The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_007777	Frankia casuarinae, complete sequence	5433628	123142	179987	5433628	transposase,integrase	Mycobacterium_virus(33.33%)	50	140139:140192	159255:159308
WP_011434576.1|123142_124507_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_011434577.1|124772_125201_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011434578.1|125241_125610_+	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_023840621.1|125719_126277_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011434582.1|128267_129806_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011434583.1|130056_131040_-	intradiol ring-cleavage dioxygenase	NA	NA	NA	NA	NA
WP_023840626.1|131257_131458_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011434584.1|131791_132205_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011434585.1|132381_134361_+	DEAD/DEAH box helicase	NA	NA	NA	NA	NA
WP_157858535.1|134395_134830_-|transposase	transposase	transposase	Q19ZT4	Mycobacterium_virus	45.9	4.3e-14
WP_011434587.1|135221_139001_-	methionine synthase	NA	A0A140XBC7	Dickeya_phage	61.3	3.4e-14
WP_083282414.1|139210_139558_-	hypothetical protein	NA	NA	NA	NA	NA
140139:140192	attL	GCCTGAAAAGCGGAAGGTCGGCGGTTCGACCCCGCCCCTGCCCACCACCTCTGA	NA	NA	NA	NA
WP_083503369.1|140304_141645_-|integrase	site-specific integrase	integrase	A0A1B0T6A8	Bacillus_phage	26.9	2.0e-30
WP_082456667.1|142954_143365_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_035958968.1|143541_144150_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_049761030.1|144128_144617_-	winged helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_011434594.1|144897_148125_+	NACHT domain-containing protein	NA	NA	NA	NA	NA
WP_011434595.1|148288_149023_+|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
WP_011434596.1|149098_150523_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_011434597.1|151405_152596_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_011434598.1|153064_154531_-	SAVED domain-containing protein	NA	NA	NA	NA	NA
WP_011434599.1|154537_155449_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_011434600.1|155445_155955_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011434601.1|155957_156923_-	nucleotidyltransferase	NA	NA	NA	NA	NA
WP_011434602.1|157062_157398_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_011434603.1|157381_157909_+	ImmA/IrrE family metallo-endopeptidase	NA	Q854W5	Mycobacterium_virus	39.4	2.5e-08
WP_011434604.1|158018_158840_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011434605.1|160041_161406_-|transposase	IS110 family transposase	transposase	Q9JMN8	Wolbachia_phage	31.5	4.4e-41
159255:159308	attR	GCCTGAAAAGCGGAAGGTCGGCGGTTCGACCCCGCCCCTGCCCACCACCTCTGA	NA	NA	NA	NA
WP_011434606.1|161701_162172_-	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_131728957.1|162175_162826_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_023842162.1|163069_163372_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049761031.1|163403_163628_+	hypothetical protein	NA	NA	NA	NA	NA
WP_139168599.1|164303_164501_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023842166.1|165030_165240_+	hypothetical protein	NA	NA	NA	NA	NA
WP_131728958.1|165333_165717_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011434612.1|165716_165908_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157858587.1|166634_167696_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023842169.1|168190_168370_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023842171.1|168613_169264_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011434616.1|169564_170038_-	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_011434617.1|170021_170291_-	type II toxin-antitoxin system prevent-host-death family antitoxin	NA	NA	NA	NA	NA
WP_011434618.1|170919_171693_-|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
WP_011434619.1|171893_173606_+|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
WP_157858537.1|174167_174713_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011434621.1|174884_175619_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_011434622.1|175761_176376_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_011434623.1|176372_176858_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_157858538.1|177102_177582_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	28.0	3.6e-06
WP_011434625.1|177774_179004_+	3-carboxy-cis,cis-muconate cycloisomerase	NA	NA	NA	NA	NA
WP_011434626.1|179234_179987_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NC_007777	Frankia casuarinae, complete sequence	5433628	1131989	1213914	5433628	transposase,integrase	Bacillus_phage(33.33%)	57	1127271:1127288	1217036:1217053
1127271:1127288	attL	CGACCAGCGCCGCGAGCT	NA	NA	NA	NA
WP_011435410.1|1131989_1132445_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_011435411.1|1132522_1133056_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_011435413.1|1133944_1134694_+|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
WP_011435414.1|1134956_1137977_+	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_108913785.1|1137991_1138591_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023841309.1|1140685_1140862_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023841308.1|1141126_1142944_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_011435418.1|1142940_1144623_+	4-amino-4-deoxy-L-arabinose transferase	NA	NA	NA	NA	NA
WP_041257794.1|1144854_1145085_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011435420.1|1145166_1147803_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	33.6	3.8e-41
WP_011435421.1|1147974_1148547_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011435422.1|1148569_1149052_+	Rieske (2Fe-2S) protein	NA	NA	NA	NA	NA
WP_011435423.1|1149112_1149664_+	FHA domain-containing protein	NA	NA	NA	NA	NA
WP_011435424.1|1149716_1150100_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011435425.1|1150113_1150914_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_011435426.1|1151738_1152257_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011435427.1|1152440_1153943_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_011435428.1|1154593_1155637_-	SDR family NAD(P)-dependent oxidoreductase	NA	A0A2H4UUK0	Bodo_saltans_virus	28.5	2.0e-25
WP_011435429.1|1155742_1156882_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	23.6	7.7e-15
WP_148214905.1|1156946_1157750_-	response regulator	NA	W8CYM9	Bacillus_phage	36.2	3.0e-37
WP_011435431.1|1157938_1158619_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_011435432.1|1158630_1159353_+	DUF2064 domain-containing protein	NA	NA	NA	NA	NA
WP_085949886.1|1159430_1160072_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_011435434.1|1160004_1160514_-	hypothetical protein	NA	NA	NA	NA	NA
WP_173645825.1|1160486_1161854_-	molybdopterin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_011435436.1|1161852_1163328_+	DUF2029 domain-containing protein	NA	NA	NA	NA	NA
WP_076806614.1|1163650_1164466_-	metalloregulator ArsR/SmtB family transcription factor	NA	NA	NA	NA	NA
WP_063613394.1|1165298_1165610_-	hypothetical protein	NA	NA	NA	NA	NA
WP_131728922.1|1165644_1166892_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011435438.1|1167234_1167672_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_035730973.1|1173721_1174708_-	beta-ketoacyl-ACP synthase 3	NA	NA	NA	NA	NA
WP_011435442.1|1174729_1177960_-	type I polyketide synthase	NA	NA	NA	NA	NA
WP_131728921.1|1178210_1180649_-	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
WP_023841295.1|1181215_1183123_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_011435445.1|1183119_1184094_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011435446.1|1184252_1185611_+	cation:proton antiporter	NA	NA	NA	NA	NA
WP_023841293.1|1186906_1187647_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_023841292.1|1187789_1188311_-	lipocalin-like domain-containing protein	NA	NA	NA	NA	NA
WP_011435450.1|1188602_1189940_-	crotonyl-CoA carboxylase/reductase	NA	NA	NA	NA	NA
WP_011435451.1|1189980_1191759_-	NAD(P)-binding domain-containing protein	NA	NA	NA	NA	NA
WP_011435453.1|1193909_1194464_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035730986.1|1194964_1195783_+	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_011435455.1|1195982_1198160_+	EAL domain-containing protein	NA	G3MA91	Bacillus_virus	31.6	6.4e-18
WP_157493315.1|1198532_1198685_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011435456.1|1198730_1199582_+	GvpL/GvpF family gas vesicle protein	NA	NA	NA	NA	NA
WP_011435457.1|1199757_1200189_+	gas vesicle structural protein GvpA	NA	NA	NA	NA	NA
WP_011435458.1|1200194_1201013_+	GvpL/GvpF family gas vesicle protein	NA	NA	NA	NA	NA
WP_011435459.1|1201115_1201661_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082456736.1|1201615_1202344_-	arsenate reductase ArsC	NA	NA	NA	NA	NA
WP_023841286.1|1202781_1203990_-	acyl-CoA dehydrogenase family protein	NA	NA	NA	NA	NA
WP_011435462.1|1204483_1205935_+	alkaline phosphatase D family protein	NA	NA	NA	NA	NA
WP_049760843.1|1206167_1207571_+	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	NA	NA	NA	NA
WP_011435464.1|1207573_1207846_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011435465.1|1207869_1209063_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082456848.1|1210479_1210941_+|integrase	tyrosine-type recombinase/integrase	integrase	S5MNZ2	Brevibacillus_phage	42.4	5.9e-06
WP_011435467.1|1210972_1212196_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_108913766.1|1212861_1213914_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
1217036:1217053	attR	AGCTCGCGGCGCTGGTCG	NA	NA	NA	NA
>prophage 3
NC_007777	Frankia casuarinae, complete sequence	5433628	1266361	1359078	5433628	integrase,transposase,bacteriocin,holin,protease	Streptomyces_phage(28.57%)	74	1278634:1278650	1372078:1372093
WP_011435513.1|1266361_1268236_-|holin	choline/carnitine O-acyltransferase	holin	NA	NA	NA	NA
WP_108913794.1|1268447_1269305_-	methyltransferase type 12	NA	NA	NA	NA	NA
WP_011435515.1|1269499_1270369_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011435516.1|1270988_1271453_-	hemerythrin domain-containing protein	NA	NA	NA	NA	NA
WP_011435517.1|1271802_1272426_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011435518.1|1272428_1273040_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011435519.1|1273234_1274296_-	hydrogenase expression/formation protein HypE	NA	NA	NA	NA	NA
WP_011435520.1|1274288_1275395_-	hydrogenase formation protein HypD	NA	NA	NA	NA	NA
WP_011435521.1|1275391_1275673_-	HypC/HybG/HupF family hydrogenase formation chaperone	NA	NA	NA	NA	NA
WP_011435522.1|1275676_1278223_-	carbamoyltransferase HypF	NA	NA	NA	NA	NA
WP_011435523.1|1278219_1279308_-	NHL repeat-containing protein	NA	NA	NA	NA	NA
1278634:1278650	attL	GACCAGCAGCCGGTCGG	NA	NA	NA	NA
WP_011435524.1|1279454_1280705_-	hypothetical protein	NA	NA	NA	NA	NA
1278634:1278650	attL	GACCAGCAGCCGGTCGG	NA	NA	NA	NA
WP_011435525.1|1280767_1281334_-|protease	hydrogenase maturation protease	protease	NA	NA	NA	NA
WP_011435526.1|1281347_1282955_-	nickel-dependent hydrogenase large subunit	NA	NA	NA	NA	NA
WP_011435527.1|1283030_1284002_-	hydrogenase	NA	NA	NA	NA	NA
WP_023841586.1|1284429_1284924_+	hydrogenase maturation nickel metallochaperone HypA	NA	NA	NA	NA	NA
WP_011435529.1|1284930_1285824_+	hydrogenase nickel incorporation protein HypB	NA	NA	NA	NA	NA
WP_035733742.1|1286101_1286323_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011435531.1|1286516_1287821_-	TIGR02679 family protein	NA	NA	NA	NA	NA
WP_108913591.1|1287817_1292131_-	TIGR02680 family protein	NA	NA	NA	NA	NA
WP_011435533.1|1292145_1293414_-	TIGR02678 family protein	NA	NA	NA	NA	NA
WP_085949863.1|1293410_1295288_-	TIGR02677 family protein	NA	NA	NA	NA	NA
WP_011435535.1|1296261_1297698_-	FAD-binding oxidoreductase	NA	S4VXI2	Pandoravirus	29.5	7.7e-36
WP_011435537.1|1300560_1301055_+	hypothetical protein	NA	NA	NA	NA	NA
WP_193359378.1|1301086_1301407_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011435539.1|1303461_1303659_+	ribbon-helix-helix protein, CopG family	NA	NA	NA	NA	NA
WP_011435540.1|1303655_1304036_+	type II toxin-antitoxin system death-on-curing family toxin	NA	A0A1B3AYM0	Gordonia_phage	46.7	5.5e-18
WP_082456783.1|1304712_1305375_+	DUF433 domain-containing protein	NA	NA	NA	NA	NA
WP_011435543.1|1305377_1305821_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011435544.1|1305923_1306652_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_011435546.1|1307961_1309959_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011435547.1|1309955_1311128_-	5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase	NA	NA	NA	NA	NA
WP_011435548.1|1311130_1311880_-	NUDIX hydrolase	NA	A0A0E3JJF3	Streptomyces_phage	44.4	1.3e-13
WP_011435549.1|1312683_1313082_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011435550.1|1313123_1316426_-	N-6 DNA methylase	NA	NA	NA	NA	NA
WP_134351940.1|1317511_1318846_+|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
WP_011435553.1|1318990_1320430_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_157858594.1|1320594_1320828_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_011435555.1|1321239_1322889_+|transposase	ISAzo13-like element ISFsp13 family transposase	transposase	NA	NA	NA	NA
1322666:1322682	attR	CCGACCGGCTGCTGGTC	NA	NA	NA	NA
WP_011435556.1|1322973_1324188_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
1322666:1322682	attR	CCGACCGGCTGCTGGTC	NA	NA	NA	NA
WP_011435557.1|1324318_1325155_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011435558.1|1325173_1325617_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082456844.1|1325658_1326669_+	cytochrome P450	NA	NA	NA	NA	NA
WP_011435560.1|1326674_1327139_+	aspartate 1-decarboxylase	NA	NA	NA	NA	NA
WP_173645828.1|1327153_1328095_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_035734604.1|1329547_1330192_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011435565.1|1330191_1330536_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011435566.1|1330563_1331979_+	MFS transporter	NA	A0A0M3UL24	Mycobacterium_phage	33.0	3.9e-40
WP_052154563.1|1332154_1333237_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_011435567.1|1333246_1333606_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011435568.1|1333772_1334150_-	DUF3037 domain-containing protein	NA	NA	NA	NA	NA
WP_011435569.1|1334277_1335111_+|transposase	IS5-like element ISFsp7 family transposase	transposase	NA	NA	NA	NA
WP_011435570.1|1335453_1336731_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011435571.1|1337563_1338466_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011435572.1|1338465_1339506_-|bacteriocin	thiopeptide-type bacteriocin biosynthesis protein	bacteriocin	NA	NA	NA	NA
WP_011435573.1|1339487_1340705_-	lanthionine synthetase C family protein	NA	NA	NA	NA	NA
WP_011435574.1|1340701_1343791_-	lantibiotic dehydratase	NA	NA	NA	NA	NA
WP_023840439.1|1343815_1343986_-	FxLD family lanthipeptide	NA	NA	NA	NA	NA
WP_085949864.1|1344034_1345216_-	methyltransferase, FxLD system	NA	NA	NA	NA	NA
WP_035730121.1|1346187_1346397_-	DUF397 domain-containing protein	NA	NA	NA	NA	NA
WP_108913238.1|1346701_1347994_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011435577.1|1347996_1348569_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_023840445.1|1349472_1350369_+	restriction endonuclease	NA	NA	NA	NA	NA
WP_035730000.1|1350706_1351036_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011435580.1|1351543_1352092_+	HD domain-containing protein	NA	NA	NA	NA	NA
WP_011435581.1|1352079_1352550_-	NUDIX domain-containing protein	NA	A0A1L6UW58	Biomphalaria_virus	43.1	1.3e-05
WP_011435582.1|1352555_1353404_-	helix-turn-helix domain-containing protein	NA	Q1WDJ8	Streptomyces_phage	30.4	6.4e-22
WP_011435583.1|1353635_1353911_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035910131.1|1353907_1354399_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011435585.1|1354446_1354935_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_011435586.1|1355119_1355524_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011435587.1|1355520_1355847_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011435589.1|1357261_1357561_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011435590.1|1357809_1359078_+|integrase	site-specific integrase	integrase	A0A1B0T6A8	Bacillus_phage	27.7	1.8e-33
1372078:1372093	attR	GGTGCCCTCGACGTCG	NA	NA	NA	NA
>prophage 4
NC_007777	Frankia casuarinae, complete sequence	5433628	1997494	2006501	5433628		Bacillus_phage(16.67%)	9	NA	NA
WP_023841555.1|1997494_1998301_+	Fe-S cluster assembly ATPase SufC	NA	W8CYL7	Bacillus_phage	24.8	1.4e-05
WP_011436103.1|1998297_1999626_+	cysteine desulfurase	NA	Q2XUY6	environmental_halophage	47.1	2.8e-109
WP_011436104.1|1999622_2000141_+	SUF system NifU family Fe-S cluster assembly protein	NA	A0A0K1LS29	Mycobacterium_phage	45.2	1.5e-21
WP_011436105.1|2000137_2000587_+	metal-sulfur cluster assembly factor	NA	NA	NA	NA	NA
WP_011436106.1|2000814_2002053_+	glucose-1-phosphate adenylyltransferase	NA	A0A291LA53	Escherichia_phage	23.8	7.1e-06
WP_011436107.1|2002165_2003401_+	glycogen synthase	NA	NA	NA	NA	NA
WP_023841554.1|2003423_2004428_-	dTDP-glucose 4,6-dehydratase	NA	A0A140G5S6	Enterobacteria_phage	40.3	4.4e-62
WP_023841553.1|2004431_2004680_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011436109.1|2004887_2006501_+	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L0W2	Tupanvirus	24.4	3.6e-42
>prophage 5
NC_007777	Frankia casuarinae, complete sequence	5433628	2059526	2113885	5433628	transposase	Shigella_phage(12.5%)	52	NA	NA
WP_011436164.1|2059526_2059817_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_083503472.1|2059813_2060707_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	39.8	7.1e-48
WP_083282554.1|2060970_2061150_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049761065.1|2061086_2062328_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011436167.1|2063499_2063949_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_011436168.1|2063940_2066907_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A0U4B6X0	Arthrobacter_phage	54.0	2.9e-05
WP_131728943.1|2066903_2067449_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011436170.1|2067331_2067778_-	pilus assembly protein	NA	NA	NA	NA	NA
WP_083503446.1|2067774_2068236_-	pilus assembly protein	NA	NA	NA	NA	NA
WP_035958833.1|2068718_2068913_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011436172.1|2068936_2069842_-	type II secretion system F family protein	NA	NA	NA	NA	NA
WP_011436173.1|2069838_2070747_-	pilus assembly protein TadB	NA	NA	NA	NA	NA
WP_011436174.1|2070743_2072189_-	CpaF family protein	NA	NA	NA	NA	NA
WP_011436175.1|2072185_2073007_-	hypothetical protein	NA	NA	NA	NA	NA
WP_108913817.1|2073011_2073701_-	flagellar biosynthesis protein FlgA	NA	NA	NA	NA	NA
WP_108913818.1|2073780_2074353_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167534327.1|2074799_2075417_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035958835.1|2075863_2076088_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011436180.1|2076084_2076735_+	2'-5' RNA ligase family protein	NA	NA	NA	NA	NA
WP_051569483.1|2076807_2077500_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011436182.1|2077502_2078234_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011436183.1|2078347_2079004_-	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_011436185.1|2079852_2080584_-	HAD family hydrolase	NA	NA	NA	NA	NA
WP_011436186.1|2080580_2081159_-	GTP cyclohydrolase I	NA	E7DN69	Pneumococcus_phage	45.5	1.9e-30
WP_131728945.1|2081149_2081734_-	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_108913822.1|2081733_2082912_-	UbiD family decarboxylase	NA	NA	NA	NA	NA
WP_011436189.1|2082992_2083529_-	phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_011436190.1|2083525_2084683_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	31.1	1.4e-51
WP_011436191.1|2084719_2085475_-	7-carboxy-7-deazaguanine synthase QueE	NA	A0A2P1JXY9	Rhodococcus_phage	38.2	4.2e-33
WP_011436192.1|2085471_2086419_-	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_035958845.1|2086420_2086792_-	6-carboxytetrahydropterin synthase	NA	S4U060	uncultured_phage	40.2	3.4e-12
WP_011436194.1|2087129_2088554_-	sulfatase-like hydrolase/transferase	NA	NA	NA	NA	NA
WP_011436196.1|2089421_2089754_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011436197.1|2089952_2090915_-	amidinotransferase	NA	NA	NA	NA	NA
WP_011436198.1|2090889_2092215_-	sulfotransferase	NA	NA	NA	NA	NA
WP_011436199.1|2092226_2094203_-	methyltransferase domain-containing protein	NA	G3M9Z3	Bacillus_virus	32.7	1.4e-48
WP_011436200.1|2094243_2094717_-	rubrerythrin	NA	NA	NA	NA	NA
WP_049761068.1|2096041_2097292_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_083282554.1|2097228_2097408_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011436202.1|2097792_2099217_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_011436203.1|2099587_2100775_+	sulfatase	NA	NA	NA	NA	NA
WP_011436204.1|2100764_2101178_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011436205.1|2101639_2102752_+	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_011436206.1|2102800_2104114_+	MFS transporter	NA	NA	NA	NA	NA
WP_011436207.1|2104159_2105347_+	cytochrome P450	NA	NA	NA	NA	NA
WP_035941816.1|2105745_2106699_+	adenosine deaminase	NA	NA	NA	NA	NA
WP_049760884.1|2106923_2107880_-	phosphotransferase	NA	NA	NA	NA	NA
WP_049760885.1|2107933_2109283_-	MFS transporter	NA	A0A0M3UL24	Mycobacterium_phage	36.0	9.4e-36
WP_023841610.1|2109522_2110335_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_011436212.1|2110334_2111411_-	sulfotransferase	NA	NA	NA	NA	NA
WP_011436213.1|2111426_2112605_-	radical SAM protein	NA	NA	NA	NA	NA
WP_049760812.1|2112601_2113885_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
>prophage 6
NC_007777	Frankia casuarinae, complete sequence	5433628	2160883	2208209	5433628	bacteriocin,transposase,integrase,tRNA	Acidithiobacillus_phage(66.67%)	47	2167059:2167075	2208600:2208616
WP_011436259.1|2160883_2161735_+|bacteriocin	thiopeptide-type bacteriocin biosynthesis protein	bacteriocin	NA	NA	NA	NA
WP_023842038.1|2161731_2162907_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011436261.1|2162860_2163715_-	DUF1932 domain-containing protein	NA	NA	NA	NA	NA
WP_023842037.1|2163730_2163928_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011436262.1|2163951_2164266_-	4a-hydroxytetrahydrobiopterin dehydratase	NA	NA	NA	NA	NA
WP_011436263.1|2164267_2165722_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011436264.1|2165855_2166155_-	4a-hydroxytetrahydrobiopterin dehydratase	NA	NA	NA	NA	NA
WP_011436265.1|2166147_2167707_-	hypothetical protein	NA	NA	NA	NA	NA
2167059:2167075	attL	GGCGGGCGCGGCCGGCG	NA	NA	NA	NA
WP_023842254.1|2168108_2168360_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011436267.1|2168465_2168753_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011436268.1|2168749_2169130_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011436269.1|2169126_2169831_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_011436270.1|2169950_2170199_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011436271.1|2170275_2171514_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011436272.1|2171510_2172314_-	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_011436273.1|2172930_2174460_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_011436274.1|2174456_2175245_+	5-formyltetrahydrofolate cyclo-ligase	NA	NA	NA	NA	NA
WP_162865199.1|2175845_2176007_+	hypothetical protein	NA	NA	NA	NA	NA
WP_108913628.1|2176269_2177028_+	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_011436277.1|2177076_2178006_+|bacteriocin	thiopeptide-type bacteriocin biosynthesis protein	bacteriocin	NA	NA	NA	NA
WP_023841963.1|2178296_2178911_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011436281.1|2179810_2180740_-	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_023841964.1|2181001_2181373_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023841965.1|2181451_2182120_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011436284.1|2182246_2183383_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023841966.1|2183561_2184002_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011436287.1|2184557_2185370_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011436289.1|2186393_2187029_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_011436290.1|2187140_2188004_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_011436291.1|2188173_2189244_+	DUF4037 domain-containing protein	NA	NA	NA	NA	NA
WP_085949889.1|2189588_2189939_+	helix-turn-helix domain-containing protein	NA	K4ICM4	Acidithiobacillus_phage	44.6	2.7e-11
WP_023841970.1|2189944_2190544_+	PIN domain-containing protein	NA	K4HZX4	Acidithiobacillus_phage	44.1	3.3e-25
WP_167534305.1|2191113_2191254_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011436295.1|2192616_2193231_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166793634.1|2193274_2194867_+	cytochrome P450	NA	NA	NA	NA	NA
WP_011436297.1|2194928_2195882_+	2-dehydropantoate 2-reductase	NA	NA	NA	NA	NA
WP_011436298.1|2196011_2197109_+	histidinol-phosphate transaminase	NA	A0A1X6WGT4	Pacmanvirus	26.6	1.5e-15
WP_011436299.1|2197227_2198688_+	RiPP maturation radical SAM C-methyltransferase	NA	NA	NA	NA	NA
WP_011436300.1|2198758_2200399_-|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
WP_167534311.1|2200367_2201003_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011436302.1|2200999_2201743_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011436303.1|2201880_2202993_-|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_011436304.1|2203187_2203727_+	winged helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_035959251.1|2203651_2204269_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_023842211.1|2204949_2206416_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_011436307.1|2206546_2206990_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011436308.1|2207078_2208209_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
2208600:2208616	attR	GGCGGGCGCGGCCGGCG	NA	NA	NA	NA
>prophage 7
NC_007777	Frankia casuarinae, complete sequence	5433628	2258114	2309891	5433628	transposase,protease	Orpheovirus(33.33%)	45	NA	NA
WP_011434743.1|2258114_2259755_-|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
WP_167534329.1|2259920_2260412_+	sulfotransferase family protein	NA	NA	NA	NA	NA
WP_035734094.1|2260513_2262004_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_011436358.1|2262411_2263227_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_011436359.1|2263507_2264434_-	acyl-ACP desaturase	NA	NA	NA	NA	NA
WP_011436360.1|2264465_2265386_-	class I SAM-dependent methyltransferase	NA	A0A2I2L5L3	Orpheovirus	23.0	1.6e-10
WP_011436361.1|2265382_2265643_-	acyl carrier protein	NA	NA	NA	NA	NA
WP_108913832.1|2265643_2266309_-	PaaI family thioesterase	NA	NA	NA	NA	NA
WP_108913607.1|2266389_2268285_-	AMP-binding protein	NA	NA	NA	NA	NA
WP_011436364.1|2269042_2270332_+	cytochrome P450	NA	NA	NA	NA	NA
WP_082456797.1|2270517_2271531_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_108913608.1|2271901_2273593_+	long-chain fatty acid--CoA ligase	NA	A0A1V0SBX8	Catovirus	23.1	8.5e-42
WP_011436367.1|2273685_2273922_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035734092.1|2273975_2275211_+	beta-ketoacyl-ACP synthase II	NA	NA	NA	NA	NA
WP_023841713.1|2275355_2275589_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011436370.1|2275681_2276320_-	DUF4389 domain-containing protein	NA	NA	NA	NA	NA
WP_011436371.1|2276720_2277131_+	hydrogenase maturation nickel metallochaperone HypA	NA	NA	NA	NA	NA
WP_011436372.1|2277082_2277934_+	hydrogenase nickel incorporation protein HypB	NA	NA	NA	NA	NA
WP_035941907.1|2278161_2279742_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011436374.1|2279738_2280344_+|protease	hydrogenase maturation protease	protease	NA	NA	NA	NA
WP_011436375.1|2280340_2281405_+	hydrogenase expression protein HypE	NA	NA	NA	NA	NA
WP_011436376.1|2281498_2283292_+	nickel-dependent hydrogenase large subunit	NA	NA	NA	NA	NA
WP_011436377.1|2283284_2283860_+	NifU family protein	NA	NA	NA	NA	NA
WP_023841716.1|2284567_2284780_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082456798.1|2284983_2287407_+	carbamoyltransferase HypF	NA	NA	NA	NA	NA
WP_011436380.1|2287414_2287717_+	HypC/HybG/HupF family hydrogenase formation chaperone	NA	NA	NA	NA	NA
WP_011436381.1|2287713_2288922_+	hydrogenase formation protein HypD	NA	NA	NA	NA	NA
WP_011436382.1|2288911_2289991_+	hydrogenase expression/formation protein HypE	NA	NA	NA	NA	NA
WP_011436383.1|2290593_2291019_+	cold shock domain-containing protein	NA	NA	NA	NA	NA
WP_148214935.1|2291271_2292396_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_011436385.1|2292693_2293770_+	toll/interleukin-1 receptor domain-containing protein	NA	NA	NA	NA	NA
WP_023840405.1|2294295_2294601_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011436388.1|2295482_2296895_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023840402.1|2297226_2297568_+	DUF397 domain-containing protein	NA	NA	NA	NA	NA
WP_070130442.1|2297560_2297863_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083771071.1|2297945_2298611_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011436391.1|2298607_2299135_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157858598.1|2300514_2300664_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011436393.1|2300822_2302085_-|transposase	IS110 family transposase	transposase	Q9JMN8	Wolbachia_phage	28.8	1.8e-36
WP_011436395.1|2302995_2303139_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049760812.1|2303458_2304742_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_011436396.1|2304751_2305471_-	PhzF family phenazine biosynthesis protein	NA	NA	NA	NA	NA
WP_011436397.1|2305620_2306157_+	DUF1003 domain-containing protein	NA	NA	NA	NA	NA
WP_011436398.1|2306247_2307450_-	cytochrome P450	NA	NA	NA	NA	NA
WP_108913766.1|2308838_2309891_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 8
NC_007777	Frankia casuarinae, complete sequence	5433628	2379767	2451718	5433628	transposase,bacteriocin	Ochrobactrum_phage(25.0%)	57	NA	NA
WP_085949890.1|2379767_2379944_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_085949870.1|2380168_2380991_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_082456818.1|2381013_2381676_-	FABP family protein	NA	NA	NA	NA	NA
WP_035959116.1|2381843_2385359_-	pyruvate:ferredoxin (flavodoxin) oxidoreductase	NA	NA	NA	NA	NA
WP_011436459.1|2385577_2386546_+	ParA family protein	NA	A0A240F4U1	Ochrobactrum_phage	28.3	8.9e-12
WP_011436461.1|2387388_2388540_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011436462.1|2388536_2389382_-|bacteriocin	thiopeptide-type bacteriocin biosynthesis protein	bacteriocin	NA	NA	NA	NA
WP_011436463.1|2389394_2390633_-	lanthionine synthetase C family protein	NA	NA	NA	NA	NA
WP_011436464.1|2390629_2393725_-	lantibiotic dehydratase	NA	NA	NA	NA	NA
WP_023841893.1|2393810_2394005_-	FxLD family lanthipeptide	NA	NA	NA	NA	NA
WP_011436465.1|2394075_2395302_-	methyltransferase, FxLD system	NA	NA	NA	NA	NA
WP_011436466.1|2396438_2397497_+	NAD-dependent epimerase	NA	NA	NA	NA	NA
WP_011436467.1|2397526_2397970_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011435557.1|2397988_2398825_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011436468.1|2399580_2400405_-	DUF3050 domain-containing protein	NA	A0A1L7N1A4	Ralstonia_phage	37.2	7.0e-34
WP_011436469.1|2400556_2400871_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035959128.1|2401613_2402066_+	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_011436471.1|2402254_2402515_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011436472.1|2402678_2403941_-	cytochrome P450	NA	NA	NA	NA	NA
WP_011436473.1|2403937_2405377_-	2-polyprenyl-6-methoxyphenol hydroxylase and related FAD-dependent oxidoreductase-like protein	NA	NA	NA	NA	NA
WP_011436474.1|2405392_2405806_-	PaaI family thioesterase	NA	NA	NA	NA	NA
WP_035959124.1|2405924_2407289_-	MFS transporter	NA	NA	NA	NA	NA
WP_011436476.1|2407410_2408898_-	AMP-binding protein	NA	A0A2H4PQM9	Staphylococcus_phage	26.8	1.9e-37
WP_131728960.1|2408899_2409133_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011436477.1|2409129_2410137_-	transglutaminase domain-containing protein	NA	NA	NA	NA	NA
WP_011436478.1|2410133_2410421_-	acyl carrier protein	NA	NA	NA	NA	NA
WP_157858590.1|2410434_2412057_-	AMP-binding protein	NA	Q75ZG1	Hepacivirus	23.7	1.1e-09
WP_167534312.1|2412077_2413787_-	AMP-binding protein	NA	NA	NA	NA	NA
WP_011434965.1|2414274_2416008_-|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
WP_049760812.1|2416798_2418082_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_083494934.1|2419164_2419896_+	HAD family hydrolase	NA	NA	NA	NA	NA
WP_049760897.1|2420136_2420733_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_011436484.1|2420933_2422574_+|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
WP_011436485.1|2422888_2423410_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_035734546.1|2423539_2424106_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011436487.1|2424174_2424618_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011436488.1|2424706_2425804_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_011434618.1|2425983_2426757_+|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
WP_011436491.1|2428606_2429926_-	tryptophan 7-halogenase	NA	NA	NA	NA	NA
WP_011436492.1|2429979_2431317_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011436493.1|2431321_2432596_-	aspartate aminotransferase family protein	NA	NA	NA	NA	NA
WP_011436494.1|2432595_2433753_-	FAD-dependent monooxygenase	NA	NA	NA	NA	NA
WP_011436495.1|2433793_2434894_-	3-dehydroquinate synthase II family protein	NA	NA	NA	NA	NA
WP_011436496.1|2434927_2435746_-	2-amino-4,5-dihydroxy-6-one-heptanoic acid-7-phosphate synthase	NA	NA	NA	NA	NA
WP_011436497.1|2435761_2436988_-	aspartate kinase	NA	NA	NA	NA	NA
WP_035959176.1|2437070_2437892_-	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_011434965.1|2437917_2439651_-|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
WP_011436499.1|2439715_2439955_-	hypothetical protein	NA	NA	NA	NA	NA
WP_108913441.1|2440106_2441372_-	aspartate aminotransferase family protein	NA	NA	NA	NA	NA
WP_011436501.1|2441753_2442944_+	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_023841880.1|2443118_2443502_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011434965.1|2444290_2446024_+|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
WP_011436503.1|2447406_2448243_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011435558.1|2448261_2448705_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023841846.1|2449148_2450045_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011436505.1|2450173_2450641_+	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_108913766.1|2450665_2451718_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 9
NC_007777	Frankia casuarinae, complete sequence	5433628	2684908	2722411	5433628	transposase,integrase	Microcystis_virus(20.0%)	41	2685031:2685047	2728183:2728199
WP_108913407.1|2684908_2685958_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
2685031:2685047	attL	CGGCGCGGGCGGCGGCG	NA	NA	NA	NA
WP_011436719.1|2686049_2686334_-	Sec-independent protein translocase subunit TatA	NA	NA	NA	NA	NA
WP_011436721.1|2686687_2686966_+	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_011436722.1|2687063_2687747_+	DUF2599 domain-containing protein	NA	NA	NA	NA	NA
WP_011436723.1|2687824_2688406_-	TIGR03086 family protein	NA	NA	NA	NA	NA
WP_011436724.1|2688412_2689009_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011436725.1|2689118_2689793_+	formylglycine-generating enzyme family protein	NA	A0A7F1	Microcystis_virus	43.1	1.9e-13
WP_011436726.1|2689870_2691298_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035959139.1|2691709_2692516_+	methylenetetrahydrofolate reductase	NA	NA	NA	NA	NA
WP_023841897.1|2693117_2694047_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011436729.1|2694043_2694559_-|transposase	Tn3 family transposase	transposase	NA	NA	NA	NA
WP_023841898.1|2694971_2695460_+	DinB family protein	NA	NA	NA	NA	NA
WP_167534314.1|2695626_2696151_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011436734.1|2699903_2700347_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011436735.1|2700552_2701782_-	MFS transporter	NA	NA	NA	NA	NA
WP_011436736.1|2701778_2702168_-	CrcB family protein	NA	NA	NA	NA	NA
WP_035733534.1|2702164_2702512_-	DUF190 domain-containing protein	NA	NA	NA	NA	NA
WP_011436738.1|2702508_2703030_-	CrcB family protein	NA	NA	NA	NA	NA
WP_035959142.1|2703296_2703704_-	arsenate reductase ArsC	NA	NA	NA	NA	NA
WP_049761082.1|2703739_2704492_-	aquaporin	NA	NA	NA	NA	NA
WP_011436741.1|2704534_2705056_-	VOC family protein	NA	NA	NA	NA	NA
WP_131728962.1|2705414_2706041_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_049760812.1|2706481_2707765_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_011436744.1|2707758_2708661_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_011436745.1|2709150_2709531_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023840322.1|2709527_2709785_-	hypothetical protein	NA	NA	NA	NA	NA
WP_108913870.1|2710039_2710249_+	hypothetical protein	NA	NA	NA	NA	NA
WP_108913869.1|2710321_2710669_-	type II toxin-antitoxin system PemK/MazF family toxin	NA	NA	NA	NA	NA
WP_035733467.1|2710677_2710947_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011436750.1|2711605_2712811_+	acyltransferase	NA	A9YX16	Burkholderia_phage	27.7	8.5e-12
WP_082456631.1|2712868_2713300_+	AMP-binding protein	NA	NA	NA	NA	NA
WP_082456630.1|2713324_2714224_+	tryptophan 7-halogenase	NA	NA	NA	NA	NA
WP_049760907.1|2714226_2714805_+	serine hydrolase family protein	NA	NA	NA	NA	NA
WP_023840318.1|2714892_2715057_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011436754.1|2715938_2716403_+	NUDIX pyrophosphatase	NA	NA	NA	NA	NA
WP_011436755.1|2716387_2716999_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011436756.1|2717073_2718042_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B1P7C7	Bacillus_phage	30.4	4.3e-22
WP_023840315.1|2718071_2718365_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035941181.1|2718363_2719314_+	site-specific DNA-methyltransferase	NA	G1D1F5	Mycobacterium_virus	52.6	4.5e-85
WP_011436758.1|2719346_2719664_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011436759.1|2719660_2722411_-|transposase	Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	40.5	2.3e-158
2728183:2728199	attR	CGGCGCGGGCGGCGGCG	NA	NA	NA	NA
>prophage 10
NC_007777	Frankia casuarinae, complete sequence	5433628	2925823	2999480	5433628	transposase	Pandoravirus(25.0%)	56	NA	NA
WP_049760812.1|2925823_2927107_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_049760913.1|2927327_2927762_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011436893.1|2928136_2929261_+	CapA family protein	NA	S4VS02	Pandoravirus	53.1	4.7e-105
WP_011436894.1|2929338_2930742_-	DUF1298 domain-containing protein	NA	NA	NA	NA	NA
WP_082456793.1|2931020_2932106_-	prephenate dehydratase	NA	NA	NA	NA	NA
WP_011436896.1|2932142_2933435_-	2-oxo acid dehydrogenase subunit E2	NA	NA	NA	NA	NA
WP_011436897.1|2933439_2934429_-	alpha-ketoacid dehydrogenase subunit beta	NA	NA	NA	NA	NA
WP_011436898.1|2934425_2935592_-	pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha	NA	NA	NA	NA	NA
WP_011436899.1|2936675_2938283_-	ubiquinol-cytochrome c reductase cytochrome b subunit	NA	NA	NA	NA	NA
WP_023841669.1|2938279_2939131_-	Rieske 2Fe-2S domain-containing protein	NA	NA	NA	NA	NA
WP_157493468.1|2939223_2939400_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011436902.1|2939489_2939933_-	cytochrome c oxidase subunit 4	NA	NA	NA	NA	NA
WP_108913839.1|2939929_2941696_-	cytochrome c oxidase subunit I	NA	NA	NA	NA	NA
WP_011436904.1|2941956_2943768_-	glycoside hydrolase family 15 protein	NA	NA	NA	NA	NA
WP_011436905.1|2944038_2945838_-	thiamine pyrophosphate-requiring protein	NA	NA	NA	NA	NA
WP_011436906.1|2946252_2947761_+	hopanoid C-3 methylase HpnR	NA	NA	NA	NA	NA
WP_011436907.1|2947844_2949029_-	cytochrome c oxidase assembly protein	NA	NA	NA	NA	NA
WP_011436908.1|2949055_2950384_-	Dyp-type peroxidase	NA	NA	NA	NA	NA
WP_108913840.1|2950380_2951112_-	SCO family protein	NA	NA	NA	NA	NA
WP_011436910.1|2951433_2951970_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011436911.1|2952050_2953931_+	chloride channel protein	NA	NA	NA	NA	NA
WP_011436912.1|2953900_2955085_-	acetyl-CoA acetyltransferase	NA	NA	NA	NA	NA
WP_011436913.1|2955147_2955834_-	CoA transferase subunit B	NA	NA	NA	NA	NA
WP_011436914.1|2955835_2956627_-	CoA transferase subunit A	NA	NA	NA	NA	NA
WP_011436915.1|2956628_2957441_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011436916.1|2957492_2959817_-	hydantoinase B/oxoprolinase family protein	NA	NA	NA	NA	NA
WP_011436917.1|2959852_2961979_-	hydantoinase/oxoprolinase family protein	NA	NA	NA	NA	NA
WP_023841948.1|2962001_2962430_-	acetone carboxylase subunit gamma	NA	NA	NA	NA	NA
WP_011436919.1|2962482_2964396_-	hydantoinase/oxoprolinase family protein	NA	NA	NA	NA	NA
WP_011436920.1|2964578_2966426_+	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_011436921.1|2966912_2967794_+	multicopper oxidase domain-containing protein	NA	NA	NA	NA	NA
WP_011436922.1|2967790_2968999_+	metal cation transporter	NA	NA	NA	NA	NA
WP_011436923.1|2969277_2970927_-	chaperonin GroEL	NA	A0A240F779	uncultured_virus	49.2	1.8e-134
WP_011436924.1|2971116_2972142_-	NAD(P)-dependent alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_011436925.1|2972178_2972895_-	iron-sulfur cluster assembly protein	NA	NA	NA	NA	NA
WP_011436926.1|2972891_2973929_-	amidohydrolase	NA	NA	NA	NA	NA
WP_049760914.1|2974016_2974325_-	MmoB/DmpM family protein	NA	NA	NA	NA	NA
WP_011436928.1|2974378_2975482_-	aromatic/alkene monooxygenase hydroxylase subunit beta	NA	NA	NA	NA	NA
WP_011436929.1|2975538_2976591_-	2Fe-2S iron-sulfur cluster binding domain-containing protein	NA	NA	NA	NA	NA
WP_011436930.1|2976785_2978435_-	aromatic/alkene/methane monooxygenase hydroxylase/oxygenase subunit alpha	NA	NA	NA	NA	NA
WP_049760915.1|2978859_2979615_+	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_011436484.1|2979611_2981252_-|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
WP_049760916.1|2981465_2982572_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011436931.1|2982678_2984442_-	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	35.7	2.4e-15
WP_157858592.1|2984640_2984805_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152987866.1|2985539_2985869_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023842136.1|2987094_2987670_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035734135.1|2988793_2989669_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_011436935.1|2989665_2990505_+	RNA polymerase sigma factor SigJ	NA	NA	NA	NA	NA
WP_148214938.1|2990755_2992210_-	recombinase family protein	NA	A0A1B1PA72	Streptomyces_phage	30.8	4.6e-44
WP_011435569.1|2992298_2993132_-|transposase	IS5-like element ISFsp7 family transposase	transposase	NA	NA	NA	NA
WP_011434618.1|2993559_2994333_+|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
WP_011436937.1|2994610_2995057_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023842285.1|2995274_2995922_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_011436484.1|2996003_2997644_-|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
WP_011434596.1|2998055_2999480_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 11
NC_007777	Frankia casuarinae, complete sequence	5433628	3168785	3222922	5433628	transposase,tRNA	uncultured_Mediterranean_phage(25.0%)	49	NA	NA
WP_011437080.1|3168785_3169358_-|transposase	IS607 family transposase	transposase	F9VHY9	Thermus_phage	33.3	1.8e-20
WP_193359370.1|3170455_3170791_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049760926.1|3171334_3171670_+	polyprenyl synthetase family protein	NA	NA	NA	NA	NA
WP_011437082.1|3171674_3172805_+	Rieske 2Fe-2S domain-containing protein	NA	F2Y2Q3	Organic_Lake_phycodnavirus	32.9	3.2e-05
WP_035941594.1|3172864_3173872_+	aromatic ring-hydroxylating dioxygenase subunit alpha	NA	NA	NA	NA	NA
WP_108913605.1|3173943_3174918_+	Rieske 2Fe-2S domain-containing protein	NA	NA	NA	NA	NA
WP_011437085.1|3174910_3177526_+	phosphoenolpyruvate synthase	NA	NA	NA	NA	NA
WP_011437086.1|3177479_3178028_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011437087.1|3178083_3179091_+	flippase-like domain-containing protein	NA	NA	NA	NA	NA
WP_011437088.1|3179136_3179457_+	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_108913606.1|3179624_3180383_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011437090.1|3180387_3181107_+	hypothetical protein	NA	NA	NA	NA	NA
WP_076806164.1|3181206_3181632_-	protein phosphatase	NA	NA	NA	NA	NA
WP_011437092.1|3181891_3182377_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_157493398.1|3182517_3182685_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023840970.1|3183090_3184626_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011437095.1|3184937_3185465_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011437096.1|3185482_3186106_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_011437097.1|3186102_3186447_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011437098.1|3186593_3187442_+	helix-turn-helix domain-containing protein	NA	I4AZQ1	Saccharomonospora_phage	42.3	2.0e-44
WP_011437099.1|3187438_3187642_+	DUF397 domain-containing protein	NA	NA	NA	NA	NA
WP_049760812.1|3188033_3189317_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_011437100.1|3189401_3191198_-|tRNA	arginine--tRNA ligase	tRNA	M1PAX3	Moumouvirus	36.9	2.5e-84
WP_011436467.1|3191310_3191754_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011435557.1|3191772_3192609_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_041257917.1|3192674_3193187_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011434597.1|3193245_3194436_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_011437101.1|3194666_3194969_-	hypothetical protein	NA	NA	NA	NA	NA
WP_108913881.1|3194965_3195781_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_148214915.1|3195912_3197304_-	pyridoxal-dependent decarboxylase	NA	S4W1T5	Pandoravirus	25.8	3.9e-08
WP_011434597.1|3197529_3198720_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_131728915.1|3198765_3199035_-	hypothetical protein	NA	NA	NA	NA	NA
WP_108913773.1|3199231_3199684_+	nucleoside deaminase	NA	NA	NA	NA	NA
WP_011437106.1|3200755_3201793_+	replication-relaxation family protein	NA	NA	NA	NA	NA
WP_011437107.1|3202097_3202613_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011437108.1|3203106_3203442_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_011437109.1|3203443_3204160_+	cation transporter	NA	NA	NA	NA	NA
WP_011437110.1|3205290_3206085_+	hypothetical protein	NA	NA	NA	NA	NA
WP_055725631.1|3206960_3208529_-	recombinase family protein	NA	A0A0K1Y917	Streptomyces_phage	28.6	2.1e-26
WP_035958605.1|3208525_3209110_-	hypothetical protein	NA	NA	NA	NA	NA
WP_108913772.1|3209052_3209430_-	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_157493474.1|3209682_3209859_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011437116.1|3210653_3211067_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023841739.1|3211357_3211585_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011437117.1|3211647_3212193_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011437118.1|3212636_3216959_-	hypothetical protein	NA	A0A1B1IUC6	uncultured_Mediterranean_phage	27.5	1.7e-46
WP_035958600.1|3216955_3220279_-	helicase	NA	A0A1B1IUI1	uncultured_Mediterranean_phage	29.4	3.3e-98
WP_011437121.1|3221029_3221947_-	NADP-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_011437123.1|3222649_3222922_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 12
NC_007777	Frankia casuarinae, complete sequence	5433628	4007694	4080566	5433628	transposase,integrase,tRNA	uncultured_Mediterranean_phage(20.0%)	59	4018326:4018365	4032686:4032725
WP_023842148.1|4007694_4008573_+	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	39.0	1.6e-44
WP_070133240.1|4008609_4009746_+|tRNA	queuine tRNA-ribosyltransferase family protein	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	29.4	1.7e-41
WP_011437760.1|4009748_4010459_+	7-cyano-7-deazaguanine synthase QueC	NA	A0A0D4D9V8	Escherichia_phage	35.2	1.7e-23
WP_011437761.1|4010460_4011099_+	7-carboxy-7-deazaguanine synthase	NA	A0A088FAQ4	Vibrio_phage	30.3	1.6e-14
WP_011437762.1|4011098_4011473_+	6-carboxytetrahydropterin synthase QueD	NA	NA	NA	NA	NA
WP_011437763.1|4011469_4012336_+	16S rRNA methyltransferase	NA	NA	NA	NA	NA
WP_085949899.1|4012455_4012785_+	preQ(1) synthase	NA	E7DN65	Pneumococcus_phage	42.6	7.2e-14
WP_035942159.1|4013309_4014035_-|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
WP_023842153.1|4014055_4014901_-|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	43.0	3.9e-11
WP_108913880.1|4016652_4017981_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4JCB7	uncultured_Caudovirales_phage	24.1	1.1e-17
WP_167534319.1|4018014_4018194_-	hypothetical protein	NA	NA	NA	NA	NA
4018326:4018365	attL	GGTGGGGCGGGTGGGGCTCGAACCCACGACCGACGGATTA	NA	NA	NA	NA
WP_011437769.1|4018556_4019699_+|integrase	site-specific integrase	integrase	A0A0U4B2E0	Arthrobacter_phage	37.2	2.7e-52
WP_035734610.1|4019991_4020651_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011437771.1|4021129_4022569_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_023841973.1|4022966_4023293_+	DUF397 domain-containing protein	NA	NA	NA	NA	NA
WP_041257976.1|4023285_4023558_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083771087.1|4023643_4024309_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023841509.1|4024305_4024734_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011437774.1|4025042_4027232_-	protein kinase	NA	A0A1B1IUU3	uncultured_Mediterranean_phage	33.1	2.0e-11
WP_035733686.1|4027234_4027648_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023841510.1|4028166_4028340_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023841511.1|4028339_4028597_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011437776.1|4028578_4028914_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011437777.1|4028998_4030681_+	cell division protein FtsK	NA	NA	NA	NA	NA
WP_011437779.1|4032226_4032430_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_011437780.1|4033154_4033517_+	hypothetical protein	NA	NA	NA	NA	NA
4032686:4032725	attR	GGTGGGGCGGGTGGGGCTCGAACCCACGACCGACGGATTA	NA	NA	NA	NA
WP_011437781.1|4034182_4034671_+|tRNA	YbaK/prolyl-tRNA synthetase associated domain-containing protein	tRNA	NA	NA	NA	NA
WP_011437782.1|4035139_4037248_+	FTR1 family protein	NA	NA	NA	NA	NA
WP_011437783.1|4037244_4038513_+	deferrochelatase/peroxidase EfeB	NA	NA	NA	NA	NA
WP_011437784.1|4038702_4040217_-	DUF839 domain-containing protein	NA	NA	NA	NA	NA
WP_011437785.1|4040631_4041969_+	GNAT family N-acetyltransferase	NA	R4TQL5	Phaeocystis_globosa_virus	32.0	1.5e-22
WP_157858569.1|4042319_4043345_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082456771.1|4043701_4045042_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L6B6	Tupanvirus	32.7	6.2e-64
WP_011437788.1|4045288_4050550_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011437789.1|4050546_4051671_-	serine/threonine protein kinase	NA	NA	NA	NA	NA
WP_011437790.1|4051667_4053557_-	FHA domain-containing protein	NA	NA	NA	NA	NA
WP_011437791.1|4053574_4054945_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_131728931.1|4054944_4057149_-	SpoIIE family protein phosphatase	NA	NA	NA	NA	NA
WP_023841517.1|4057493_4058081_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023841518.1|4058179_4058887_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082456772.1|4059276_4060290_+	alpha/beta fold hydrolase	NA	R4JP33	Mycobacterium_phage	27.4	1.0e-05
WP_011437795.1|4060597_4061644_+	aldo/keto reductase	NA	NA	NA	NA	NA
WP_035733690.1|4061938_4062127_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011437797.1|4062258_4062696_-	SsgA family sporulation/cell division regulator	NA	NA	NA	NA	NA
WP_011437798.1|4063070_4065767_-	protein kinase	NA	A0A1B1IUU3	uncultured_Mediterranean_phage	30.4	6.1e-10
WP_049761114.1|4065879_4066473_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139140041.1|4066930_4067542_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049761115.1|4067836_4068406_+	hypothetical protein	NA	NA	NA	NA	NA
WP_108913586.1|4068655_4069081_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085949878.1|4069432_4070560_+	twin-arginine translocation pathway signal protein	NA	NA	NA	NA	NA
WP_011437802.1|4070856_4071639_+	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_011437803.1|4071719_4072847_-	phosphotransferase	NA	NA	NA	NA	NA
WP_076806976.1|4073687_4073870_-	hypothetical protein	NA	NA	NA	NA	NA
WP_131728932.1|4074693_4074978_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167534320.1|4075185_4077648_+	helicase-associated domain-containing protein	NA	NA	NA	NA	NA
WP_011437807.1|4077788_4078208_-	ester cyclase	NA	NA	NA	NA	NA
WP_131728933.1|4078308_4078605_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011437809.1|4078668_4079997_-|transposase	transposase	transposase	A0A7P9	Microcystis_virus	37.6	8.1e-56
WP_035959263.1|4079993_4080566_-|transposase	IS607 family transposase	transposase	F9VHY9	Thermus_phage	34.8	1.2e-21
>prophage 13
NC_007777	Frankia casuarinae, complete sequence	5433628	4730358	4799617	5433628	transposase,bacteriocin,tRNA	Erysipelothrix_phage(14.29%)	59	NA	NA
WP_011438325.1|4730358_4730952_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_035732506.1|4730985_4731606_-	50S ribosomal protein L25/general stress protein Ctc	NA	NA	NA	NA	NA
WP_035732552.1|4731783_4732359_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011438328.1|4732448_4733024_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085949903.1|4733130_4733412_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035732549.1|4733510_4733699_-	DUF2273 domain-containing protein	NA	NA	NA	NA	NA
WP_049760995.1|4734205_4734703_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011438331.1|4734699_4735185_-	Asp23/Gls24 family envelope stress response protein	NA	NA	NA	NA	NA
WP_049761137.1|4735550_4736642_+	4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase	NA	NA	NA	NA	NA
WP_011438333.1|4736638_4738477_+	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2I4R674	Erysipelothrix_phage	27.8	3.9e-40
WP_023840057.1|4738502_4739522_-	acyl-CoA desaturase	NA	NA	NA	NA	NA
WP_082456604.1|4740131_4741835_+	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	NA	NA	NA	NA
WP_011438336.1|4742104_4743079_+	ribose-phosphate diphosphokinase	NA	A0A2K9L2G2	Tupanvirus	38.0	7.8e-48
WP_011438337.1|4743190_4744216_+|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_082456606.1|4744278_4745139_-	16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))- dimethyltransferase RsmA	NA	NA	NA	NA	NA
WP_011438339.1|4745150_4745975_-	TatD family hydrolase	NA	NA	NA	NA	NA
WP_023840053.1|4747429_4747981_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035732497.1|4747994_4748909_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	36.8	5.4e-35
WP_011438343.1|4748949_4750659_+	phospholipid carrier-dependent glycosyltransferase	NA	NA	NA	NA	NA
WP_006541195.1|4751060_4751258_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035909299.1|4751299_4751848_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011438346.1|4752238_4754023_+	glycoside hydrolase family 15 protein	NA	NA	NA	NA	NA
WP_011438347.1|4754236_4755577_+	FHA domain-containing protein	NA	NA	NA	NA	NA
WP_011438348.1|4755617_4756433_+	DUF305 domain-containing protein	NA	NA	NA	NA	NA
WP_011438349.1|4756543_4758124_+	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	52.3	1.5e-117
WP_011438350.1|4758196_4759327_+	family 43 glycosylhydrolase	NA	NA	NA	NA	NA
WP_011438351.1|4759489_4759894_+	VOC family protein	NA	NA	NA	NA	NA
WP_108913684.1|4760047_4761061_+	thioesterase family protein	NA	NA	NA	NA	NA
WP_108913688.1|4761086_4762511_-	MFS transporter	NA	A0A0M3UL24	Mycobacterium_phage	37.6	3.6e-54
WP_011438354.1|4762820_4763627_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011438355.1|4763863_4766062_+	serine/threonine protein kinase	NA	NA	NA	NA	NA
WP_011438356.1|4766089_4766608_-	hypothetical protein	NA	NA	NA	NA	NA
WP_108913600.1|4766908_4767499_-	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_011438358.1|4767648_4768056_+	TOBE domain-containing protein	NA	NA	NA	NA	NA
WP_023840046.1|4768265_4769102_+	molybdate ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_108913689.1|4769200_4769842_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	36.3	1.4e-24
WP_035909281.1|4770101_4771430_-	dienelactone hydrolase family protein	NA	NA	NA	NA	NA
WP_049760996.1|4772356_4772908_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011438364.1|4774856_4776047_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_011438365.1|4776381_4776894_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157858593.1|4776890_4777508_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043590376.1|4778673_4779210_-	flavoprotein	NA	NA	NA	NA	NA
WP_085949882.1|4779224_4780817_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_035959242.1|4780958_4781741_-|bacteriocin	thiopeptide-type bacteriocin biosynthesis protein	bacteriocin	NA	NA	NA	NA
WP_011438371.1|4781755_4782484_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011435557.1|4782394_4783231_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011438373.1|4783249_4783693_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011434965.1|4784115_4785849_+|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
WP_011438374.1|4785900_4786197_-	AMP-binding protein	NA	NA	NA	NA	NA
WP_011438375.1|4786270_4786891_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011438376.1|4787363_4787897_+	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_049760998.1|4787953_4789228_+	MFS transporter	NA	NA	NA	NA	NA
WP_035959288.1|4789311_4789506_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011438373.1|4789581_4790025_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011435557.1|4790043_4790880_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_108913871.1|4792389_4793136_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_011438382.1|4793297_4796630_-	type I restriction endonuclease subunit R	NA	A0A220A398	Liberibacter_phage	27.1	5.0e-62
WP_011438383.1|4796626_4797937_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_011434596.1|4798192_4799617_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 14
NC_007777	Frankia casuarinae, complete sequence	5433628	4870448	4969345	5433628	transposase	Escherichia_phage(45.45%)	98	NA	NA
WP_011434597.1|4870448_4871639_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_035959121.1|4871697_4872105_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049761006.1|4872457_4873222_-	PIG-L family deacetylase	NA	NA	NA	NA	NA
WP_011438438.1|4873985_4874981_-	MoxR family ATPase	NA	NA	NA	NA	NA
WP_023841005.1|4876160_4876325_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023841006.1|4876435_4876753_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023841007.1|4877199_4877739_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011438441.1|4878336_4881006_+	FUSC family protein	NA	NA	NA	NA	NA
WP_108913553.1|4881082_4881745_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011438444.1|4882549_4883365_+	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_162238926.1|4883450_4885685_-	MMPL family transporter	NA	NA	NA	NA	NA
WP_011438446.1|4886730_4886877_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011438447.1|4886964_4887372_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011438449.1|4888402_4891954_+	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	57.7	0.0e+00
WP_011438450.1|4892149_4892860_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	39.4	1.7e-36
WP_023842258.1|4893130_4893358_+	DUF433 domain-containing protein	NA	NA	NA	NA	NA
WP_011438451.1|4893354_4893723_+	DUF5615 family PIN-like protein	NA	NA	NA	NA	NA
WP_035912346.1|4894048_4894366_+	recombinase family protein	NA	NA	NA	NA	NA
WP_011438453.1|4894547_4895555_+	recombinase zinc beta ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_011438454.1|4895551_4895929_-	hypothetical protein	NA	NA	NA	NA	NA
WP_108913846.1|4895925_4897209_-	replication initiation protein	NA	NA	NA	NA	NA
WP_011438456.1|4897932_4898256_-	4a-hydroxytetrahydrobiopterin dehydratase	NA	NA	NA	NA	NA
WP_011438457.1|4898271_4899783_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_162238925.1|4900045_4900306_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011438458.1|4900245_4900587_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011438459.1|4900639_4901824_+	adenosylhomocysteinase	NA	NA	NA	NA	NA
WP_011438460.1|4901830_4902394_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_011438461.1|4903545_4903812_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035958970.1|4905008_4905899_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_011438465.1|4905937_4906897_-	SRPBCC family protein	NA	NA	NA	NA	NA
WP_011438466.1|4906911_4907175_-	acyl carrier protein	NA	NA	NA	NA	NA
WP_011438467.1|4907250_4908453_-	ketosynthase chain-length factor	NA	NA	NA	NA	NA
WP_011438468.1|4908449_4909724_-	beta-ketoacyl-[acyl-carrier-protein] synthase family protein	NA	NA	NA	NA	NA
WP_011438469.1|4909747_4910893_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_023841932.1|4910922_4911708_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_011438471.1|4911900_4912350_+	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_011438472.1|4912418_4913333_+	NADP-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_011438473.1|4913338_4914028_+	DsbA family oxidoreductase	NA	NA	NA	NA	NA
WP_035912354.1|4914060_4914738_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	40.8	1.5e-37
WP_011438475.1|4914871_4915120_+	type II toxin-antitoxin system prevent-host-death family antitoxin	NA	NA	NA	NA	NA
WP_011438476.1|4915116_4915500_+	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_023841936.1|4915558_4916236_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	39.8	5.2e-35
WP_011438478.1|4916316_4916844_+	cytochrome P450	NA	NA	NA	NA	NA
WP_035958968.1|4916859_4917468_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_049761030.1|4917446_4917935_-	winged helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_041258026.1|4917985_4918180_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049761007.1|4918216_4918492_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049760812.1|4918845_4920129_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_023842267.1|4920468_4920897_+	50S ribosomal protein L11	NA	NA	NA	NA	NA
WP_011438481.1|4920936_4921197_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011438482.1|4921228_4921750_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011438483.1|4921757_4922270_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023842273.1|4922780_4923980_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_011437816.1|4924559_4925798_-|transposase	IS110 family transposase	transposase	Q9JMN8	Wolbachia_phage	28.3	1.2e-40
WP_011438487.1|4926106_4927405_+	recombinase family protein	NA	A0A1B1PA72	Streptomyces_phage	29.1	4.5e-35
WP_011438488.1|4927401_4927776_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011438489.1|4927772_4929218_-	hypothetical protein	NA	NA	NA	NA	NA
WP_108913848.1|4929711_4930227_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035734445.1|4930246_4930486_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157858584.1|4930650_4931349_-	aminoglycoside phosphotransferase	NA	NA	NA	NA	NA
WP_131728953.1|4931450_4932287_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049761008.1|4932337_4932847_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011438495.1|4932997_4934248_-	helix-turn-helix domain-containing protein	NA	A0A142K650	Streptomyces_phage	41.1	1.4e-65
WP_011438496.1|4935064_4935454_-	flavin reductase family protein	NA	NA	NA	NA	NA
WP_011438497.1|4935477_4936791_-	NDP-hexose 2,3-dehydratase family protein	NA	NA	NA	NA	NA
WP_035734442.1|4937109_4937817_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_011438499.1|4937859_4938318_+	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_011438500.1|4938511_4939219_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011438501.1|4939457_4940369_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_011438502.1|4940478_4941450_-	hydroxylacyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_011438503.1|4941538_4942603_-	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_011438504.1|4942652_4943105_-	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_011438505.1|4943149_4944283_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_011438506.1|4944350_4945307_-	SRPBCC family protein	NA	NA	NA	NA	NA
WP_011438508.1|4945747_4947202_+|transposase	IS66-like element ISFsp10 family transposase	transposase	NA	NA	NA	NA
WP_011438509.1|4947320_4947881_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_011438510.1|4947970_4948267_-	acyl carrier protein	NA	NA	NA	NA	NA
WP_011438511.1|4948291_4949206_-	beta-ketoacyl synthase	NA	NA	NA	NA	NA
WP_041258031.1|4949229_4949940_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	42.3	1.0e-36
WP_035942187.1|4949867_4950491_-	DUF1205 domain-containing protein	NA	NA	NA	NA	NA
WP_011438514.1|4950606_4951554_-	aromatase/cyclase	NA	NA	NA	NA	NA
WP_011438515.1|4951638_4952730_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011438516.1|4953358_4954309_+	zinc-binding dehydrogenase	NA	NA	NA	NA	NA
WP_011438517.1|4954305_4955757_+	DHA2 family efflux MFS transporter permease subunit	NA	A0A0M3UL24	Mycobacterium_phage	28.0	3.2e-21
WP_011434597.1|4956006_4957197_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_083503478.1|4957463_4957709_+	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_011438518.1|4958180_4958489_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011438519.1|4958488_4958881_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011438520.1|4959582_4960794_-	helix-turn-helix transcriptional regulator	NA	A0A0R8V0C3	Thermobifida_phage	34.6	1.0e-44
WP_083503477.1|4960961_4961399_+	DUF397 domain-containing protein	NA	NA	NA	NA	NA
WP_167534321.1|4961391_4961664_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148214924.1|4961821_4962412_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011438523.1|4962408_4962936_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035959318.1|4963791_4965078_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011438525.1|4965074_4965581_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011438526.1|4965577_4967083_-	recombinase family protein	NA	NA	NA	NA	NA
WP_011438527.1|4967114_4967456_+	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_041258044.1|4968634_4969345_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	39.9	5.9e-37
>prophage 15
NC_007777	Frankia casuarinae, complete sequence	5433628	5014669	5075206	5433628	bacteriocin,transposase,tRNA	Brazilian_cedratvirus(12.5%)	40	NA	NA
WP_108913841.1|5014669_5015668_+|bacteriocin	thiopeptide-type bacteriocin biosynthesis protein	bacteriocin	NA	NA	NA	NA
WP_011438563.1|5015670_5016588_+	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	34.5	5.3e-22
WP_011438564.1|5016638_5017376_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_035941780.1|5017445_5019080_-	bifunctional 3-(3-hydroxy-phenyl)propionate/3-hydroxycinnamic acid hydroxylase	NA	NA	NA	NA	NA
WP_085949905.1|5019373_5019526_+|bacteriocin	thiazolylpeptide-type bacteriocin	bacteriocin	NA	NA	NA	NA
WP_011438566.1|5019606_5021232_+	long-chain fatty acid--CoA ligase	NA	NA	NA	NA	NA
WP_082456775.1|5021117_5022065_+	2-amino-4,5-dihydroxy-6-one-heptanoic acid-7-phosphate synthase	NA	NA	NA	NA	NA
WP_049761014.1|5021988_5023158_+	3-dehydroquinate synthase II family protein	NA	NA	NA	NA	NA
WP_011438569.1|5023180_5024401_+	FAD-dependent monooxygenase	NA	NA	NA	NA	NA
WP_131728951.1|5024435_5025500_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011438570.1|5025555_5026161_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_035958930.1|5026683_5027682_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	36.2	2.6e-38
WP_011438575.1|5030771_5032019_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_011435467.1|5032856_5034080_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_049760812.1|5034799_5036083_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_011438578.1|5036962_5037415_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049760812.1|5037635_5038919_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_083503475.1|5040135_5040474_-|transposase	transposase family protein	transposase	NA	NA	NA	NA
WP_041258262.1|5041867_5043121_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011438583.1|5043484_5044075_-	hemerythrin domain-containing protein	NA	NA	NA	NA	NA
WP_011438585.1|5045792_5047196_+	cyclic nucleotide-binding domain-containing protein	NA	A0A2K9L690	Tupanvirus	33.0	3.5e-25
WP_011438586.1|5047525_5049781_+	terpene synthase	NA	NA	NA	NA	NA
WP_108913469.1|5049781_5050456_-	SagB family peptide dehydrogenase	NA	NA	NA	NA	NA
WP_011438588.1|5050564_5051902_-	YcaO-like family protein	NA	NA	NA	NA	NA
WP_108913844.1|5051911_5053216_-	YcaO-like family protein	NA	NA	NA	NA	NA
WP_011438590.1|5053308_5054922_-	CocE/NonD family hydrolase	NA	NA	NA	NA	NA
WP_108913843.1|5054932_5055847_-	TOMM precursor leader peptide-binding protein	NA	NA	NA	NA	NA
WP_083282201.1|5056216_5057545_-	MFS transporter	NA	NA	NA	NA	NA
WP_011438594.1|5057601_5058603_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_011438595.1|5058635_5059493_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.0	2.1e-12
WP_108913436.1|5059489_5060575_-	iron ABC transporter permease	NA	A0A2H4IY97	uncultured_Caudovirales_phage	24.9	2.9e-11
WP_011438597.1|5060833_5062768_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	26.6	6.5e-30
WP_035941453.1|5063025_5064399_+	lipase	NA	NA	NA	NA	NA
WP_011438599.1|5065286_5066936_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	39.0	3.5e-08
WP_011438600.1|5067611_5067992_+	transglycosylase family protein	NA	NA	NA	NA	NA
WP_011438601.1|5068197_5069289_-	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_011438602.1|5069531_5069855_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023840700.1|5070279_5071395_+	serine/threonine-protein phosphatase	NA	NA	NA	NA	NA
WP_011438605.1|5071935_5073579_+	FHA domain-containing protein	NA	NA	NA	NA	NA
WP_011438606.1|5073631_5075206_-|tRNA	cysteine--tRNA ligase	tRNA	A0A1V0SAQ2	Catovirus	29.3	1.2e-37
