The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_007432	Streptococcus agalactiae A909, complete sequence	2127839	36570	48635	2127839		Microbacterium_phage(14.29%)	8	NA	NA
WP_001042263.1|36570_40296_+	phosphoribosylformylglycinamidine synthase	NA	A6N228	Microbacterium_phage	27.0	1.6e-40
WP_000220672.1|40529_41984_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	32.5	6.3e-54
WP_001291325.1|42011_43034_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A1D7SE90	Cyanophage	44.6	9.6e-65
WP_000685111.1|43201_43753_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	35.6	1.8e-25
WP_000780019.1|43772_44525_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000166558.1|44544_46092_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	48.9	2.5e-77
WP_001045908.1|46284_47184_+	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A221J6U0	Arthrobacter_phage	45.9	4.1e-19
WP_000783424.1|47330_48635_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A2D1GNZ3	Streptomyces_phage	40.5	1.7e-05
>prophage 2
NC_007432	Streptococcus agalactiae A909, complete sequence	2127839	532501	629763	2127839	transposase,terminase,tail,integrase,holin,portal,protease,capsid,tRNA	Streptococcus_phage(65.71%)	112	548854:548913	586266:586346
WP_000882549.1|532501_534763_-|protease	ATP-dependent Clp protease ATP-binding subunit	protease	A0A2C9CYX3	Yersinia_phage	39.4	7.4e-126
WP_000443582.1|535060_535291_+	DUF1797 family protein	NA	NA	NA	NA	NA
WP_001011647.1|535432_536125_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_000230131.1|536117_536852_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	41.8	8.7e-36
WP_001106845.1|537138_538833_+	phospho-sugar mutase	NA	A0A1X9I671	Streptococcus_phage	42.6	5.5e-126
WP_000137498.1|538971_539826_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase	NA	A0A249XZQ2	Enterococcus_phage	40.2	1.5e-39
WP_000634981.1|539822_540659_+	NAD(P)H-hydrate dehydratase	NA	NA	NA	NA	NA
WP_001286939.1|540784_542125_+	exodeoxyribonuclease VII large subunit	NA	L7RDW5	Acanthamoeba_polyphaga_moumouvirus	31.7	3.4e-38
WP_001280900.1|542102_542318_+	exodeoxyribonuclease VII small subunit	NA	NA	NA	NA	NA
WP_000256279.1|542317_543190_+	polyprenyl synthetase family protein	NA	NA	NA	NA	NA
WP_001041040.1|543182_544010_+	TlyA family rRNA (cytidine-2'-O)-methyltransferase	NA	NA	NA	NA	NA
WP_000747943.1|543996_544470_+	ArgR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000923619.1|544481_546140_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_000034838.1|546252_547089_+	DegV family protein	NA	NA	NA	NA	NA
WP_001035227.1|547081_547921_+	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
WP_000806954.1|547895_548498_+	YpmS family protein	NA	NA	NA	NA	NA
WP_001284634.1|548600_548876_+	HU family DNA-binding protein	NA	A7KV42	Bacillus_phage	71.9	1.2e-25
548854:548913	attL	CTCTTAAAGACGCTGTTAAATAATTCGTCTAGAAAAACCTTGTCATATCAATGTTTATTG	NA	NA	NA	NA
WP_000269476.1|548963_550106_-|integrase	site-specific integrase	integrase	A1EAB7	Streptococcus_phage	82.4	1.3e-182
WP_000442169.1|550233_550443_-	TM2 domain-containing protein	NA	A0A060AN66	Enterococcus_phage	47.7	3.5e-06
WP_000700104.1|550494_550875_-	ImmA/IrrE family metallo-endopeptidase	NA	J7KBR5	Streptococcus_phage	100.0	8.2e-70
WP_000555955.1|550861_551221_-	helix-turn-helix transcriptional regulator	NA	A0A1P8VVN3	Streptococcus_phage	80.7	1.7e-45
WP_000257547.1|551412_551631_+	helix-turn-helix transcriptional regulator	NA	A0A1P8VVR5	Streptococcus_phage	90.1	9.5e-31
WP_000158652.1|551728_552061_+	hypothetical protein	NA	J7KBZ0	Streptococcus_phage	100.0	8.4e-55
WP_000360288.1|552165_552501_-	hypothetical protein	NA	J7KDN7	Streptococcus_phage	69.1	7.8e-16
WP_000263692.1|552646_552832_+	helix-turn-helix transcriptional regulator	NA	J7KH19	Streptococcus_phage	100.0	4.1e-27
WP_001123481.1|552910_553222_+	hypothetical protein	NA	M1Q0Y6	Streptococcus_phage	88.2	3.4e-50
WP_000732607.1|553226_553376_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001058282.1|553451_553652_+	hypothetical protein	NA	J7KK69	Streptococcus_phage	100.0	9.3e-33
WP_000650504.1|553648_553939_+	hypothetical protein	NA	J7KDN2	Streptococcus_phage	100.0	8.2e-38
WP_000704949.1|553925_554609_+	AAA family ATPase	NA	J7KC09	Streptococcus_phage	97.7	3.9e-123
WP_047198501.1|554644_556048_+	DEAD/DEAH box helicase	NA	A0A1P8BMH7	Lactococcus_phage	72.5	7.9e-195
WP_000896928.1|556052_556535_+	DUF669 domain-containing protein	NA	A0A1P8BMD4	Lactococcus_phage	71.3	1.1e-60
WP_000203210.1|556552_558106_+	hypothetical protein	NA	A0A1P8BM51	Lactococcus_phage	70.2	5.7e-210
WP_000274892.1|558374_559244_+	bifunctional DNA primase/polymerase	NA	A0A1P8BME8	Lactococcus_phage	65.6	3.4e-103
WP_001076208.1|559197_559545_+	VRR-NUC domain-containing protein	NA	J7KC03	Streptococcus_phage	87.4	4.9e-45
WP_000763908.1|559623_559920_+	DUF1599 domain-containing protein	NA	J7KBY0	Streptococcus_phage	87.8	1.2e-41
WP_000150115.1|559903_560143_+	hypothetical protein	NA	A0A097PAV1	Streptococcus_pyogenes_phage	55.6	7.5e-05
WP_000159368.1|560173_560338_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000139628.1|560334_560604_+	hypothetical protein	NA	A7J287	Streptococcus_phage	69.7	1.8e-23
WP_000564605.1|560607_560751_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001019149.1|560747_561260_+	DUF1642 domain-containing protein	NA	A0A097PAV5	Streptococcus_pyogenes_phage	46.0	2.7e-28
WP_001105090.1|561280_561580_+	hypothetical protein	NA	M1PFH6	Streptococcus_phage	45.4	1.3e-17
WP_000221696.1|561767_561962_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000660741.1|561958_562225_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000533370.1|562615_563041_+	DUF1492 domain-containing protein	NA	A0A0B5A564	Streptococcus_phage	48.6	8.3e-31
WP_017646473.1|563609_563987_+	HNH endonuclease	NA	Q7Y4J1	Streptococcus_phage	71.3	2.1e-41
WP_000725958.1|564137_564494_+	hypothetical protein	NA	A0A0B5A7G9	Streptococcus_phage	60.0	1.3e-24
WP_001108673.1|564490_565759_+|portal	phage portal protein	portal	M1PFL4	Streptococcus_phage	76.8	8.2e-191
WP_000227335.1|565751_566972_+	hypothetical protein	NA	Q7Y4I9	Streptococcus_phage	66.7	7.8e-114
WP_000421991.1|566971_567160_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000256854.1|567267_568683_+|terminase	terminase	terminase	A0A0B5A091	Streptococcus_phage	74.8	1.4e-215
WP_001288696.1|568763_569228_+	DUF4355 domain-containing protein	NA	A0A0B5A7G6	Streptococcus_phage	51.9	9.7e-41
WP_000841024.1|569230_570133_+|capsid	phage major capsid protein	capsid	A0A0B5A5W3	Streptococcus_phage	85.7	1.3e-145
WP_000640308.1|570129_570345_+	hypothetical protein	NA	M1PRX2	Streptococcus_phage	49.3	3.2e-07
WP_000180799.1|570358_570790_+	phage Gp19/Gp15/Gp42 family protein	NA	A0A0B5A2F6	Streptococcus_phage	69.3	1.1e-46
WP_001096306.1|570740_571079_+	hypothetical protein	NA	A0A0B5A086	Streptococcus_phage	66.1	4.6e-40
WP_000032787.1|571071_571308_+	hypothetical protein	NA	A0A1P8BMT2	Lactococcus_phage	66.7	2.5e-21
WP_000573598.1|571308_571644_+	hypothetical protein	NA	A0A1P8BMR5	Lactococcus_phage	64.9	9.8e-35
WP_000226353.1|571653_572211_+|tail	tail protein	tail	M1PKG8	Streptococcus_phage	65.8	3.4e-64
WP_000858406.1|572210_572456_+	hypothetical protein	NA	A0A0B5A2F3	Streptococcus_phage	55.3	9.7e-16
WP_000916438.1|572470_572842_+	DUF5361 domain-containing protein	NA	A0A1P8BMT6	Lactococcus_phage	54.0	7.3e-31
WP_000224696.1|572841_574854_+	hypothetical protein	NA	Q9F4J3	Streptococcus_phage	58.9	9.8e-13
WP_000228808.1|574847_576380_+|tail	phage tail family protein	tail	J7KH53	Streptococcus_phage	73.8	2.8e-201
WP_000955545.1|576380_580502_+|tail	phage tail protein	tail	J7KBT9	Streptococcus_phage	79.0	0.0e+00
WP_000206874.1|580502_582506_+	hypothetical protein	NA	J7KC14	Streptococcus_phage	77.1	1.1e-295
WP_000889198.1|582517_582910_+	DUF1366 domain-containing protein	NA	J7KKA3	Streptococcus_phage	38.7	2.3e-11
WP_001017826.1|583069_583372_+	hypothetical protein	NA	J7KH30	Streptococcus_phage	63.4	5.2e-27
WP_000609111.1|583364_583592_+|holin	phage holin	holin	A7J2B3	Streptococcus_phage	97.3	1.7e-30
WP_000257237.1|583717_585049_+	lysin	NA	Q8HA43	Streptococcus_phage	99.8	3.1e-265
WP_000356856.1|585310_585481_-	hypothetical protein	NA	A0A286QNA2	Streptococcus_phage	63.8	1.1e-07
WP_000965651.1|585899_586079_+	hypothetical protein	NA	J7KIW4	Streptococcus_phage	86.4	2.1e-20
WP_001290370.1|586484_586682_+	hypothetical protein	NA	NA	NA	NA	NA
586266:586346	attR	CTCTTAAAGACGCTGTTAAATAATTCGTCTAGAAAAACCTTGTCATATCAATGTTTATTGATAGCGACAAGGTTCTTTTTT	NA	NA	NA	NA
WP_000254063.1|586725_587658_-	dihydroorotate oxidase	NA	A0A1V0SH91	Hokovirus	43.7	6.7e-65
WP_001185392.1|587844_589080_-	aminoacyltransferase	NA	NA	NA	NA	NA
WP_000285508.1|589098_590310_-	aminoacyltransferase	NA	NA	NA	NA	NA
WP_000527090.1|590322_591558_-	aminoacyltransferase	NA	NA	NA	NA	NA
WP_000200668.1|591542_592355_-	sugar-phosphatase	NA	NA	NA	NA	NA
WP_001003543.1|592425_593742_-	HD domain-containing protein	NA	E3T4P8	Cafeteria_roenbergensis_virus	29.6	8.1e-24
WP_001209458.1|593805_594204_+	DUF1934 domain-containing protein	NA	NA	NA	NA	NA
WP_000910750.1|594547_597232_+	calcium-translocating P-type ATPase, PMCA-type	NA	M1IAU8	Acanthocystis_turfacea_Chlorella_virus	29.3	1.1e-70
WP_000064640.1|598288_600220_+	fructose-1,6-bisphosphatase	NA	NA	NA	NA	NA
WP_000351637.1|600309_601434_+|tRNA	tRNA epoxyqueuosine(34) reductase QueG	tRNA	NA	NA	NA	NA
WP_011324939.1|601502_602600_+	peptide chain release factor 2	NA	NA	NA	NA	NA
WP_001173889.1|602619_603312_+	cell division ATP-binding protein FtsE	NA	G9BWD6	Planktothrix_phage	35.1	1.3e-28
WP_000236202.1|603295_604225_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000468734.1|604246_605695_-|transposase	IS1182-like element IS1563 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	74.3	8.2e-203
WP_001022575.1|605839_606550_-	thioesterase	NA	NA	NA	NA	NA
WP_001115859.1|606546_607245_-	MBL fold metallo-hydrolase	NA	A0A1X9I5D3	Streptococcus_phage	64.9	1.5e-82
WP_000048144.1|607412_608177_+	(S)-acetoin forming diacetyl reductase	NA	V5L4T3	Hirudovirus	31.8	9.8e-06
WP_000458613.1|608289_610797_+	bifunctional DnaQ family exonuclease/ATP-dependent helicase	NA	A0A1X9I5C8	Streptococcus_phage	50.4	4.1e-218
WP_000221826.1|610882_612076_+	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_000038470.1|612096_613443_+|tRNA	asparagine--tRNA ligase	tRNA	A0A2P1EMB4	Moumouvirus	31.4	1.3e-56
WP_000167491.1|613482_614040_-	ECF transporter S component	NA	NA	NA	NA	NA
WP_001031100.1|614036_615020_-	nucleoside hydrolase	NA	NA	NA	NA	NA
WP_000965180.1|615265_615679_-	OsmC family protein	NA	NA	NA	NA	NA
WP_001278848.1|615832_616723_+	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	28.1	5.7e-05
WP_001231102.1|616719_617694_+	YvcK family protein	NA	A1IMD5	Streptococcus_phage	78.8	9.8e-144
WP_000011316.1|617690_618602_+	DNA-binding protein WhiA	NA	Q7AWZ3	Streptococcus_phage	65.7	1.4e-107
WP_000752457.1|618616_620014_+	C69 family dipeptidase	NA	NA	NA	NA	NA
WP_001227408.1|620155_621676_+	zinc ABC transporter substrate-binding protein AdcA	NA	NA	NA	NA	NA
WP_000710758.1|621788_622049_-	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_000583238.1|622157_623093_-	bifunctional oligoribonuclease/PAP phosphatase NrnA	NA	NA	NA	NA	NA
WP_000189641.1|623358_624381_+	adenosine deaminase	NA	NA	NA	NA	NA
WP_001162136.1|624439_624883_+	flavodoxin	NA	NA	NA	NA	NA
WP_000418127.1|624959_625235_+	chorismate mutase	NA	NA	NA	NA	NA
WP_000595708.1|625227_626424_+	voltage-gated chloride channel family protein	NA	A0A1X9I5Z9	Streptococcus_phage	54.5	4.6e-103
WP_001068667.1|627003_627351_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_001872365.1|628113_628380_-	hypothetical protein	NA	Q77YW7	Streptococcus_phage	65.2	9.2e-20
WP_000640620.1|628379_628784_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001122304.1|628945_629146_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_001865698.1|629167_629428_+|transposase	IS3 family transposase	transposase	A0A0C5AEA5	Paenibacillus_phage	43.0	3.4e-11
WP_001867107.1|629553_629763_+|transposase	transposase	transposase	A0A0C5AEA5	Paenibacillus_phage	55.4	1.4e-15
>prophage 3
NC_007432	Streptococcus agalactiae A909, complete sequence	2127839	661087	698679	2127839	terminase,tail,head,holin,portal,protease,capsid	Streptococcus_phage(100.0%)	37	NA	NA
WP_000459854.1|661087_662956_+	ImmA/IrrE family metallo-endopeptidase	NA	E4ZFJ9	Streptococcus_phage	81.0	5.2e-303
WP_001122250.1|663364_663934_+	hypothetical protein	NA	A0A1B0RXB3	Streptococcus_phage	81.0	1.1e-86
WP_000905646.1|663972_665928_-	DNA polymerase	NA	D0R0B0	Streptococcus_phage	84.0	0.0e+00
WP_000464240.1|665977_666142_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000208946.1|666158_666722_-	DUF2815 family protein	NA	A0A1B0RXA9	Streptococcus_phage	93.4	3.3e-91
WP_001873559.1|666726_667848_-	DUF2800 domain-containing protein	NA	A0A1X9I6D8	Streptococcus_phage	87.9	2.6e-196
WP_000041407.1|667840_668164_-	hypothetical protein	NA	A0A1B0RXB7	Streptococcus_phage	71.2	2.0e-32
WP_001160920.1|668560_670846_+	hypothetical protein	NA	E4ZFK6	Streptococcus_phage	79.1	0.0e+00
WP_001208492.1|671129_671411_+	VRR-NUC domain-containing protein	NA	M1PFY8	Streptococcus_phage	79.6	7.9e-38
WP_000768926.1|671391_672768_+	DEAD/DEAH box helicase	NA	A0A1X9I6B0	Streptococcus_phage	86.2	5.2e-231
WP_000356300.1|672760_673258_+	hypothetical protein	NA	A0A1B0RXB9	Streptococcus_phage	75.0	4.3e-63
WP_000640707.1|673650_674688_+	methionine adenosyltransferase	NA	E4ZFL0	Streptococcus_phage	84.9	2.2e-170
WP_001138031.1|674689_675055_+	HNH endonuclease	NA	A0A1B0RXJ3	Streptococcus_phage	86.0	6.6e-61
WP_000999418.1|675342_675798_+	hypothetical protein	NA	A0A1B0RXC6	Streptococcus_phage	51.0	5.4e-44
WP_000211620.1|675769_677026_+	DNA modification methylase	NA	A0A1B0RXE5	Streptococcus_phage	90.7	7.5e-221
WP_000176350.1|677022_678276_+	DNA (cytosine-5-)-methyltransferase	NA	M1NSK8	Streptococcus_phage	93.8	2.5e-232
WP_000164539.1|678353_678608_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000342209.1|678618_679068_+	DUF4314 domain-containing protein	NA	E4ZFL7	Streptococcus_phage	65.2	2.1e-16
WP_000220985.1|679574_681167_+|terminase	terminase large subunit	terminase	A0A1B0RXJ8	Streptococcus_phage	95.5	1.5e-306
WP_001140392.1|681222_681525_+	type II toxin-antitoxin system RelB/DinJ family antitoxin	NA	NA	NA	NA	NA
WP_000666489.1|681524_681830_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000424367.1|681846_682119_+	hypothetical protein	NA	E4ZFM1	Streptococcus_phage	78.0	4.1e-07
WP_000523688.1|682199_683489_+|portal	phage portal protein	portal	E4ZFM3	Streptococcus_phage	91.0	2.0e-229
WP_001225236.1|683481_684180_+|protease	Clp protease ClpP	protease	A0A1B0RXE1	Streptococcus_phage	82.8	1.4e-104
WP_000040500.1|684193_685402_+|capsid	phage major capsid protein	capsid	E4ZFM5	Streptococcus_phage	91.3	6.8e-211
WP_000988605.1|685398_685656_+|head,tail	phage gp6-like head-tail connector protein	head,tail	D0R0D7	Streptococcus_phage	78.8	4.3e-30
WP_000684962.1|685655_685994_+|head,tail	head-tail adaptor protein	head,tail	A0A1B0RXE4	Streptococcus_phage	69.6	1.2e-37
WP_000161241.1|685986_686355_+	HK97 gp10 family phage protein	NA	Q6DMT7	Streptococcus_phage	62.1	9.1e-34
WP_001209971.1|686363_686690_+	hypothetical protein	NA	M1Q1Z4	Streptococcus_phage	67.6	5.4e-38
WP_000818565.1|686692_687262_+	hypothetical protein	NA	E4ZFM9	Streptococcus_phage	97.3	5.1e-100
WP_001249616.1|687273_687693_+	hypothetical protein	NA	A0A1X9I691	Streptococcus_phage	75.5	2.8e-55
WP_000918343.1|687987_691107_+|tail	phage tail tape measure protein	tail	Q6DMT2	Streptococcus_phage	78.0	3.5e-259
WP_000589863.1|691103_691829_+	hypothetical protein	NA	Q6DMT1	Streptococcus_phage	58.8	2.1e-82
WP_000966169.1|691828_694744_+|tail	phage tail protein	tail	Q6DMT0	Streptococcus_phage	64.6	0.0e+00
WP_000796404.1|694756_696613_+	hypothetical protein	NA	Q6DMS9	Streptococcus_phage	73.3	2.7e-259
WP_000661349.1|696630_697029_+|holin	phage holin family protein	holin	D0R0E9	Streptococcus_phage	60.8	5.1e-38
WP_000123549.1|698571_698679_+|holin	putative holin-like toxin	holin	NA	NA	NA	NA
>prophage 4
NC_007432	Streptococcus agalactiae A909, complete sequence	2127839	1578421	1589939	2127839	transposase	Streptococcus_phage(90.91%)	13	NA	NA
WP_000767484.1|1578421_1579249_+	exodeoxyribonuclease III	NA	M1PSC0	Streptococcus_phage	78.0	4.3e-124
WP_000287944.1|1579288_1579645_-	arsenate reductase family protein	NA	M1PLC0	Streptococcus_phage	71.8	1.5e-41
WP_000966772.1|1579646_1580123_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	50.9	7.1e-39
WP_000232156.1|1580177_1581359_-	phosphoglycerate dehydrogenase	NA	M1NSB9	Streptococcus_phage	75.6	7.0e-168
WP_001167085.1|1581421_1581970_-	acetyltransferase	NA	M1PSC3	Streptococcus_phage	58.4	1.1e-54
WP_000603277.1|1583262_1583898_+	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_000425856.1|1584167_1585037_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	70.4	4.9e-110
WP_000358198.1|1585036_1585363_-	DNA replication initiation control protein YabA	NA	M1PFV3	Streptococcus_phage	61.1	3.2e-30
WP_000364565.1|1585392_1586256_-	DNA polymerase III subunit delta'	NA	M1NSC1	Streptococcus_phage	49.7	7.3e-74
WP_000715592.1|1586275_1586911_-	dTMP kinase	NA	M1PSC7	Streptococcus_phage	61.1	2.8e-67
WP_000160532.1|1587119_1588286_+|transposase	IS30-like element ISSag9 family transposase	transposase	NA	NA	NA	NA
WP_001144248.1|1588550_1589210_-	CBS domain-containing protein	NA	M1NSC5	Streptococcus_phage	55.6	5.2e-64
WP_000178146.1|1589228_1589939_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.5	4.7e-18
>prophage 5
NC_007432	Streptococcus agalactiae A909, complete sequence	2127839	2071865	2088866	2127839	integrase	Streptococcus_phage(71.43%)	24	2071032:2071051	2086269:2086288
2071032:2071051	attL	AATTAAAGCATTTTGTTGTA	NA	NA	NA	NA
WP_000381996.1|2071865_2072372_-	DUF4065 domain-containing protein	NA	D7RWK7	Brochothrix_phage	48.8	3.0e-35
WP_000038828.1|2072865_2073252_-	ArpU family transcriptional regulator	NA	A0A141E173	Streptococcus_phage	32.8	1.8e-08
WP_000500996.1|2073226_2073589_-	DUF1492 domain-containing protein	NA	NA	NA	NA	NA
WP_000891149.1|2073988_2074477_-	hypothetical protein	NA	A0A1X9I5V2	Streptococcus_phage	58.0	9.2e-50
WP_000173125.1|2074550_2075096_-	hypothetical protein	NA	A0A1X9I5U4	Streptococcus_phage	57.9	4.2e-27
WP_000838180.1|2075460_2076963_-	DNA primase family protein	NA	Q9AZI5	Lactococcus_phage	37.2	1.6e-63
WP_001029290.1|2076982_2077840_-	primase alpha helix C-terminal domain-containing protein	NA	A0A1X9I6L2	Streptococcus_phage	74.8	2.9e-123
WP_001048305.1|2077840_2078113_-	hypothetical protein	NA	A0A1X9I5U9	Streptococcus_phage	60.0	6.1e-19
WP_000174495.1|2078115_2078445_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000613927.1|2078456_2078651_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000877495.1|2078647_2078980_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025194678.1|2079068_2079521_-	hypothetical protein	NA	A0A1X9I5V7	Streptococcus_phage	34.4	2.0e-06
WP_000074662.1|2079661_2079835_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000130289.1|2080064_2080238_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001021394.1|2080336_2080975_-	Bro-N domain-containing protein	NA	NA	NA	NA	NA
WP_001258609.1|2081210_2081813_-	phage repressor protein	NA	A0A1W6JPC3	Staphylococcus_phage	46.7	6.7e-42
WP_000359663.1|2081836_2082037_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001080841.1|2082242_2082857_+	helix-turn-helix transcriptional regulator	NA	A0A1X9I723	Streptococcus_phage	68.7	2.6e-17
WP_000946250.1|2082868_2083156_+	DUF3102 domain-containing protein	NA	A0A286QMZ8	Streptococcus_phage	61.4	1.9e-10
WP_000429449.1|2083693_2084659_+	DUF3644 domain-containing protein	NA	A0A0N9RUA4	Staphylococcus_phage	51.1	7.1e-86
WP_011324955.1|2084997_2086164_+|integrase	site-specific integrase	integrase	A0A1X9I5Y5	Streptococcus_phage	70.4	3.3e-154
WP_000092759.1|2086270_2086882_-	30S ribosomal protein S4	NA	NA	NA	NA	NA
2086269:2086288	attR	AATTAAAGCATTTTGTTGTA	NA	NA	NA	NA
WP_001278152.1|2087211_2087499_-	Veg family protein	NA	NA	NA	NA	NA
WP_000852645.1|2087510_2088866_-	replicative DNA helicase	NA	A0A1P8VVQ6	Streptococcus_phage	62.6	1.2e-152
>prophage 6
NC_007432	Streptococcus agalactiae A909, complete sequence	2127839	2097186	2104390	2127839		uncultured_Caudovirales_phage(16.67%)	8	NA	NA
WP_001042661.1|2097186_2097891_-	transglycosylase SLT domain-containing protein	NA	A0A2H4J6C5	uncultured_Caudovirales_phage	56.6	3.2e-27
WP_000029067.1|2097996_2098536_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A249XZV3	Enterococcus_phage	46.4	3.0e-17
WP_000359358.1|2098751_2099546_-	energy-coupling factor transporter transmembrane protein EcfT	NA	NA	NA	NA	NA
WP_000510606.1|2099538_2100381_-	energy-coupling factor transporter ATPase	NA	A0A2H4PQG7	Staphylococcus_phage	28.5	2.0e-15
WP_000181757.1|2100356_2101196_-	energy-coupling factor transporter ATPase	NA	G9BWD6	Planktothrix_phage	30.0	3.5e-20
WP_000239224.1|2101195_2101738_-	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_000217765.1|2101860_2103144_-	insulinase family protein	NA	A0A2H4UVM3	Bodo_saltans_virus	23.6	1.6e-05
WP_000706190.1|2103145_2104390_-	insulinase family protein	NA	A0A1X9I714	Streptococcus_phage	41.5	1.7e-87
