The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_008261	Clostridium perfringens ATCC 13124, complete sequence	3256683	796479	809069	3256683		Synechococcus_phage(25.0%)	9	NA	NA
WP_003457021.1|796479_797130_+	aminotransferase	NA	A0A1B1P8C0	Bacillus_phage	31.1	2.9e-14
WP_003456962.1|797634_798945_+	phosphomethylpyrimidine synthase ThiC	NA	NA	NA	NA	NA
WP_011590300.1|799182_802983_+	phosphoribosylformylglycinamidine synthase	NA	A6N228	Microbacterium_phage	25.0	3.3e-33
WP_003453078.1|803293_803773_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	47.4	2.6e-28
WP_003456948.1|803772_804480_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	M4SM18	Cyanophage	43.8	2.8e-47
WP_011009969.1|804501_805947_+	amidophosphoribosyltransferase	NA	A0A1B1ISH6	uncultured_Mediterranean_phage	33.0	1.4e-56
WP_003468449.1|805947_806949_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3FGG1	Synechococcus_phage	49.0	6.7e-71
WP_003468450.1|806936_807551_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	38.3	2.2e-24
WP_011590302.1|807563_809069_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	47.2	1.2e-66
>prophage 2
NC_008261	Clostridium perfringens ATCC 13124, complete sequence	3256683	1085225	1150716	3256683	integrase,holin,capsid,protease,terminase	Clostridium_phage(82.5%)	74	1082439:1082455	1097346:1097362
1082439:1082455	attL	TATCTTTAGGAGTAAAG	NA	NA	NA	NA
WP_011590443.1|1085225_1087037_+	ribonucleoside triphosphate reductase	NA	D9ZNH0	Clostridium_phage	62.6	5.4e-220
WP_011590444.1|1087033_1087492_+	4Fe-4S cluster-binding domain-containing protein	NA	D9ZNH1	Clostridium_phage	48.6	1.3e-29
WP_011590445.1|1087686_1088409_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003477284.1|1089076_1090141_-|integrase	site-specific integrase	integrase	B3GVW7	Streptococcus_phage	33.1	1.6e-33
WP_011590446.1|1090233_1090698_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A0A7RVV2	Clostridium_phage	51.3	7.0e-39
WP_110003070.1|1090713_1091190_-	helix-turn-helix transcriptional regulator	NA	A0A0A7RTR3	Clostridium_phage	53.2	3.3e-28
WP_011590448.1|1091368_1091605_+	helix-turn-helix domain-containing protein	NA	B6SBW9	Clostridium_virus	57.9	5.7e-13
WP_011590449.1|1091616_1092348_+	ORF6C domain-containing protein	NA	A0A288WG93	Bacillus_phage	33.2	3.9e-20
WP_011590450.1|1092373_1092628_+	hypothetical protein	NA	NA	NA	NA	NA
WP_110003034.1|1092596_1093268_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011590452.1|1093444_1093747_+	histidine kinase	NA	NA	NA	NA	NA
WP_011590453.1|1093748_1093928_+	hypothetical protein	NA	M9Q2G4	Clostridium_phage	50.0	9.3e-08
WP_003477299.1|1093938_1094121_+	hypothetical protein	NA	I2E8Z1	Clostridium_phage	48.3	2.7e-07
WP_162467388.1|1094215_1094374_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011590455.1|1094417_1094603_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011590456.1|1094602_1095514_+	YqaJ viral recombinase family protein	NA	A0A0A7RWR9	Clostridium_phage	64.9	4.5e-106
WP_011590457.1|1095515_1096385_+	recombinase RecT	NA	A0A0A7RW37	Clostridium_phage	68.3	5.4e-101
WP_011590458.1|1096402_1097116_+	GntR family transcriptional regulator	NA	A0A0A7RTY6	Clostridium_phage	60.0	2.0e-32
WP_011590459.1|1097116_1097290_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011590460.1|1097283_1097670_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A2K9V3I2	Faecalibacterium_phage	44.3	5.1e-19
1097346:1097362	attR	CTTTACTCCTAAAGATA	NA	NA	NA	NA
WP_011590461.1|1097819_1098467_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011590462.1|1099025_1099499_+	hypothetical protein	NA	A0A0A8WFM4	Clostridium_phage	34.4	3.3e-12
WP_011590463.1|1099981_1101157_+	DUF4935 domain-containing protein	NA	NA	NA	NA	NA
WP_011590464.1|1101225_1101693_+|terminase	terminase small subunit	terminase	A7J290	Streptococcus_phage	60.1	4.7e-35
WP_011590465.1|1101685_1103050_+|terminase	terminase	terminase	M9Q2I1	Clostridium_phage	96.2	4.7e-261
WP_041702636.1|1103105_1103873_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041702637.1|1103918_1105439_+|capsid	phage capsid protein	capsid	M9Q246	Clostridium_phage	97.2	1.3e-283
WP_080503691.1|1106562_1107060_+	hypothetical protein	NA	A0A0A8WIE7	Clostridium_phage	59.8	4.8e-30
WP_041702747.1|1107105_1107297_+	hypothetical protein	NA	A0A0A8WJ56	Clostridium_phage	64.7	1.8e-09
WP_011590470.1|1107324_1107942_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011590471.1|1108035_1108641_+	hypothetical protein	NA	M9Q248	Clostridium_phage	90.0	4.5e-78
WP_011590472.1|1108665_1109571_+	hypothetical protein	NA	M9Q2F4	Clostridium_phage	84.4	6.5e-150
WP_003460293.1|1109585_1109855_+	hypothetical protein	NA	M9Q1H8	Clostridium_phage	100.0	3.4e-22
WP_011590473.1|1109890_1110253_+	hypothetical protein	NA	M9Q2K9	Clostridium_phage	98.3	3.9e-61
WP_011590474.1|1110256_1110583_+	hypothetical protein	NA	M9Q2I3	Clostridium_phage	99.1	5.2e-57
WP_011590475.1|1110582_1110966_+	hypothetical protein	NA	M9Q249	Clostridium_phage	96.9	8.0e-65
WP_011590476.1|1110965_1111352_+	hypothetical protein	NA	M9Q2F6	Clostridium_phage	96.9	5.0e-67
WP_003460307.1|1111361_1111820_+	hypothetical protein	NA	M9Q1I1	Clostridium_phage	96.7	7.8e-83
WP_003460275.1|1111832_1112201_+	hypothetical protein	NA	M9Q2L0	Clostridium_phage	99.2	1.1e-52
WP_041702638.1|1112160_1112523_+	bacteriophage Gp15 protein	NA	M9Q2I4	Clostridium_phage	97.5	7.3e-60
WP_011590478.1|1112563_1115776_+	membrane protein	NA	M9Q251	Clostridium_phage	90.1	0.0e+00
WP_003460303.1|1115779_1116133_+	hypothetical protein	NA	M9Q2F8	Clostridium_phage	96.4	4.3e-57
WP_003460286.1|1116155_1116422_+	hypothetical protein	NA	M9Q1I4	Clostridium_phage	97.7	1.0e-39
WP_011590479.1|1116488_1116869_+	DUF1617 family protein	NA	M9Q2L1	Clostridium_phage	92.9	1.4e-58
WP_011590480.1|1116904_1122013_+	KID repeat-containing protein	NA	M9Q2I5	Clostridium_phage	87.7	6.7e-268
WP_011590481.1|1122031_1122280_+	hypothetical protein	NA	Q0SPG3	Clostridium_phage	95.1	5.4e-38
WP_011590482.1|1122293_1122710_+|holin	phage holin family protein	holin	M9Q253	Clostridium_phage	97.8	1.2e-69
WP_011590483.1|1122750_1123167_+	hypothetical protein	NA	M9Q2G0	Clostridium_phage	86.2	2.8e-55
WP_011590484.1|1123252_1124281_+	SH3 domain-containing protein	NA	Q0SPG7	Clostridium_phage	93.3	2.0e-187
WP_011590485.1|1124698_1125361_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011590486.1|1125584_1126673_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148194390.1|1126608_1126959_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011590488.1|1126965_1127691_+	restriction endonuclease	NA	NA	NA	NA	NA
WP_003477359.1|1128750_1129536_-	phosphorylase	NA	NA	NA	NA	NA
WP_011590489.1|1129892_1130990_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011590490.1|1131186_1131705_+	ClbS/DfsB family four-helix bundle protein	NA	NA	NA	NA	NA
WP_004457245.1|1131741_1132584_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011590491.1|1132600_1132915_+	DUF3784 domain-containing protein	NA	NA	NA	NA	NA
WP_004457215.1|1133106_1133844_-	sugar phosphate isomerase/epimerase	NA	NA	NA	NA	NA
WP_004457310.1|1134210_1134957_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011590492.1|1135174_1136323_-	exo-alpha-sialidase	NA	Q9III6	Frog_adenovirus	28.9	4.0e-19
WP_011590493.1|1137104_1138484_+	flagellin lysine-N-methylase	NA	NA	NA	NA	NA
WP_011590494.1|1138907_1139201_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041702640.1|1139591_1140212_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_011590496.1|1141377_1141770_+	DUF4440 domain-containing protein	NA	NA	NA	NA	NA
WP_011590497.1|1142099_1143245_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041702641.1|1143401_1143713_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011590499.1|1143880_1145644_+	AAA family ATPase	NA	K4I1H4	Acidithiobacillus_phage	37.8	3.5e-46
WP_011590500.1|1145647_1146961_+	McrC family protein	NA	NA	NA	NA	NA
WP_003462042.1|1146986_1147370_+	SdpI family protein	NA	NA	NA	NA	NA
WP_011590501.1|1147460_1148018_-	flavin reductase family protein	NA	NA	NA	NA	NA
WP_011590502.1|1148062_1148452_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011590503.1|1148754_1149531_+	DUF1311 domain-containing protein	NA	NA	NA	NA	NA
WP_011590504.1|1149912_1150716_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
>prophage 3
NC_008261	Clostridium perfringens ATCC 13124, complete sequence	3256683	1744791	1862464	3256683	integrase,tail,portal,plate,tRNA,head,capsid,protease,terminase,transposase	Clostridium_phage(71.11%)	112	1761946:1761966	1861401:1861421
WP_011010387.1|1744791_1745784_-|tRNA	tRNA epoxyqueuosine(34) reductase QueG	tRNA	NA	NA	NA	NA
WP_003450775.1|1745928_1746438_-	serine O-acetyltransferase	NA	NA	NA	NA	NA
WP_011010388.1|1746456_1747359_-	cysteine synthase A	NA	A0A1X9I5K7	Streptococcus_phage	56.4	3.8e-89
WP_003477931.1|1747697_1748969_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_011590753.1|1749308_1750097_+	amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003481390.1|1750110_1750752_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_011590754.1|1750763_1751456_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.7	2.0e-26
WP_011590755.1|1751624_1752305_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003460604.1|1752377_1753259_-	YegS/Rv2252/BmrU family lipid kinase	NA	NA	NA	NA	NA
WP_003453570.1|1753573_1754095_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_003453576.1|1754141_1754492_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003460610.1|1754513_1755050_-	rubrerythrin family protein	NA	NA	NA	NA	NA
WP_003460596.1|1755101_1756451_-	SpoVR family protein	NA	NA	NA	NA	NA
WP_003460597.1|1756477_1757656_-	sporulation protein YhbH	NA	NA	NA	NA	NA
WP_003460607.1|1757659_1759582_-	PrkA family serine protein kinase	NA	A0MN77	Thermus_phage	32.8	2.0e-84
WP_011590757.1|1759671_1761450_-	DNA helicase RecQ	NA	A0A2P1EM61	Moumouvirus	36.7	2.2e-77
WP_003460600.1|1761680_1762304_-	thiamine phosphate synthase	NA	NA	NA	NA	NA
1761946:1761966	attL	ATAGCTTTTAAAGCTTCCTCT	NA	NA	NA	NA
WP_003460606.1|1762296_1763094_-	hydroxyethylthiazole kinase	NA	NA	NA	NA	NA
WP_011590758.1|1763105_1763900_-	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_003460605.1|1764206_1765046_+	patatin family protein	NA	NA	NA	NA	NA
WP_003470312.1|1765163_1766177_-	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_003477945.1|1766394_1767459_+	galactose/glucose ABC transporter substrate-binding protein MglB	NA	NA	NA	NA	NA
WP_003449162.1|1767533_1769081_+	galactose/methyl galactoside ABC transporter ATP-binding protein MglA	NA	F2Y2R6	Organic_Lake_phycodnavirus	33.3	3.7e-12
WP_003449090.1|1769052_1770081_+	galactose/methyl galactoside ABC transporter permease MglC	NA	NA	NA	NA	NA
WP_011590759.1|1770120_1771143_-	galactose mutarotase	NA	NA	NA	NA	NA
WP_003465923.1|1771368_1772532_+	galactokinase	NA	NA	NA	NA	NA
WP_011590760.1|1772654_1774151_+	UDP-glucose--hexose-1-phosphate uridylyltransferase	NA	NA	NA	NA	NA
WP_003460743.1|1774341_1775997_-	nucleoside kinase	NA	NA	NA	NA	NA
WP_003472738.1|1776127_1776826_+	DUF421 domain-containing protein	NA	NA	NA	NA	NA
WP_011590761.1|1776822_1777257_+	DUF4363 family protein	NA	NA	NA	NA	NA
WP_003449129.1|1777353_1778220_+	class II fructose-1,6-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_011590762.1|1778266_1779310_-	nucleoid-associated protein	NA	J9QE81	Clostridium_phage	29.5	5.4e-39
WP_011590763.1|1779449_1780013_+	CYTH domain-containing protein	NA	NA	NA	NA	NA
WP_041702689.1|1780262_1780865_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011590766.1|1781005_1782667_-	C40 family peptidase	NA	A0A1J0GW44	Streptomyces_phage	37.2	3.5e-16
WP_003449139.1|1782832_1783201_-	DUF2164 family protein	NA	NA	NA	NA	NA
WP_011590767.1|1783388_1783775_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011590768.1|1784094_1784580_-|tRNA	Cys-tRNA(Pro) deacylase	tRNA	NA	NA	NA	NA
WP_003460283.1|1784746_1785049_-	hypothetical protein	NA	I2E8X0	Clostridium_phage	73.5	1.2e-20
WP_011590769.1|1785240_1786269_-	SH3 domain-containing protein	NA	Q0SPG7	Clostridium_phage	95.9	5.4e-193
WP_011590770.1|1786322_1786805_-	cobalt ABC transporter permease	NA	I2E8W8	Clostridium_phage	68.1	4.4e-52
WP_011590771.1|1786825_1787059_-	hemolysin XhlA family protein	NA	Q0SPG4	Clostridium_phage	100.0	5.8e-34
WP_011590772.1|1787140_1787326_-	hypothetical protein	NA	I2E8W6	Clostridium_phage	76.9	1.1e-19
WP_011590773.1|1787344_1789843_-|plate	BppU family phage baseplate upper protein	plate	I2E8W5	Clostridium_phage	52.9	1.1e-151
WP_011590774.1|1789858_1791739_-	MBL fold metallo-hydrolase	NA	I2E8W4	Clostridium_phage	91.7	6.0e-307
WP_011590775.1|1791789_1794849_-	peptidoglycan DD-metalloendopeptidase family protein	NA	I2E8W3	Clostridium_phage	97.1	0.0e+00
WP_041702692.1|1794853_1795615_-|tail	phage tail family protein	tail	I2E8W2	Clostridium_phage	97.6	7.0e-145
WP_011590777.1|1795556_1798811_-|tail	phage tail tape measure protein	tail	I2E8W1	Clostridium_phage	97.0	0.0e+00
WP_158301053.1|1798846_1799176_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011590779.1|1799361_1799679_-	hypothetical protein	NA	I2E8W0	Clostridium_phage	100.0	7.1e-51
WP_011590780.1|1799681_1800284_-|tail	tail protein	tail	I2E8V9	Clostridium_phage	100.0	2.0e-110
WP_011590781.1|1800300_1800648_-	hypothetical protein	NA	I2E8V8	Clostridium_phage	100.0	9.1e-60
WP_041702697.1|1800656_1801094_-	HK97 gp10 family phage protein	NA	I2E8V7	Clostridium_phage	98.6	8.5e-79
WP_011590783.1|1801093_1801423_-|head	phage head closure protein	head	I2E8V6	Clostridium_phage	87.2	4.4e-48
WP_011590784.1|1801415_1801694_-|head,tail	phage gp6-like head-tail connector protein	head,tail	Q8SBP7	Clostridium_phage	61.5	6.2e-27
WP_011590785.1|1801705_1802890_-|capsid	phage major capsid protein	capsid	Q8SBP8	Clostridium_phage	79.3	5.7e-146
WP_011590786.1|1802930_1803536_-|head,protease	HK97 family phage prohead protease	head,protease	Q8SBP9	Clostridium_phage	88.1	3.0e-98
WP_011590787.1|1803525_1804773_-|portal	phage portal protein	portal	Q8SBQ1	Clostridium_phage	81.5	2.3e-201
WP_011590788.1|1804773_1806513_-|terminase	terminase large subunit	terminase	Q8SBQ2	Clostridium_phage	85.9	1.5e-307
WP_041702751.1|1806505_1807009_-|terminase	phage terminase small subunit P27 family	terminase	Q8SBQ3	Clostridium_phage	88.6	2.7e-76
WP_041702752.1|1807108_1807525_-	HNH endonuclease	NA	Q8SBK4	Clostridium_phage	79.7	1.3e-57
WP_011590790.1|1807520_1808342_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011590791.1|1808516_1809065_-|integrase	site-specific integrase	integrase	Q8SBK8	Clostridium_phage	74.6	1.2e-74
WP_011590792.1|1809159_1809513_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041702754.1|1809571_1809757_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011590794.1|1809919_1810381_-	sigma-70 family RNA polymerase sigma factor	NA	A0A0A8WFM4	Clostridium_phage	39.0	5.3e-15
WP_011590796.1|1810916_1811306_-	single-stranded DNA-binding protein	NA	Q8SBL5	Clostridium_phage	60.9	6.2e-41
WP_011590797.1|1811320_1811467_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011590798.1|1811478_1812762_-	DNA helicase	NA	Q8SBL9	Clostridium_phage	81.7	2.3e-196
WP_193332938.1|1812772_1813420_-	phage protein	NA	Q8SBM0	Clostridium_phage	53.6	2.0e-52
WP_158301054.1|1813540_1813699_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011590801.1|1813701_1813881_-	hypothetical protein	NA	I2E8Z1	Clostridium_phage	60.4	2.2e-09
WP_011590802.1|1813906_1814137_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011590803.1|1814142_1814640_-	hypothetical protein	NA	A0A2K9V3J3	Faecalibacterium_phage	41.5	3.4e-23
WP_011590804.1|1814689_1814878_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_011590805.1|1815027_1815372_+	helix-turn-helix transcriptional regulator	NA	A0A1L2BY72	Clostridium_phage	52.7	5.7e-22
WP_011590806.1|1815422_1817012_+	hypothetical protein	NA	Q7Y4B3	Escherichia_virus	28.8	6.4e-07
WP_011590807.1|1817079_1817934_+	DNA adenine methylase	NA	NA	NA	NA	NA
WP_011590808.1|1818045_1818543_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A1L2BY64	Clostridium_phage	44.8	1.5e-34
WP_011590809.1|1818555_1820064_+	recombinase family protein	NA	M9Q2G2	Clostridium_phage	35.6	3.6e-60
WP_011590811.1|1820819_1821197_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011590813.1|1821672_1822233_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_011590814.1|1822316_1823267_-	ribonuclease Z	NA	NA	NA	NA	NA
WP_041702699.1|1823379_1827816_-	discoidin domain-containing protein	NA	NA	NA	NA	NA
WP_003449118.1|1828028_1828655_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011590816.1|1828706_1829459_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011590817.1|1829550_1830699_-	YibE/F family protein	NA	NA	NA	NA	NA
WP_011590818.1|1830779_1835912_-	CehA/McbA family metallohydrolase	NA	NA	NA	NA	NA
WP_003449110.1|1836148_1836652_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_011590819.1|1836960_1837740_+	histidinol-phosphatase	NA	NA	NA	NA	NA
WP_003460070.1|1838090_1839404_+	sodium-dependent transporter	NA	NA	NA	NA	NA
WP_003449164.1|1839694_1840390_+	energy-coupled thiamine transporter ThiT	NA	NA	NA	NA	NA
WP_003460055.1|1840498_1841575_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_003470420.1|1841710_1842757_-	calcium/proton exchanger	NA	NA	NA	NA	NA
WP_041702701.1|1843197_1844481_-	alkaline phosphatase family protein	NA	O90761	Fowlpox_virus	24.8	7.6e-11
WP_003460059.1|1844549_1844885_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003460053.1|1845024_1845438_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003460063.1|1845637_1846549_-	DUF368 domain-containing protein	NA	NA	NA	NA	NA
WP_078209945.1|1846708_1847881_-|transposase	transposase	transposase	Q331V1	Clostridium_botulinum_C_phage	76.5	4.0e-168
WP_011590822.1|1848574_1849366_-	M15 family metallopeptidase	NA	NA	NA	NA	NA
WP_003470421.1|1849635_1849962_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003472741.1|1850447_1851389_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003466212.1|1851426_1852296_-	methionyl aminopeptidase	NA	NA	NA	NA	NA
WP_003460916.1|1852643_1853240_-	zinc dependent phospholipase C family protein	NA	NA	NA	NA	NA
WP_011590823.1|1853341_1854265_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011010422.1|1854404_1854974_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003460758.1|1855338_1855554_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011590826.1|1855589_1856072_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003448636.1|1856288_1856882_-	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_003460768.1|1856881_1859212_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	45.3	2.8e-176
WP_003460767.1|1859333_1861046_-|protease	ATP-dependent protease LonB	protease	A0A0R6PGP8	Moraxella_phage	27.4	3.1e-23
WP_003448621.1|1861156_1862464_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	58.4	4.0e-140
1861401:1861421	attR	ATAGCTTTTAAAGCTTCCTCT	NA	NA	NA	NA
>prophage 4
NC_008261	Clostridium perfringens ATCC 13124, complete sequence	3256683	1964698	1977955	3256683	tRNA	Clostridium_phage(22.22%)	12	NA	NA
WP_003457168.1|1964698_1965736_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	36.0	5.4e-31
WP_003454568.1|1965936_1966206_+	ACT domain-containing protein	NA	NA	NA	NA	NA
WP_003474040.1|1966222_1967575_+	PFL family protein	NA	NA	NA	NA	NA
WP_003457240.1|1967786_1968290_-	QueT transporter family protein	NA	E7DN70	Pneumococcus_phage	37.2	1.1e-13
WP_003457231.1|1968614_1969490_-	MBL fold metallo-hydrolase	NA	Q332C0	Clostridium_botulinum_C_phage	50.2	1.1e-64
WP_011590863.1|1969660_1970983_-	sensor histidine kinase	NA	X5JAC0	Clostridium_phage	37.8	3.6e-72
WP_003449818.1|1970976_1971687_-	response regulator transcription factor	NA	A0A2R2ZGH8	Clostridioides_phage	31.8	3.3e-32
WP_003456038.1|1971825_1972839_-	N-acetylmuramoyl-L-alanine amidase	NA	Q8SBN4	Clostridium_phage	64.0	2.5e-121
WP_003455890.1|1972935_1973223_-	thiamine-binding protein	NA	NA	NA	NA	NA
WP_003456055.1|1973446_1974460_-	DUF348 domain-containing protein	NA	A0A143FMI2	Bacillus_phage	52.0	3.5e-19
WP_003455941.1|1974885_1976184_-	uracil permease	NA	Q9KX94	Enterobacteria_phage	39.3	3.6e-69
WP_003456099.1|1976371_1977955_+	ATP-binding cassette domain-containing protein	NA	A0A1V0SGN0	Hokovirus	25.6	8.5e-44
