748.1|2828988_2829390_+	DUF1240 domain-containing protein	NA	NA	NA	NA	NA
WP_002209749.1|2829401_2829974_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_002227852.1|2829997_2830249_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002209751.1|2830287_2830527_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002209752.1|2831335_2833252_+	autotransporter adhesin YapC	NA	NA	NA	NA	NA
WP_002224869.1|2833375_2833498_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002209753.1|2833786_2834368_+	AbiEi antitoxin N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_002209743.1|2834769_2835978_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	50.8	5.4e-51
WP_002209756.1|2836429_2838637_+	DUF4401 domain-containing protein	NA	NA	NA	NA	NA
WP_002209757.1|2838629_2839160_+	GDYXXLXY domain-containing protein	NA	NA	NA	NA	NA
2839104:2839118	attL	TCGGCGTTGCTGACC	NA	NA	NA	NA
WP_002209758.1|2839318_2841700_+	glycoside hydrolase family 3 C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_002209759.1|2841778_2843407_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002215244.1|2843423_2843567_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002209762.1|2843879_2844731_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	41.1	1.2e-49
WP_002209763.1|2844756_2845746_+	aldo/keto reductase	NA	NA	NA	NA	NA
WP_002209764.1|2845800_2846694_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000255944.1|2846787_2847810_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_001297096.1|2847809_2848589_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_002215253.1|2848955_2849261_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002209765.1|2849357_2849759_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002209766.1|2849740_2851060_-	phosphatase PAP2/dual specificity phosphatase family protein	NA	NA	NA	NA	NA
WP_002209767.1|2851052_2852816_-	bifunctional alpha/beta hydrolase/class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_002209768.1|2852812_2853445_-	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_002209769.1|2853454_2854384_-	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_002209770.1|2854376_2854979_-	CDP-alcohol phosphatidyltransferase family protein	NA	NA	NA	NA	NA
WP_002354559.1|2855378_2855585_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079866998.1|2855796_2856075_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y6Q1	Salmonella_phage	73.5	4.2e-31
WP_002215266.1|2856157_2856496_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002228356.1|2856631_2857129_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002215268.1|2857242_2857443_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002215270.1|2857701_2857884_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_002209774.1|2858238_2859105_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	34.1	2.2e-30
WP_002209775.1|2859119_2859332_+	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_002213775.1|2859478_2859937_-|transposase	IS200/IS605-like element IS1541B family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	8.5e-13
WP_002222677.1|2860283_2861669_-|tRNA	cysteine--tRNA ligase	tRNA	A0A0G2Y344	Acanthamoeba_polyphaga_mimivirus	28.5	2.2e-40
WP_002208567.1|2861879_2862374_+	peptidylprolyl isomerase B	NA	NA	NA	NA	NA
WP_002208568.1|2862384_2863107_+	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_002208569.1|2863402_2863927_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	NA	NA	NA	NA
WP_002208570.1|2863923_2864988_+	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_002208571.1|2865031_2867461_-	ABC transporter permease	NA	NA	NA	NA	NA
2866709:2866723	attR	GGTCAGCAACGCCGA	NA	NA	NA	NA
WP_002208572.1|2867457_2868144_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.2	1.6e-31
WP_002208573.1|2868114_2868750_+|protease	multifunctional acyl-CoA thioesterase I/protease I/lysophospholipase L1	protease	NA	NA	NA	NA
>prophage 11
NC_008150	Yersinia pestis Antiqua, complete sequence	4702289	3695862	3789635	4702289	transposase,plate,protease	Escherichia_phage(33.33%)	43	NA	NA
WP_002216348.1|3695862_3696699_+|protease	rhomboid family intramembrane serine protease GlpG	protease	NA	NA	NA	NA
WP_002208930.1|3696733_3697492_+	DeoR/GlpR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001297096.1|3698258_3699038_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_000255944.1|3699037_3700060_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_002214014.1|3701193_3703560_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_002214016.1|3703563_3703761_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002211643.1|3704199_3705477_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_002211642.1|3705489_3708609_+	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_002211641.1|3708743_3710234_-	ShET2/EspL2 family type III secretion system effector toxin	NA	NA	NA	NA	NA
WP_002211640.1|3710511_3711099_+	copper-binding periplasmic metallochaperone CueP	NA	NA	NA	NA	NA
WP_011566339.1|3711952_3723070_+	autotransporter adhesin YapH	NA	A0A2L1IV18	Escherichia_phage	37.8	1.6e-133
WP_002211637.1|3723172_3725053_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011055744.1|3725448_3725535_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002214025.1|3725615_3726491_-	IpaH family type III secretion system E3 ubiquitin--protein ligase	NA	NA	NA	NA	NA
WP_002213775.1|3726820_3727279_+|transposase	IS200/IS605-like element IS1541B family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	8.5e-13
WP_002211636.1|3727410_3729228_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002211634.1|3729946_3731503_+	AbgT family transporter	NA	NA	NA	NA	NA
WP_002211633.1|3731580_3732813_+	peptidase T	NA	A0A0K2CPK3	Brevibacillus_phage	39.1	1.2e-05
WP_002211632.1|3733200_3735273_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_000255944.1|3738850_3739873_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_001297096.1|3739872_3740652_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_002211387.1|3740859_3747318_+	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	25.0	8.5e-42
WP_002214915.1|3747325_3749014_+	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	25.0	3.1e-36
WP_011566340.1|3749026_3754810_+	non-ribosomal peptide synthetase	NA	A0A2K9L3I8	Tupanvirus	31.3	1.3e-41
WP_002224891.1|3754806_3755877_+	NAD-dependent epimerase/dehydratase family protein	NA	NA	NA	NA	NA
WP_002211390.1|3755873_3757001_+	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_002214925.1|3756993_3757758_+	thioesterase	NA	NA	NA	NA	NA
WP_002211392.1|3757747_3759052_+	MFS transporter	NA	NA	NA	NA	NA
WP_002214927.1|3759051_3760824_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	25.6	7.8e-30
WP_002211394.1|3760816_3762574_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	24.0	6.7e-34
WP_002211395.1|3762896_3763772_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002228079.1|3764207_3764606_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002223676.1|3766145_3767489_+	gluconate permease GntP	NA	NA	NA	NA	NA
WP_011566341.1|3772838_3775088_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	27.0	1.2e-27
WP_002211401.1|3775113_3776433_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002211402.1|3776446_3780763_+	RHS domain-containing protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	49.6	1.8e-27
WP_097608211.1|3780893_3781280_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002211404.1|3781823_3782237_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002211405.1|3782416_3783787_-	DASS family sodium-coupled anion symporter	NA	NA	NA	NA	NA
WP_002211406.1|3784068_3785088_-	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_002211407.1|3785381_3786545_+	cellulase family glycosylhydrolase	NA	NA	NA	NA	NA
WP_100067904.1|3786434_3787789_-|transposase	IS3-like element IS1661 family transposase	transposase	A0A1B1P773	Bacillus_phage	44.7	1.1e-55
WP_002213885.1|3788546_3789635_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
>prophage 12
NC_008150	Yersinia pestis Antiqua, complete sequence	4702289	3908861	3976658	4702289	transposase,tRNA	Escherichia_phage(28.57%)	54	NA	NA
WP_002209003.1|3908861_3909554_+|tRNA	tRNA (guanosine(18)-2'-O)-methyltransferase TrmH	tRNA	NA	NA	NA	NA
WP_002209004.1|3909554_3911636_+	ATP-dependent DNA helicase RecG	NA	NA	NA	NA	NA
WP_071529784.1|3911827_3911920_+	gluconate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_002209005.1|3912001_3913216_-	sodium/glutamate symporter	NA	NA	NA	NA	NA
WP_002209006.1|3913453_3914839_+	uracil-xanthine permease	NA	H9YQ34	environmental_Halophage	80.0	3.8e-56
WP_002209007.1|3914986_3916696_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002209008.1|3916830_3917754_-	fatty acid biosynthesis protein FabY	NA	NA	NA	NA	NA
WP_000255944.1|3918023_3919046_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_001297096.1|3919045_3919825_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_002209009.1|3919898_3920336_-|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
WP_002209010.1|3920342_3921227_-	virulence factor BrkB family protein	NA	NA	NA	NA	NA
WP_002209011.1|3921323_3921914_-	glucose-1-phosphatase	NA	NA	NA	NA	NA
WP_002217380.1|3922235_3924059_-	ribosome-dependent GTPase TypA	NA	A0A2K5B2A5	Erysipelothrix_phage	42.3	1.2e-20
WP_002213150.1|3924620_3926030_+	glutamate--ammonia ligase	NA	NA	NA	NA	NA
WP_002213759.1|3926297_3926756_+|transposase	IS200/IS605-like element IS1541A family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	8.5e-13
WP_002213151.1|3926992_3928042_+	nitrogen regulation protein NR(II)	NA	Q8QKV7	Ectocarpus_siliculosus_virus	25.2	4.2e-07
WP_002213152.1|3928049_3929462_+	nitrogen regulation protein NR(I)	NA	Q56AR1	Bacillus_thuringiensis_phage	25.6	3.1e-05
WP_002213155.1|3929515_3930889_-	oxygen-independent coproporphyrinogen III oxidase	NA	NA	NA	NA	NA
WP_002213158.1|3931071_3931638_-	Der GTPase-activating protein YihI	NA	NA	NA	NA	NA
WP_002213160.1|3932382_3933033_+	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_002213775.1|3933284_3933743_-|transposase	IS200/IS605-like element IS1541B family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	8.5e-13
WP_002213164.1|3934151_3936950_-	DNA polymerase I	NA	A0A218MKQ4	uncultured_virus	32.8	2.7e-69
WP_002213168.1|3937441_3938065_-	thiol:disulfide interchange protein DsbA	NA	NA	NA	NA	NA
WP_002213169.1|3938092_3939079_-	serine/threonine protein kinase	NA	NA	NA	NA	NA
WP_002213170.1|3939158_3939428_-	YihD family protein	NA	NA	NA	NA	NA
WP_002213171.1|3939581_3940169_+	molybdenum cofactor guanylyltransferase MobA	NA	NA	NA	NA	NA
WP_002217538.1|3940168_3940699_+	molybdopterin-guanine dinucleotide biosynthesis protein B	NA	NA	NA	NA	NA
WP_002220999.1|3940756_3941965_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	50.8	5.4e-51
WP_000255944.1|3948263_3949286_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_001297096.1|3949285_3950065_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_002210424.1|3950326_3950713_-	8-oxo-dGTP diphosphatase MutT	NA	A0A0B5CYJ3	Rhizoctonia_fumigata_mycovirus	30.4	8.4e-06
WP_002210426.1|3951007_3953722_-	preprotein translocase subunit SecA	NA	NA	NA	NA	NA
WP_002210427.1|3953799_3954333_-	secA regulator SecM	NA	NA	NA	NA	NA
WP_002210428.1|3954361_3954886_+	DUF721 domain-containing protein	NA	NA	NA	NA	NA
WP_002228285.1|3955052_3955973_-	UDP-3-O-acyl-N-acetylglucosamine deacetylase	NA	NA	NA	NA	NA
WP_002210430.1|3956072_3957224_-	cell division protein FtsZ	NA	NA	NA	NA	NA
WP_002210431.1|3957296_3958553_-	cell division protein FtsA	NA	NA	NA	NA	NA
WP_002228100.1|3958579_3959407_-	cell division protein FtsQ	NA	NA	NA	NA	NA
WP_002210432.1|3959408_3960329_-	D-alanine--D-alanine ligase	NA	NA	NA	NA	NA
WP_002216457.1|3960321_3961797_-	UDP-N-acetylmuramate--L-alanine ligase	NA	NA	NA	NA	NA
WP_002210434.1|3961934_3963005_-	undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase	NA	NA	NA	NA	NA
WP_002210435.1|3963001_3964204_-	cell division protein FtsW	NA	NA	NA	NA	NA
WP_002210436.1|3964203_3965520_-	UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase	NA	NA	NA	NA	NA
WP_002210437.1|3965522_3966605_-	phospho-N-acetylmuramoyl-pentapeptide- transferase	NA	NA	NA	NA	NA
WP_002210438.1|3966598_3967975_-	UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D- alanine ligase	NA	NA	NA	NA	NA
WP_002210439.1|3967971_3969459_-	UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2, 6-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_002210440.1|3969445_3971209_-	peptidoglycan glycosyltransferase FtsI	NA	NA	NA	NA	NA
WP_002210441.1|3971274_3971592_-	cell division protein FtsL	NA	NA	NA	NA	NA
WP_002210442.1|3971588_3972551_-	16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH	NA	NA	NA	NA	NA
WP_002210443.1|3972553_3973012_-	division/cell wall cluster transcriptional repressor MraZ	NA	NA	NA	NA	NA
WP_087768171.1|3973566_3973656_-	gluconate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_002210446.1|3974113_3974554_+	L-alanine exporter AlaE	NA	NA	NA	NA	NA
WP_002210447.1|3974684_3975695_-	catabolite repressor/activator	NA	NA	NA	NA	NA
WP_002213759.1|3976199_3976658_-|transposase	IS200/IS605-like element IS1541A family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	8.5e-13
>prophage 13
NC_008150	Yersinia pestis Antiqua, complete sequence	4702289	3984233	4054229	4702289	transposase,plate	Escherichia_phage(26.67%)	48	NA	NA
WP_002213775.1|3984233_3984692_+|transposase	IS200/IS605-like element IS1541B family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	8.5e-13
WP_002210453.1|3984838_3986401_+	2-isopropylmalate synthase	NA	NA	NA	NA	NA
WP_002210454.1|3986403_3987495_+	3-isopropylmalate dehydrogenase	NA	NA	NA	NA	NA
WP_002210455.1|3987496_3988927_+	3-isopropylmalate dehydratase large subunit	NA	NA	NA	NA	NA
WP_002220586.1|3988941_3989544_+	3-isopropylmalate dehydratase small subunit	NA	NA	NA	NA	NA
WP_002397472.1|3989784_3990036_-	sugar transporter	NA	NA	NA	NA	NA
WP_000255944.1|3990123_3991146_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_001297096.1|3991145_3991925_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_002210461.1|3993588_3995250_+	HTH-type transcriptional regulator SgrR	NA	NA	NA	NA	NA
WP_002214274.1|3996189_3997182_+	thiamine ABC transporter substrate binding subunit	NA	NA	NA	NA	NA
WP_002214276.1|3997157_3998765_+	thiamine/thiamine pyrophosphate ABC transporter permease ThiP	NA	NA	NA	NA	NA
WP_002210464.1|3998751_3999462_+	thiamine ABC transporter ATP-binding protein ThiQ	NA	G3M9Y6	Bacillus_virus	34.1	1.0e-20
WP_002210465.1|3999530_4000298_-	DedA family protein	NA	NA	NA	NA	NA
WP_002210466.1|4000493_4002863_+	DNA polymerase II	NA	A0A0P0YM26	Yellowstone_lake_phycodnavirus	25.5	1.5e-31
WP_002220588.1|4003307_4006214_+	RNA polymerase-associated protein RapA	NA	A0A1B1IUI1	uncultured_Mediterranean_phage	37.6	3.0e-23
WP_002210468.1|4006469_4006823_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002210469.1|4010347_4011958_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_002210470.1|4011954_4013310_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_002210471.1|4013429_4013921_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_002214737.1|4013913_4014279_-	DUF4150 domain-containing protein	NA	NA	NA	NA	NA
WP_002210473.1|4014284_4014902_-	DUF3540 domain-containing protein	NA	NA	NA	NA	NA
WP_002214739.1|4014894_4015998_-	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_002220595.1|4018255_4020595_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	32.9	2.1e-14
WP_002210475.1|4020698_4023287_-	type VI secretion system ATPase TssH	NA	A0A248SJW6	Salicola_phage	28.7	1.9e-77
WP_002210476.1|4023304_4024288_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_002210477.1|4024280_4026125_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_002210478.1|4026157_4026601_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_002210479.1|4026674_4027193_-	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_000255944.1|4028317_4029340_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_001297096.1|4029339_4030119_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_086016626.1|4030783_4031883_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.2	2.2e-46
WP_002210692.1|4038209_4039799_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	49.4	2.2e-68
WP_002210691.1|4039858_4041145_+	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_002355296.1|4041292_4041946_-	DUF1481 domain-containing protein	NA	NA	NA	NA	NA
WP_002210689.1|4041995_4042271_-	DNA-binding protein HU-alpha	NA	A7KV42	Bacillus_phage	55.6	3.6e-19
WP_002210688.1|4042459_4043050_-	YjaG family protein	NA	NA	NA	NA	NA
WP_002210687.1|4043095_4043836_-	deoxyribonuclease V	NA	NA	NA	NA	NA
WP_002210686.1|4043865_4044933_-	uroporphyrinogen decarboxylase	NA	NA	NA	NA	NA
WP_002210685.1|4045051_4045837_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002210684.1|4045929_4046712_-	NAD(+) diphosphatase	NA	NA	NA	NA	NA
WP_002210683.1|4046808_4047318_+	sigma D regulator	NA	NA	NA	NA	NA
WP_002210682.1|4047693_4049739_+	phosphomethylpyrimidine synthase ThiC	NA	NA	NA	NA	NA
WP_002210681.1|4049725_4050400_+	thiamine phosphate synthase	NA	NA	NA	NA	NA
WP_002210680.1|4050389_4051187_+	HesA/MoeB/ThiF family protein	NA	A0A1V0SAV8	Catovirus	27.8	1.6e-11
WP_002217275.1|4051183_4051399_+	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
WP_002228257.1|4051400_4052216_+	thiazole synthase	NA	NA	NA	NA	NA
WP_002210678.1|4052208_4053339_+	2-iminoacetate synthase ThiH	NA	NA	NA	NA	NA
WP_002213759.1|4053770_4054229_+|transposase	IS200/IS605-like element IS1541A family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	8.5e-13
>prophage 14
NC_008150	Yersinia pestis Antiqua, complete sequence	4702289	4132034	4189748	4702289	tail,transposase,protease,holin	uncultured_Mediterranean_phage(18.18%)	47	NA	NA
WP_002210082.1|4132034_4133480_+|protease	metalloprotease TldD	protease	NA	NA	NA	NA
WP_002210083.1|4133682_4136541_-	RHS repeat protein	NA	NA	NA	NA	NA
WP_002210084.1|4136565_4139397_-	RHS repeat protein	NA	NA	NA	NA	NA
WP_002210086.1|4139597_4139957_-	DUF2570 domain-containing protein	NA	NA	NA	NA	NA
WP_002210087.1|4139953_4140355_-	M15 family metallopeptidase	NA	A0A249XWK9	Proteus_phage	61.0	3.6e-36
WP_002214300.1|4140367_4140670_-|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_002210089.1|4140803_4145294_-	toxin	NA	NA	NA	NA	NA
WP_002220204.1|4145350_4148944_-|tail	phage tail tape measure protein	tail	NA	NA	NA	NA
WP_002214297.1|4151710_4152577_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002210092.1|4152837_4153749_-	HTH-type transcriptional activator AaeR	NA	NA	NA	NA	NA
WP_002210093.1|4154051_4154255_+	AaeX family protein	NA	NA	NA	NA	NA
WP_002210094.1|4154262_4155198_+	p-hydroxybenzoic acid efflux pump subunit AaeA	NA	NA	NA	NA	NA
WP_002210095.1|4155199_4157155_+	p-hydroxybenzoic acid efflux pump subunit AaeB	NA	NA	NA	NA	NA
WP_002214288.1|4159084_4159558_+	ribonuclease Ba	NA	NA	NA	NA	NA
WP_002210098.1|4159562_4159844_+	ribonuclease inhibitor	NA	NA	NA	NA	NA
WP_002210099.1|4159955_4160504_-	ribosome-associated protein	NA	NA	NA	NA	NA
WP_002210100.1|4160684_4162025_+|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
WP_011055205.1|4162273_4162918_+	hypothetical protein	NA	A0A1B0VBK8	Salmonella_phage	49.0	3.4e-52
WP_002210102.1|4163125_4163512_+	cytochrome b562	NA	NA	NA	NA	NA
WP_002210103.1|4163743_4164154_-	nucleoside diphosphate kinase regulator	NA	NA	NA	NA	NA
WP_002210104.1|4164506_4166174_-	alpha,alpha-phosphotrehalase	NA	NA	NA	NA	NA
WP_002215779.1|4166268_4167684_-	PTS trehalose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_002210106.1|4168094_4169048_-	HTH-type transcriptional regulator TreR	NA	NA	NA	NA	NA
WP_002210107.1|4169281_4169758_-	PliI family lysozyme inhibitor of I-type lysozyme	NA	NA	NA	NA	NA
WP_002210109.1|4170056_4170443_-	2-iminobutanoate/2-iminopropanoate deaminase	NA	NA	NA	NA	NA
WP_002210110.1|4170580_4171045_-	aspartate carbamoyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_002210111.1|4171056_4171992_-	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	38.5	1.5e-48
WP_002210112.1|4172329_4172602_-	PTS phosphocarrier protein NPr	NA	NA	NA	NA	NA
WP_002210113.1|4172598_4173453_-	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	30.0	3.2e-05
WP_002213952.1|4173758_4174241_-	PTS IIA-like nitrogen regulatory protein PtsN	NA	NA	NA	NA	NA
WP_002210115.1|4174669_4176103_-	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_002210116.1|4176164_4176890_-	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	1.4e-22
WP_002210117.1|4176896_4177442_-	lipopolysaccharide ABC transporter substrate-binding protein LptA	NA	NA	NA	NA	NA
WP_002218352.1|4177425_4177989_-	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_002228203.1|4177985_4178549_-	3-deoxy-manno-octulosonate-8-phosphatase KdsC	NA	A0A140XBD6	Dickeya_phage	83.0	9.6e-59
WP_002210119.1|4178797_4179784_-	arabinose-5-phosphate isomerase KdsD	NA	A0A2P0VNK5	Tetraselmis_virus	30.8	6.0e-40
WP_002210120.1|4179894_4180869_-	calcium/sodium antiporter	NA	NA	NA	NA	NA
WP_002210121.1|4181133_4181952_+	phospholipid ABC transporter ATP-binding protein MlaF	NA	G3M9Y6	Bacillus_virus	31.7	2.2e-19
WP_002210122.1|4182169_4182952_+	lipid asymmetry maintenance ABC transporter permease subunit MlaE	NA	NA	NA	NA	NA
WP_002210123.1|4182956_4183514_+	outer membrane lipid asymmetry maintenance protein MlaD	NA	NA	NA	NA	NA
WP_002210124.1|4183526_4184150_+	phospholipid-binding protein MlaC	NA	NA	NA	NA	NA
WP_002210125.1|4184185_4184488_+	lipid asymmetry maintenance protein MlaB	NA	NA	NA	NA	NA
WP_002210126.1|4184634_4184889_+	BolA family iron metabolism protein IbaG	NA	NA	NA	NA	NA
WP_002210127.1|4185042_4186305_+	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_002210128.1|4186485_4187574_-	outer membrane-stress sensor serine endopeptidase DegS	NA	A0A1B1IRD3	uncultured_Mediterranean_phage	31.8	2.1e-09
WP_002213775.1|4187799_4188258_+|transposase	IS200/IS605-like element IS1541B family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	8.5e-13
WP_002218066.1|4188374_4189748_-|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	28.2	7.4e-20
>prophage 15
NC_008150	Yersinia pestis Antiqua, complete sequence	4702289	4588138	4660689	4702289	integrase,transposase,tRNA	Escherichia_phage(25.0%)	59	4630726:4630741	4643587:4643602
WP_002213759.1|4588138_4588597_+|transposase	IS200/IS605-like element IS1541A family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	8.5e-13
WP_002210504.1|4589049_4589871_+	4-hydroxy-tetrahydrodipicolinate reductase	NA	NA	NA	NA	NA
WP_002224759.1|4590343_4591519_+	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	34.3	6.9e-51
WP_002210502.1|4591534_4594768_+	carbamoyl-phosphate synthase large subunit	NA	NA	NA	NA	NA
WP_002210501.1|4594995_4595610_-	LysE family translocator	NA	NA	NA	NA	NA
WP_002210499.1|4595933_4596734_+	threonine/serine exporter ThrE family protein	NA	NA	NA	NA	NA
WP_002210498.1|4596730_4597186_+	threonine/serine exporter	NA	NA	NA	NA	NA
WP_002210497.1|4597335_4597818_+	type 3 dihydrofolate reductase	NA	A0A219UQN5	Bacillus_phage	42.6	4.7e-30
WP_002213775.1|4598029_4598488_+|transposase	IS200/IS605-like element IS1541B family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	8.5e-13
WP_071525509.1|4598929_4599244_+	DUF3757 domain-containing protein	NA	NA	NA	NA	NA
WP_002210493.1|4599370_4599835_+	DUF3757 domain-containing protein	NA	NA	NA	NA	NA
WP_002210492.1|4599924_4600794_-	bis(5'-nucleosyl)-tetraphosphatase (symmetrical) ApaH	NA	NA	NA	NA	NA
WP_002210491.1|4600810_4601188_-	Co2+/Mg2+ efflux protein ApaG	NA	NA	NA	NA	NA
WP_002210490.1|4601201_4602020_-	16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))- dimethyltransferase RsmA	NA	NA	NA	NA	NA
WP_002210489.1|4602012_4603008_-	4-hydroxythreonine-4-phosphate dehydrogenase PdxA	NA	NA	NA	NA	NA
WP_002220723.1|4602991_4604296_-	peptidylprolyl isomerase SurA	NA	NA	NA	NA	NA
WP_002228111.1|4604363_4606706_-	LPS assembly protein LptD	NA	NA	NA	NA	NA
WP_002210486.1|4606890_4607724_+	co-chaperone DjlA	NA	NA	NA	NA	NA
WP_002210485.1|4608021_4608642_-|tRNA	bifunctional tRNA pseudouridine(32) synthase/23S rRNA pseudouridine(746) synthase RluA	tRNA	NA	NA	NA	NA
WP_002214747.1|4609864_4610608_-	DUF2285 domain-containing protein	NA	NA	NA	NA	NA
WP_002210482.1|4610937_4611951_+	ImpA family type VI secretion system protein	NA	NA	NA	NA	NA
WP_002210481.1|4611961_4612522_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_001297096.1|4613230_4614010_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_000255944.1|4614009_4615032_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_002209570.1|4615910_4616501_-	transcriptional regulator UhpA	NA	NA	NA	NA	NA
WP_002220725.1|4616616_4618308_-	kdo(2)-lipid A phosphoethanolamine 7''-transferase	NA	NA	NA	NA	NA
WP_002209573.1|4618836_4620300_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_002214368.1|4620767_4622171_-	amino acid permease	NA	NA	NA	NA	NA
WP_002209575.1|4622588_4624121_-	histidine ammonia-lyase	NA	A0A1V0S940	Catovirus	39.1	1.1e-83
WP_002209576.1|4624117_4625809_-	urocanate hydratase	NA	NA	NA	NA	NA
WP_002209577.1|4626535_4627480_+	PLP-dependent cysteine synthase family protein	NA	NA	NA	NA	NA
WP_002209578.1|4627476_4628043_+	adenine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_002209579.1|4628125_4629055_+	EamA family transporter	NA	NA	NA	NA	NA
WP_000255944.1|4629564_4630587_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_001297096.1|4630586_4631366_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
4630726:4630741	attL	TTCATGAAGAAAAACT	NA	NA	NA	NA
WP_002209581.1|4632782_4633736_+	siderophore ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002209582.1|4633745_4634705_+	ABC transporter permease	NA	A0A2H4IY97	uncultured_Caudovirales_phage	39.3	2.7e-61
WP_002209583.1|4634694_4635702_+	iron chelate uptake ABC transporter family permease subunit	NA	NA	NA	NA	NA
WP_002209584.1|4635698_4636457_+	ABC transporter ATP-binding protein	NA	A0A285PWH2	Cedratvirus	28.6	1.2e-16
WP_002214364.1|4636453_4636954_-	virulence RhuM family protein	NA	Q9JMN3	Wolbachia_phage	49.4	1.0e-35
WP_002214362.1|4637189_4637375_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072085081.1|4637371_4637545_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_071525517.1|4638183_4638396_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_002209585.1|4638458_4638821_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_002214358.1|4639965_4640211_+	ogr/Delta-like zinc finger family protein	NA	Q7M294	Enterobacteria_phage	52.6	3.5e-13
WP_002209586.1|4640478_4641858_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002209587.1|4641844_4643038_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	80.6	2.4e-184
WP_002209588.1|4643423_4644617_-	DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
4643587:4643602	attR	AGTTTTTCTTCATGAA	NA	NA	NA	NA
WP_002209589.1|4644706_4645891_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_002209590.1|4645877_4647410_-	xylose ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.4	8.5e-17
WP_002209591.1|4647617_4648613_-	D-xylose ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002209593.1|4649075_4650395_+	xylose isomerase	NA	NA	NA	NA	NA
WP_002209594.1|4650518_4651973_+	xylulokinase	NA	NA	NA	NA	NA
WP_002209595.1|4652090_4653077_-	fimbrial protein	NA	NA	NA	NA	NA
WP_002209596.1|4653115_4653883_-	molecular chaperone	NA	NA	NA	NA	NA
WP_002209597.1|4656541_4657099_-	fimbrial protein	NA	NA	NA	NA	NA
WP_002209600.1|4657980_4658973_-	acyltransferase	NA	NA	NA	NA	NA
WP_002209601.1|4658969_4659170_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100067904.1|4659335_4660689_+|transposase	IS3-like element IS1661 family transposase	transposase	A0A1B1P773	Bacillus_phage	44.7	1.1e-55
>prophage 1
NC_008122	Yersinia pestis Antiqua plasmid pCD, complete sequence	70299	87	53249	70299	transposase,protease	Enterobacteria_phage(37.5%)	60	NA	NA
WP_000255944.1|87_1110_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_001297096.1|1109_1889_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_002212907.1|2721_3069_-	type III secretion system exported negative regulator LcrQ/YscM1	NA	NA	NA	NA	NA
WP_010981371.1|3293_3959_-	SctL family type III secretion system stator protein YscL	NA	NA	NA	NA	NA
WP_002361471.1|3904_4534_-	type III secretion system sorting platform protein YscK	NA	NA	NA	NA	NA
WP_002212912.1|4533_5268_-	SctJ family type III secretion inner membrane ring lipoprotein YscJ	NA	NA	NA	NA	NA
WP_002212914.1|5274_5622_-	SctI family type III secretion system inner rod subunit LcrO	NA	NA	NA	NA	NA
WP_002212915.1|5622_6120_-	T3SS polymerization control protein YopR	NA	NA	NA	NA	NA
WP_002229801.1|6116_6464_-	type III secretion system chaperone YscG	NA	NA	NA	NA	NA
WP_002212916.1|6465_6729_-	type III secretion system needle filament protein YscF	NA	NA	NA	NA	NA
WP_002212917.1|6729_6930_-	type III secretion system co-chaperone YscE	NA	NA	NA	NA	NA
WP_002212919.1|6926_8186_-	SctD family type III secretion system inner membrane ring subunit YscD	NA	NA	NA	NA	NA
WP_002212923.1|8182_10006_-	SctC family type III secretion system outer membrane ring subunit YscC	NA	NA	NA	NA	NA
WP_002212925.1|10011_10425_-	type III secretion system chaperone YscB	NA	NA	NA	NA	NA
WP_002229797.1|10650_10749_-	type III secretion system protein YscA	NA	NA	NA	NA	NA
WP_002212931.1|10827_11643_-	virulence regulon transcriptional activator VirF	NA	NA	NA	NA	NA
WP_002222527.1|11766_12162_-	type III secretion system pilotin YscW	NA	NA	NA	NA	NA
WP_002212936.1|12737_13802_-	type III secretion system export apparatus switch protein YscU	NA	NA	NA	NA	NA
WP_002212938.1|13801_14587_-	SctT family type III secretion system export apparatus subunit YscT	NA	NA	NA	NA	NA
WP_002212945.1|14583_14850_-	SctS family type III secretion system export apparatus subunit YscS	NA	NA	NA	NA	NA
WP_002212947.1|14851_15505_-	SctR family type III secretion system export apparatus subunit YscR	NA	NA	NA	NA	NA
WP_002212948.1|15501_16425_-	SctQ family type III secretion system cytoplasmic ring protein YscQ	NA	NA	NA	NA	NA
WP_002212950.1|16421_17789_-	type III secretion system needle length determinant YscP	NA	NA	NA	NA	NA
WP_002212952.1|17788_18253_-	type III secretion system central stalk protein YscO	NA	NA	NA	NA	NA
WP_002212955.1|18249_19569_-	SctN family type III secretion system ATPase YscN	NA	NA	NA	NA	NA
WP_002212958.1|19766_20648_+	SctW family type III secretion system gatekeeper subunit YopN	NA	NA	NA	NA	NA
WP_002212965.1|20628_20907_+	type III secretion system gatekeeper subunit TyeA	NA	NA	NA	NA	NA
WP_002229794.1|20893_21265_+	type III secretion chaperone SycN	NA	NA	NA	NA	NA
WP_002212969.1|21261_21630_+	type III secretion system protein YscX	NA	NA	NA	NA	NA
WP_002229791.1|21626_21971_+	type III secretion system chaperone YscY	NA	NA	NA	NA	NA
WP_002212971.1|21957_24072_+	SctV family type III secretion system export apparatus subunit LcrD	NA	NA	NA	NA	NA
WP_002220918.1|24068_24509_+	type III secretion system chaperone LcrR	NA	NA	NA	NA	NA
WP_002212973.1|24550_24838_+	type III secretion system chaperone LcrG	NA	NA	NA	NA	NA
WP_002212981.1|24839_25820_+	type III secretion system needle tip protein LcrV	NA	NA	NA	NA	NA
WP_002222758.1|25832_26339_+	type III secretion system chaperone SycD/LcrH	NA	NA	NA	NA	NA
WP_002212985.1|26316_27522_+	type III secretion system translocon subunit YopB	NA	NA	NA	NA	NA
WP_002212987.1|27540_28461_+	type III secretion system translocon subunit YopD	NA	NA	NA	NA	NA
WP_002229781.1|29586_29796_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002229779.1|30189_31419_+	type III secretion system effector YopM	NA	NA	NA	NA	NA
WP_116442925.1|31660_31906_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_002222515.1|32654_33074_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002213004.1|33778_34177_-	type III secretion system chaperone SycT	NA	NA	NA	NA	NA
WP_002213006.1|34176_35145_-|protease	T3SS effector cysteine protease YopT	protease	NA	NA	NA	NA
WP_002213007.1|35644_36193_+	type III secretion system effector YopK	NA	NA	NA	NA	NA
WP_002229770.1|36790_37420_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002220902.1|39431_40598_+	plasmid-partitioning protein SopA	NA	Q7Y3Y6	Yersinia_phage	85.3	3.5e-196
WP_002213354.1|40594_41560_+	ParB/RepB/Spo0J family plasmid partition protein	NA	Q7Y3Y7	Yersinia_phage	56.6	3.1e-89
WP_154020274.1|41719_41956_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002213357.1|42104_42278_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002224342.1|42821_43064_+	type II toxin-antitoxin system ParD family antitoxin	NA	NA	NA	NA	NA
WP_002213360.1|43056_43356_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_002229754.1|43495_44155_-	type III secretion system effector GTPase activator YopE	NA	NA	NA	NA	NA
WP_002213403.1|44348_44741_+	type III secretion system chaperone SycE/YerA	NA	NA	NA	NA	NA
WP_002220893.1|45550_46723_+|transposase	IS21 family transposase	transposase	U5N3F9	Enterobacteria_phage	95.4	1.6e-220
WP_002213267.1|47495_47921_+	type III secretion system chaperone SycH	NA	NA	NA	NA	NA
WP_086016640.1|48068_49168_-|transposase	IS3-like element ISYpe1 family transposase	transposase	S5WIU1	Leptospira_phage	38.5	1.4e-45
WP_002229829.1|49267_49597_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002224338.1|49735_50200_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002213258.1|50218_50770_-	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	80.3	5.9e-77
WP_002220934.1|50933_53249_+|transposase	Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	51.5	5.0e-279
>prophage 1
NC_008120	Yersinia pestis Antiqua plasmid pMT, complete sequence	96471	88	61975	96471	transposase,terminase,tail	Salmonella_phage(89.83%)	61	NA	NA
WP_000255944.1|88_1111_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_001297096.1|1110_1890_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_002211769.1|2023_2632_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	62.2	4.8e-64
WP_002211770.1|2933_5822_-|tail	phage tail protein	tail	J9Q6E3	Salmonella_phage	33.1	4.5e-11
WP_002211771.1|5902_6481_-	DUF4376 domain-containing protein	NA	Q9LA61	Enterobacterial_phage	38.8	3.4e-27
WP_002214118.1|6537_11169_-	DUF1983 domain-containing protein	NA	J9Q713	Salmonella_phage	88.6	0.0e+00
WP_002211773.1|11190_11778_-|tail	tail assembly protein	tail	J9Q7F8	Salmonella_phage	92.8	5.1e-103
WP_002211774.1|11765_12563_-	C40 family peptidase	NA	J9Q7R4	Salmonella_phage	96.2	1.4e-156
WP_002211775.1|12555_13254_-|tail	phage minor tail protein L	tail	J9Q7Y5	Salmonella_phage	99.1	7.1e-136
WP_002221062.1|13343_13679_-|tail	phage tail protein	tail	J9Q6E1	Salmonella_phage	96.4	1.1e-57
WP_000952684.1|18305_18530_-	hypothetical protein	NA	J9Q7F7	Salmonella_phage	100.0	4.2e-34
WP_000163862.1|18655_18973_-	hypothetical protein	NA	J9Q7R3	Salmonella_phage	98.1	6.0e-50
WP_002211778.1|19032_19779_-	Ig domain-containing protein	NA	J9Q7Y4	Salmonella_phage	98.8	5.2e-129
WP_002211779.1|19853_20237_-	hypothetical protein	NA	J9Q6D8	Salmonella_phage	98.4	1.1e-66
WP_002211780.1|20238_20712_-	hypothetical protein	NA	J9Q711	Salmonella_phage	99.4	8.9e-82
WP_001027662.1|20702_21047_-	hypothetical protein	NA	J9Q7F6	Salmonella_phage	100.0	1.9e-57
WP_002211781.1|21144_21978_-	hypothetical protein	NA	J9Q7R2	Salmonella_phage	99.6	2.9e-152
WP_002211782.1|21977_22412_-	hypothetical protein	NA	J9Q7Y3	Salmonella_phage	99.3	3.1e-73
WP_002211783.1|22455_23118_-	Ig domain-containing protein	NA	J9Q6D6	Salmonella_phage	97.2	8.5e-107
WP_002211784.1|23192_24068_-	hypothetical protein	NA	J9Q710	Salmonella_phage	99.7	8.5e-163
WP_002211785.1|24094_24928_-	hypothetical protein	NA	J9Q7F4	Salmonella_phage	91.3	5.8e-137
WP_002211786.1|24950_26525_-	hypothetical protein	NA	J9Q7R1	Salmonella_phage	99.2	2.4e-301
WP_002211787.1|26558_27815_-|terminase	terminase	terminase	J9Q7Y2	Salmonella_phage	100.0	1.8e-251
WP_002211788.1|27817_28459_-	hypothetical protein	NA	J9Q6D4	Salmonella_phage	98.1	1.2e-108
WP_000176291.1|28654_28921_-	hypothetical protein	NA	J9Q757	Salmonella_phage	100.0	1.3e-42
WP_002211789.1|28930_29821_-	hypothetical protein	NA	J9Q7I6	Salmonella_phage	99.7	6.2e-169
WP_002211790.1|29826_30081_-	hypothetical protein	NA	J9Q7U0	Salmonella_phage	97.6	2.0e-40
WP_002211791.1|30073_30712_-	ATP-binding cassette domain-containing protein	NA	J9Q807	Salmonella_phage	98.1	4.7e-110
WP_002211792.1|30708_31377_-	ParB N-terminal domain-containing protein	NA	J9Q6L1	Salmonella_phage	98.2	9.5e-114
WP_002228791.1|31376_32075_-	ParB N-terminal domain-containing protein	NA	J9Q756	Salmonella_phage	98.7	9.6e-125
WP_002211794.1|32139_33699_+	DEAD/DEAH box helicase	NA	J9Q7I4	Salmonella_phage	99.0	1.1e-293
WP_002214131.1|33701_33980_+	hypothetical protein	NA	J9Q7T9	Salmonella_phage	97.8	4.4e-41
WP_002211796.1|34039_34462_+	hypothetical protein	NA	J9Q806	Salmonella_phage	85.0	4.1e-62
WP_002214134.1|34466_34994_+	transcriptional regulator	NA	J9Q6L0	Salmonella_phage	98.0	6.4e-81
WP_002211799.1|35316_35967_+	hypothetical protein	NA	J9Q754	Salmonella_phage	99.5	4.1e-114
WP_002214137.1|36051_36279_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002213775.1|36388_36847_-|transposase	IS200/IS605-like element IS1541B family transposase	transposase	D9CGB6	Hyperthermophilic_Archaeal_Virus_2	35.3	5.0e-13
WP_002214145.1|37055_37625_-	hypothetical protein	NA	J9Q7Z7	Salmonella_phage	100.0	5.8e-104
WP_002213303.1|37637_38384_-	hypothetical protein	NA	J9Q6J5	Salmonella_phage	96.4	4.1e-134
WP_002214148.1|38373_40290_-	AAA family ATPase	NA	J9Q741	Salmonella_phage	98.6	0.0e+00
WP_002213300.1|40519_41605_-	metallophosphoesterase	NA	J9Q7S9	Salmonella_phage	98.6	7.7e-206
WP_002214160.1|43401_44046_-	hypothetical protein	NA	J9Q739	Salmonella_phage	98.1	1.8e-122
WP_002214164.1|44790_45855_+	replication protein RepA	NA	J9Q7H0	Salmonella_phage	98.6	2.4e-188
WP_002222711.1|46423_46636_-	hypothetical protein	NA	J9Q7S8	Salmonella_phage	95.7	6.8e-34
WP_002227818.1|46635_46971_-	hypothetical protein	NA	J9Q7Z5	Salmonella_phage	91.0	5.2e-52
WP_002228796.1|46967_47147_-	hypothetical protein	NA	J9Q6J1	Salmonella_phage	86.4	5.8e-18
WP_002228797.1|47187_47463_-	hypothetical protein	NA	J9Q738	Salmonella_phage	95.6	1.7e-45
WP_002221119.1|47530_47935_-	hypothetical protein	NA	J9Q7G9	Salmonella_phage	97.7	1.7e-70
WP_000255944.1|48004_49027_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_002222868.1|49877_50249_-	DUF2591 domain-containing protein	NA	J9Q7S7	Salmonella_phage	87.8	4.0e-61
WP_002222866.1|50402_51233_-	hypothetical protein	NA	J9Q7Z4	Salmonella_phage	98.6	9.3e-127
WP_002213439.1|51236_51437_-	hypothetical protein	NA	J9Q6J0	Salmonella_phage	97.0	1.1e-25
WP_000920226.1|52606_52873_-	hypothetical protein	NA	J9Q7G8	Salmonella_phage	100.0	1.6e-40
WP_002225551.1|52872_53817_-	exonuclease	NA	J9Q7S6	Salmonella_phage	99.0	1.3e-180
WP_002213132.1|53877_54906_-	hypothetical protein	NA	J9Q7Z3	Salmonella_phage	98.5	1.3e-165
WP_002213135.1|55025_55457_-	hypothetical protein	NA	J9Q6I8	Salmonella_phage	98.6	2.6e-72
WP_002215095.1|55677_55929_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002213141.1|56001_56565_+	DNA-binding protein	NA	J9Q7G7	Salmonella_phage	64.6	2.2e-63
WP_002425587.1|56594_57020_-	hypothetical protein	NA	J9Q7S4	Salmonella_phage	100.0	7.5e-72
WP_002221186.1|57034_60559_-	DNA polymerase III subunit alpha	NA	J9Q7Z2	Salmonella_phage	99.2	0.0e+00
WP_002211767.1|60739_61975_-	AAA family ATPase	NA	J9Q733	Salmonella_phage	99.3	3.0e-238
