The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_007604	Synechococcus elongatus PCC 7942, complete genome	2695903	684050	787211	2695903	terminase,tRNA,tail,integrase,portal,plate,protease	Acidithiobacillus_phage(15.0%)	114	711254:711313	759932:759991
WP_011377683.1|684050_684884_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_011377684.1|684867_685155_-|protease	ATP-dependent Clp protease adapter ClpS	protease	NA	NA	NA	NA
WP_011377685.1|685289_685634_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011243150.1|685630_686185_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_011377686.1|686246_687080_-	HAD family hydrolase	NA	NA	NA	NA	NA
WP_011243148.1|687132_688056_-	30S ribosomal protein S1	NA	NA	NA	NA	NA
WP_011243147.1|688333_688840_-	transcriptional regulator NrdR	NA	NA	NA	NA	NA
WP_011243146.1|689049_689145_-	photosystem II reaction center protein T	NA	NA	NA	NA	NA
WP_011243145.1|689221_690748_-	photosystem II chlorophyll-binding protein CP47	NA	NA	NA	NA	NA
WP_011243144.1|691084_691519_+	(2Fe-2S)-binding protein	NA	NA	NA	NA	NA
WP_011243143.1|691618_691726_+	photosystem II reaction center protein M	NA	NA	NA	NA	NA
WP_011243142.1|691823_692657_-	universal stress protein	NA	NA	NA	NA	NA
WP_011243141.1|692798_693260_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_011377688.1|693256_694045_+	SAM-dependent chlorinase/fluorinase	NA	NA	NA	NA	NA
WP_011377689.1|694071_695280_+	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_011243138.1|695312_695948_+	Vat family streptogramin A O-acetyltransferase	NA	A0A2R8FE91	Brazilian_cedratvirus	44.6	9.0e-29
WP_011243137.1|695934_696570_+	transglutaminase family protein	NA	NA	NA	NA	NA
WP_011377690.1|696576_697191_-	precorrin-6Y C5,15-methyltransferase subunit CbiT	NA	NA	NA	NA	NA
WP_011377691.1|697171_698641_-	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_011243134.1|698707_700459_+	AarF/ABC1/UbiB kinase family protein	NA	A9YVW0	Ostreococcus_tauri_virus	31.1	2.9e-45
WP_011243133.1|700510_700840_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039755832.1|700842_701481_-	DUF3318 domain-containing protein	NA	NA	NA	NA	NA
WP_011243131.1|701603_704897_+	carbamoyl-phosphate synthase large subunit	NA	NA	NA	NA	NA
WP_011243130.1|705072_706350_-	S41 family peptidase	NA	A0A0R6PIZ1	Moraxella_phage	27.8	3.2e-25
WP_011243129.1|706449_707673_-	(E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase	NA	NA	NA	NA	NA
WP_011243128.1|707743_709450_-	N-acetylmuramoyl-L-alanine amidase	NA	NA	NA	NA	NA
WP_071818111.1|709922_711179_+	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
711254:711313	attL	CAGACTCAAAATCTGCCGCTAGCGATAGTGTGTGGGTTCGAGTCCCACCTTGCCCATCAC	NA	NA	NA	NA
WP_011243126.1|711502_712546_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_039755830.1|712521_712740_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011243125.1|713126_713651_-	dCTP deaminase	NA	D6PIK2	uncultured_phage	51.2	2.4e-43
WP_011243124.1|713677_714331_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011243123.1|714327_714831_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039755828.1|714823_715054_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011243122.1|715050_715389_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039755827.1|715385_715589_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011377693.1|715591_715882_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011243121.1|715942_717025_-	hypothetical protein	NA	J7HXB6	Pseudomonas_phage	47.3	2.8e-54
WP_041674884.1|717137_717386_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011243119.1|718003_718447_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011243118.1|718665_720075_+	DEAD/DEAH box helicase	NA	A0A2I5ARD8	Synechococcus_phage	51.6	2.8e-115
WP_011243117.1|720067_720430_+	VRR-NUC domain-containing protein	NA	A0A2I5ARE6	Synechococcus_phage	56.8	6.9e-26
WP_011377695.1|720422_722966_+	hypothetical protein	NA	G8EY43	Synechococcus_phage	41.5	2.8e-113
WP_011243115.1|723235_723781_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011243114.1|723805_724411_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011243113.1|724625_725165_+	hypothetical protein	NA	K4ICN8	Acidithiobacillus_phage	35.9	1.1e-16
WP_011243112.1|725473_727354_+|terminase	phage terminase large subunit family protein	terminase	A0A1B2LRQ2	Wolbachia_phage	52.1	4.3e-188
WP_011243111.1|727481_727691_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011243110.1|727690_729154_+|portal	phage portal protein	portal	Q75QM9	Wolbachia_phage	39.9	1.5e-82
WP_011243109.1|729176_731051_+	hypothetical protein	NA	B7SYD7	Stenotrophomonas_phage	32.1	8.4e-75
WP_011243108.1|731098_731428_+	DUF2190 family protein	NA	A0A2I7S8N5	Vibrio_phage	39.7	4.5e-08
WP_011243107.1|731433_731745_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155813976.1|731716_732376_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041674885.1|732372_732729_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011377697.1|732709_733270_+|plate	phage baseplate assembly protein V	plate	Q9JML8	Wolbachia_phage	33.9	2.7e-21
WP_039756023.1|733284_733536_+	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_011243104.1|733535_733880_+|plate	phage baseplate protein	plate	A0A088FV58	Escherichia_phage	58.0	8.0e-32
WP_011243103.1|733876_734716_+	hypothetical protein	NA	K4HZB7	Acidithiobacillus_phage	48.7	2.9e-59
WP_011243102.1|734712_735552_+|tail	phage tail protein	tail	K4I1F8	Acidithiobacillus_phage	39.4	1.3e-38
WP_011243101.1|735650_736136_+	hypothetical protein	NA	K4I002	Acidithiobacillus_phage	34.5	7.1e-26
WP_011377698.1|736139_738155_+	DUF4815 domain-containing protein	NA	K4ICQ5	Acidithiobacillus_phage	44.0	2.2e-153
WP_011377699.1|738158_739610_+	hypothetical protein	NA	A0A1B2LRR4	Wolbachia_phage	37.1	2.8e-70
WP_011377700.1|739614_740778_+|tail	phage tail protein	tail	E5E3V2	Burkholderia_phage	49.6	2.9e-25
WP_011377701.1|740781_741288_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011377702.1|741395_742820_+	hypothetical protein	NA	A0A193GYC3	Enterobacter_phage	61.7	4.3e-140
WP_011377703.1|742816_743320_+|tail	phage major tail tube protein	tail	K4I1G5	Acidithiobacillus_phage	56.0	8.6e-51
WP_011377704.1|743323_743614_+|tail	phage tail assembly protein	tail	Q75QK8	Wolbachia_phage	32.4	6.3e-06
WP_155813977.1|743610_743748_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011377705.1|743737_746590_+|tail	phage tail tape measure protein	tail	A0A193GYN8	Enterobacter_phage	23.2	2.6e-11
WP_011243093.1|746589_747510_+|tail	phage tail protein	tail	A0A193GYE0	Enterobacter_phage	50.8	2.6e-29
WP_011243092.1|747509_747722_+|tail	phage tail protein	tail	A0A1S6KZY4	Salmonella_phage	46.7	1.1e-12
WP_011377706.1|747718_749161_+	late control protein D	NA	D4HTW7	Vibrio_phage	33.7	1.4e-40
WP_011377708.1|749430_750009_+	DUF882 domain-containing protein	NA	A0A2I7R851	Vibrio_phage	35.5	3.0e-07
WP_039755822.1|750008_750203_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155813884.1|750232_750409_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011243089.1|750405_750870_+	chain A, D20c mutant of T4 lysozyme	NA	A0A1J0GVQ7	Pseudoalteromonas_phage	50.4	4.1e-31
WP_049749325.1|751141_751957_+	hypothetical protein	NA	A0A142KAR9	Gordonia_phage	29.9	2.6e-28
WP_011377710.1|751958_752381_+	DUF488 domain-containing protein	NA	NA	NA	NA	NA
WP_011377711.1|752573_753953_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011377712.1|753962_754553_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011243086.1|754778_755507_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011243085.1|756009_756561_-	SocA family protein	NA	NA	NA	NA	NA
WP_081429504.1|756988_757387_-	helix-turn-helix transcriptional regulator	NA	A0A2H4PAP1	Aphanizomenon_phage	41.0	1.2e-07
WP_011377714.1|757355_757595_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_071818112.1|757686_757905_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_039755818.1|758048_758327_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011243082.1|758389_759037_+	DNA damage-inducible protein	NA	H6U5J3	Mycobacterium_phage	50.0	7.7e-20
WP_039755816.1|759047_759254_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011377716.1|759412_759847_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155813880.1|759962_760139_+	hypothetical protein	NA	NA	NA	NA	NA
759932:759991	attR	CAGACTCAAAATCTGCCGCTAGCGATAGTGTGTGGGTTCGAGTCCCACCTTGCCCATCAC	NA	NA	NA	NA
WP_126146781.1|760249_760447_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155813878.1|760485_761178_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011377718.1|761225_762128_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011377719.1|762158_763643_+	bifunctional metallophosphatase/5'-nucleotidase	NA	S4W5J5	Pandoravirus	24.9	2.9e-22
WP_011243077.1|763639_764854_-	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_011243076.1|764983_765577_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039755814.1|765591_766140_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_011243074.1|766215_767103_+	alpha/beta hydrolase	NA	E0YQD5	Mycobacterium_phage	33.3	3.9e-06
WP_011243073.1|767241_767721_-	divergent PAP2 family protein	NA	NA	NA	NA	NA
WP_011243072.1|767720_768626_-	polyprenyl synthetase family protein	NA	NA	NA	NA	NA
WP_011377721.1|768668_769538_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	39.9	3.3e-34
WP_011377722.1|769573_770038_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039756018.1|770043_772593_+	HDIG domain-containing protein	NA	NA	NA	NA	NA
WP_011377724.1|772584_773958_-	serine/threonine protein kinase	NA	M1PCM5	Moumouvirus	25.8	7.7e-09
WP_011377725.1|774003_776520_-	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	37.1	1.3e-174
WP_011377726.1|776759_778556_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.2	2.1e-51
WP_011243066.1|778588_779245_-	ATP phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_011243065.1|779530_779848_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155813978.1|779777_781919_+	PBP1A family penicillin-binding protein	NA	NA	NA	NA	NA
WP_011377728.1|782075_782942_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011243062.1|783006_783885_+	purple acid phosphatase	NA	NA	NA	NA	NA
WP_011243061.1|783953_784748_-	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_011243060.1|784843_785167_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011377729.1|785281_785710_-	RNA-binding region RNP-1	NA	NA	NA	NA	NA
WP_011377730.1|785972_787211_-|tRNA	CCA tRNA nucleotidyltransferase	tRNA	A0A219YCT8	Aeromonas_phage	39.0	9.6e-19
