The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_007606	Shigella dysenteriae Sd197, complete sequence	4369232	180497	335005	4369232	tRNA,protease,transposase	Escherichia_phage(27.27%)	115	NA	NA
WP_087786203.1|180497_181191_+|transposase	IS1-like element IS1N family transposase	transposase	A0A0U2RK18	Escherichia_phage	95.2	4.4e-130
WP_000753949.1|181863_183288_+|protease	serine endoprotease DegP	protease	A0A1B1IT49	uncultured_Mediterranean_phage	28.8	1.6e-25
WP_000272188.1|184684_185071_-	DUF3461 family protein	NA	NA	NA	NA	NA
WP_001186643.1|185384_186209_-	2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase	NA	NA	NA	NA	NA
WP_001094577.1|186239_188912_-	bifunctional uridylyltransferase/uridylyl-removing protein GlnD	NA	NA	NA	NA	NA
WP_001018194.1|188973_189768_-	type I methionyl aminopeptidase	NA	NA	NA	NA	NA
WP_000246882.1|190135_190861_+	30S ribosomal protein S2	NA	NA	NA	NA	NA
WP_000818114.1|191118_191970_+	elongation factor Ts	NA	NA	NA	NA	NA
WP_000224576.1|192116_192842_+	UMP kinase	NA	NA	NA	NA	NA
WP_000622418.1|193133_193691_+	ribosome recycling factor	NA	NA	NA	NA	NA
WP_000811921.1|193782_194979_+	1-deoxy-D-xylulose-5-phosphate reductoisomerase	NA	NA	NA	NA	NA
WP_001295562.1|195167_195926_+	(2E,6E)-farnesyl-diphosphate-specific ditrans,polycis-undecaprenyl-diphosphate synthase	NA	R9W0U9	Flavobacterium_phage	44.4	7.7e-27
WP_000922457.1|195938_196796_+	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_011378573.1|196807_198160_+|protease	sigma E protease regulator RseP	protease	NA	NA	NA	NA
WP_001240879.1|198189_200622_+	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
WP_000758956.1|200743_201229_+	molecular chaperone Skp	NA	NA	NA	NA	NA
WP_001139279.1|201232_202258_+	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_000210739.1|202362_202818_+	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_000565966.1|202821_203610_+	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
WP_000139657.1|203609_204758_+	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
WP_000569431.1|204754_205351_+	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	40.0	1.8e-26
WP_001294745.1|205387_208870_+	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.8	3.7e-209
WP_000055741.1|208882_209842_+	acetyl-CoA carboxylase carboxyl transferase subunit alpha	NA	NA	NA	NA	NA
WP_001021035.1|209940_210120_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038814217.1|212901_213291_+	VOC family protein	NA	NA	NA	NA	NA
WP_000176586.1|213358_214654_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_000062312.1|214706_214967_-	Rho-binding antiterminator	NA	NA	NA	NA	NA
WP_000417058.1|214953_215154_-	YaeP family protein	NA	NA	NA	NA	NA
WP_001185307.1|215319_215865_+	YaeQ family protein	NA	NA	NA	NA	NA
WP_000635559.1|215861_216284_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_000239185.1|216297_217008_+	envelope stress response activation lipoprotein NlpE	NA	NA	NA	NA	NA
WP_005020738.1|217151_217976_-	YaeF family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_001260719.1|218028_219747_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_000094004.1|219857_220565_-|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
WP_001202329.1|220561_220966_-	Rcs stress response system protein RcsF	NA	NA	NA	NA	NA
WP_000874233.1|221083_221899_-	methionine ABC transporter substrate-binding lipoprotein MetQ	NA	NA	NA	NA	NA
WP_001294603.1|221938_222592_-	methionine ABC transporter permease MetI	NA	NA	NA	NA	NA
WP_000594003.1|222584_223616_-	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	40.2	5.5e-36
WP_001140169.1|223803_224376_+	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_000648592.1|230926_231841_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001230979.1|232081_232882_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000644696.1|233761_235120_-	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	7.6e-09
WP_001052711.1|235191_235947_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_005020714.1|235980_236703_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000917883.1|236699_237167_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.0e-50
WP_001301976.1|237231_237963_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.5	9.9e-40
WP_005020710.1|239151_239406_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001414527.1|240925_241078_-	hypothetical protein	NA	NA	NA	NA	NA
WP_134802583.1|241441_242135_+|transposase	IS1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	93.9	4.1e-128
WP_001118024.1|243524_244295_-	2-oxoglutaramate amidase	NA	NA	NA	NA	NA
WP_000533149.1|244448_244922_+	C-lysozyme inhibitor	NA	NA	NA	NA	NA
WP_011378551.1|247648_248227_+	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	32.0	2.5e-14
WP_000333379.1|248432_249200_+	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_001225679.1|249170_249911_-	murein L,D-transpeptidase	NA	NA	NA	NA	NA
WP_000615980.1|250066_250345_-	type II toxin-antitoxin system mRNA interferase toxin YafQ	NA	NA	NA	NA	NA
WP_000729709.1|250347_250608_-	type II toxin-antitoxin system antitoxin DinJ	NA	NA	NA	NA	NA
WP_011378552.1|250817_251567_+	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	37.7	2.6e-19
WP_134801557.1|252116_252810_+|transposase	IS1-like element IS1N family transposase	transposase	A0A0U2RK18	Escherichia_phage	95.7	2.6e-130
WP_134801557.1|254652_255347_-|transposase	IS1-like element IS1N family transposase	transposase	A0A0U2RK18	Escherichia_phage	95.7	2.6e-130
WP_134801557.1|255701_256395_+|transposase	IS1-like element IS1N family transposase	transposase	A0A0U2RK18	Escherichia_phage	95.7	2.6e-130
WP_000580892.1|263933_265604_+	acyl-CoA synthetase FdrA	NA	NA	NA	NA	NA
WP_000495347.1|265613_266873_+	DUF1116 domain-containing protein	NA	NA	NA	NA	NA
WP_000152507.1|266883_267699_+	DUF2877 domain-containing protein	NA	NA	NA	NA	NA
WP_000815558.1|269504_270572_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_011378555.1|270568_271078_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	NA	NA	NA	NA
WP_000212265.1|271195_271918_-	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_000256002.1|271920_272415_-	peptidylprolyl isomerase B	NA	NA	NA	NA	NA
WP_000912364.1|272588_273974_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.8	6.7e-45
WP_000729153.1|274852_275719_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.3e-30
WP_171554031.1|276713_277870_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.7	1.8e-67
WP_000817241.1|279903_280599_+	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	67.6	1.2e-87
WP_001194525.1|280650_281049_-	long-chain acyl-CoA thioesterase FadM	NA	NA	NA	NA	NA
WP_000680314.1|281929_282301_-	helix-hairpin-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000969091.1|282451_284323_-	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_001043542.1|284514_284787_-	DNA-binding protein HU-beta	NA	A7KV42	Bacillus_phage	58.4	1.1e-20
WP_000130305.1|287546_288821_-|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	56.4	8.7e-132
WP_000122253.1|288946_289570_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	63.9	2.9e-64
WP_001198384.1|289814_291113_-	trigger factor	NA	NA	NA	NA	NA
WP_000788433.1|291259_291406_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000973448.1|291456_291774_-	transcriptional regulator BolA	NA	NA	NA	NA	NA
WP_005020628.1|292078_292657_+	lipoprotein	NA	NA	NA	NA	NA
WP_000098430.1|292700_294176_+	muropeptide MFS transporter AmpG	NA	NA	NA	NA	NA
WP_134801570.1|294272_294967_-|transposase	IS1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	94.8	7.5e-130
WP_001000964.1|295067_296432_+	MFS transporter	NA	NA	NA	NA	NA
WP_001138898.1|296559_297051_-	nucleotide binding protein YajQ	NA	NA	NA	NA	NA
WP_000705855.1|297218_298130_+	2-dehydropantoate 2-reductase	NA	NA	NA	NA	NA
WP_000116409.1|298092_298683_+	protein deglycase YajL	NA	NA	NA	NA	NA
WP_000668706.1|298736_300185_-|tRNA	tRNA 4-thiouridine(8) synthase ThiI	tRNA	NA	NA	NA	NA
WP_001124935.1|300390_300633_+	exodeoxyribonuclease VII small subunit	NA	NA	NA	NA	NA
WP_000347217.1|300632_301532_+	(2E,6E)-farnesyl diphosphate synthase	NA	NA	NA	NA	NA
WP_000006826.1|301556_303419_+	1-deoxy-D-xylulose-5-phosphate synthase	NA	NA	NA	NA	NA
WP_001199782.1|303473_304448_+	1-deoxyxylulose-5-phosphate synthase YajO	NA	NA	NA	NA	NA
WP_134801626.1|304525_305219_+|transposase	IS1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	94.8	1.7e-129
WP_134801970.1|305621_306316_-|transposase	IS1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	94.4	1.2e-127
WP_011378564.1|306387_306627_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000154054.1|306804_307320_-	phosphatidylglycerophosphatase A	NA	NA	NA	NA	NA
WP_000742105.1|307297_308275_-	thiamine-phosphate kinase	NA	NA	NA	NA	NA
WP_000801125.1|308352_308772_-	transcription antitermination factor NusB	NA	NA	NA	NA	NA
WP_001021161.1|308791_309262_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	47.4	1.3e-29
WP_001150433.1|309350_310454_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	35.8	1.4e-53
WP_000543535.1|310457_310907_-	transcriptional regulator NrdR	NA	NA	NA	NA	NA
WP_005020615.1|311057_311597_+	DUF3251 domain-containing protein	NA	NA	NA	NA	NA
WP_001295328.1|311895_312780_+	nucleoside-specific channel-forming protein Tsx	NA	NA	NA	NA	NA
WP_000974813.1|312956_313304_-	HNH nuclease family protein	NA	NA	NA	NA	NA
WP_000046643.1|313432_314404_-	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	37.9	6.1e-45
WP_000934822.1|314414_316262_-	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_000007629.1|316289_316622_-	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	33.0	2.8e-10
WP_000667319.1|316644_317772_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	46.1	2.1e-89
WP_001266503.1|317826_318897_-|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_001295329.1|322221_323595_-	proline-specific permease ProY	NA	NA	NA	NA	NA
WP_000149639.1|323670_324990_-	branched-chain amino acid transporter carrier protein BrnQ	NA	NA	NA	NA	NA
WP_000113934.1|326750_327440_-	phosphate response regulator transcription factor PhoB	NA	W8CYM9	Bacillus_phage	38.0	4.4e-37
WP_005020581.1|328416_329763_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_000698860.1|330266_333404_+	exonuclease subunit SbcC	NA	G3MAB6	Bacillus_virus	26.9	7.6e-12
WP_134801973.1|334311_335005_+|transposase	IS1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	94.4	8.3e-129
>prophage 2
NC_007606	Shigella dysenteriae Sd197, complete sequence	4369232	338248	429055	4369232	tRNA,protease,transposase	Escherichia_phage(37.5%)	57	NA	NA
WP_134801557.1|338248_338943_-|transposase	IS1-like element IS1N family transposase	transposase	A0A0U2RK18	Escherichia_phage	95.7	2.6e-130
WP_134801998.1|340067_341295_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	98.7	1.1e-176
WP_000941939.1|342328_342613_-	pyrimidine/purine nucleoside phosphorylase	NA	NA	NA	NA	NA
WP_001276400.1|342684_343362_-	AroM family protein	NA	NA	NA	NA	NA
WP_001142437.1|343619_343811_-	protein YaiA	NA	NA	NA	NA	NA
WP_000193380.1|343860_344385_-	shikimate kinase AroL	NA	NA	NA	NA	NA
WP_000158159.1|344567_345026_-	YaiI/YqxD family protein	NA	NA	NA	NA	NA
WP_005020551.1|345145_345955_+	pyrroline-5-carboxylate reductase	NA	NA	NA	NA	NA
WP_000484075.1|345971_347087_-	diguanylate cyclase AdrA	NA	A0A127AWB9	Bacillus_phage	34.5	1.1e-18
WP_134801725.1|350376_351070_+|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
WP_000792965.1|351183_351444_-	anti-adapter protein IraP	NA	NA	NA	NA	NA
WP_134801569.1|351495_352190_-|transposase	IS1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	94.4	4.1e-128
WP_001300163.1|352398_352602_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000413699.1|352679_353774_+	D-alanine--D-alanine ligase	NA	NA	NA	NA	NA
WP_001295334.1|353797_354010_-	DUF2754 domain-containing protein	NA	NA	NA	NA	NA
WP_000763147.1|354269_354578_+	DUF2755 family protein	NA	NA	NA	NA	NA
WP_000092029.1|354636_355731_-	surface-exposed outer membrane lipoprotein YaiW	NA	NA	NA	NA	NA
WP_001301663.1|355743_356964_-	peptide antibiotic transporter SbmA	NA	NA	NA	NA	NA
WP_000830736.1|357315_358485_+	D-alanyl-D-alanine- carboxypeptidase/endopeptidase AmpH	NA	A0A2H4JAN9	uncultured_Caudovirales_phage	23.0	2.3e-06
WP_134801975.1|358870_359564_+|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
WP_134802579.1|361180_361874_+|transposase	IS1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	94.8	2.9e-129
WP_011378570.1|365262_366345_-	DNA-binding transcriptional repressor LacI	NA	C6ZCU4	Enterobacteria_phage	99.2	1.6e-190
WP_171554032.1|366879_368035_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	1.2e-68
WP_001342065.1|368662_369121_+	DNA-binding transcriptional regulator DecR	NA	NA	NA	NA	NA
WP_001235614.1|369150_370923_+	SmdA family multidrug ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.1	2.6e-49
WP_001256185.1|370915_372697_+	SmdB family multidrug efflux ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	26.9	2.6e-41
WP_000780338.1|372877_373216_+	P-II family nitrogen regulator	NA	NA	NA	NA	NA
WP_000685038.1|373245_374532_+	ammonium transporter AmtB	NA	NA	NA	NA	NA
WP_000076838.1|374580_375441_-	acyl-CoA thioesterase II	NA	NA	NA	NA	NA
WP_000409911.1|376261_376573_-	MGMT family protein	NA	NA	NA	NA	NA
WP_000878140.1|376951_377305_+	DUF1428 domain-containing protein	NA	NA	NA	NA	NA
WP_000141271.1|381010_381826_-	HTH-type transcriptional repressor AllR	NA	NA	NA	NA	NA
WP_000776388.1|381903_382386_-	ureidoglycolate lyase	NA	NA	NA	NA	NA
WP_000460148.1|382614_383541_+	HTH-type transcriptional activator AllS	NA	NA	NA	NA	NA
WP_001157988.1|383609_384704_+|tRNA	tRNA 2-selenouridine(34) synthase MnmH	tRNA	NA	NA	NA	NA
WP_001110582.1|389099_389786_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.2	1.1e-32
WP_024259465.1|389756_390380_+|protease	multifunctional acyl-CoA thioesterase I/protease I/lysophospholipase L1	protease	NA	NA	NA	NA
WP_000148920.1|390369_391179_+	NADP(+)-dependent aldehyde reductase	NA	NA	NA	NA	NA
WP_001295322.1|391239_392094_+	chaperedoxin	NA	NA	NA	NA	NA
WP_024262950.1|392156_392936_-	iron export ABC transporter permease subunit FetB	NA	NA	NA	NA	NA
WP_001157535.1|392922_393600_-	iron ABC transporter ATP-binding protein FetA	NA	G3M9Y6	Bacillus_virus	34.3	2.4e-27
WP_000904507.1|393745_394663_+	SPFH/Band 7/PHB domain protein	NA	NA	NA	NA	NA
WP_000970312.1|394659_395118_+	NfeD family protein	NA	NA	NA	NA	NA
WP_001001640.1|395197_395560_-	hypothetical protein	NA	NA	NA	NA	NA
WP_134801618.1|396352_397046_+|transposase	IS1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	94.8	9.8e-130
WP_001026754.1|397195_397603_-	Cu(I)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_001014331.1|397599_398775_-	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_000918620.1|403102_407500_-	Ig-like domain-containing protein	NA	NA	NA	NA	NA
WP_001111779.1|407524_411472_-	Ig-like domain-containing protein	NA	NA	NA	NA	NA
WP_134801584.1|415931_416625_+|transposase	IS1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	94.8	2.9e-129
WP_000982163.1|418511_419804_-	amino acid permease	NA	NA	NA	NA	NA
WP_000083981.1|421001_423506_+	copper-exporting P-type ATPase CopA	NA	A0A218MNH6	uncultured_virus	38.4	1.0e-115
WP_005019474.1|423619_423961_-	HigA family addiction module antidote protein	NA	A0A222YWD7	Escherichia_phage	76.2	6.0e-40
WP_000365184.1|424098_424893_+	TraB/GumN family protein	NA	NA	NA	NA	NA
WP_000186627.1|425096_425576_+|tRNA	Cys-tRNA(Pro)/Cys-tRNA(Cys) deacylase YbaK	tRNA	NA	NA	NA	NA
WP_000771787.1|425612_427265_-	bifunctional UDP-sugar hydrolase/5'-nucleotidase	NA	NA	NA	NA	NA
WP_005019467.1|427708_429055_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 3
NC_007606	Shigella dysenteriae Sd197, complete sequence	4369232	455016	524209	4369232	transposase	Escherichia_phage(27.27%)	48	NA	NA
WP_165442257.1|455016_456244_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.0	1.9e-176
WP_134801565.1|458668_459362_+|transposase	IS1-like element IS1N family transposase	transposase	A0A0U2RK18	Escherichia_phage	95.2	5.8e-130
WP_000893250.1|460592_461846_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.0	2.2e-95
WP_001285288.1|461857_462961_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000174704.1|463960_464362_-	sigma factor-binding protein Crl	NA	NA	NA	NA	NA
WP_000189527.1|464419_465664_-	esterase FrsA	NA	NA	NA	NA	NA
WP_001291990.1|465755_466214_-	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001293005.1|466474_467932_+	cytosol nonspecific dipeptidase	NA	NA	NA	NA	NA
WP_023438539.1|467988_468546_-	peptide chain release factor H	NA	NA	NA	NA	NA
WP_001624623.1|468457_468724_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001226160.1|469479_470535_-	DNA polymerase IV	NA	NA	NA	NA	NA
WP_001232563.1|470605_471529_-	putative lateral flagellar export/assembly protein LafU	NA	NA	NA	NA	NA
WP_134801618.1|472197_472891_+|transposase	IS1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	94.8	9.8e-130
WP_000786304.1|475428_476805_+	phenylalanine transporter	NA	NA	NA	NA	NA
WP_001153149.1|476872_478120_-	mechanosensitive ion channel YbdG	NA	NA	NA	NA	NA
WP_000351475.1|478227_478881_-	oxygen-insensitive NAD(P)H nitroreductase	NA	NA	NA	NA	NA
WP_000360951.1|478974_479343_-	MmcQ/YjbR family DNA-binding protein	NA	NA	NA	NA	NA
WP_000682488.1|479407_479656_-	DUF1158 domain-containing protein	NA	NA	NA	NA	NA
WP_001131209.1|479721_480840_-	glutamate--cysteine ligase	NA	NA	NA	NA	NA
WP_023600406.1|481278_481431_+	type I toxin-antitoxin system Hok family toxin	NA	NA	NA	NA	NA
WP_165442258.1|481763_482992_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.0	6.5e-177
WP_001295337.1|485879_486854_+	porphobilinogen synthase	NA	NA	NA	NA	NA
WP_000004058.1|486960_487812_-	taurine dioxygenase	NA	NA	NA	NA	NA
WP_000114603.1|487808_488636_-	taurine ABC transporter permease TauC	NA	NA	NA	NA	NA
WP_000939378.1|488632_489400_-	taurine ABC transporter ATP-binding subunit	NA	G9BWD6	Planktothrix_phage	40.3	1.1e-25
WP_001018407.1|489412_490375_-	taurine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000621916.1|490677_491307_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_000956466.1|493716_493869_+	type I toxin-antitoxin system toxin HokE	NA	NA	NA	NA	NA
WP_005019349.1|493990_494611_-	enterobactin synthase subunit EntD	NA	NA	NA	NA	NA
WP_001034900.1|494785_497026_-	siderophore enterobactin receptor FepA	NA	NA	NA	NA	NA
WP_000125828.1|497268_498471_+	enterochelin esterase	NA	NA	NA	NA	NA
WP_000885783.1|498473_498692_+	enterobactin biosynthesis protein YbdZ	NA	NA	NA	NA	NA
WP_000077781.1|498688_502570_+	enterobactin non-ribosomal peptide synthetase EntF	NA	A0A2K9KZV5	Tupanvirus	29.2	2.1e-59
WP_000096698.1|503561_504695_+	LPS O-antigen length regulator	NA	NA	NA	NA	NA
WP_000140647.1|504691_505507_-	iron-enterobactin ABC transporter ATP-binding protein	NA	A0A1V0SJ29	Klosneuvirus	22.0	7.3e-07
WP_000640995.1|505503_506496_-	iron-enterobactin ABC transporter permease	NA	NA	NA	NA	NA
WP_005019334.1|506492_507497_-	Fe(3+)-siderophore ABC transporter permease	NA	NA	NA	NA	NA
WP_001041801.1|507607_508858_+	enterobactin transporter EntS	NA	NA	NA	NA	NA
WP_001234336.1|508938_509904_-	Fe2+-enterobactin ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000381303.1|510092_511268_+	isochorismate synthase EntC	NA	NA	NA	NA	NA
WP_000026832.1|511277_512888_+	(2,3-dihydroxybenzoyl)adenylate synthase	NA	NA	NA	NA	NA
WP_001007154.1|512901_513759_+	enterobactin biosynthesis bifunctional isochorismatase/aryl carrier protein EntB	NA	NA	NA	NA	NA
WP_000347670.1|513758_514505_+	2,3-dihydro-2,3-dihydroxybenzoate dehydrogenase	NA	NA	NA	NA	NA
WP_000637953.1|514507_514921_+	proofreading thioesterase EntH	NA	NA	NA	NA	NA
WP_000460431.1|517388_517586_+	YbdD/YjiX family protein	NA	NA	NA	NA	NA
WP_001120489.1|517595_518684_-	hydroxycarboxylate dehydrogenase HcxA	NA	NA	NA	NA	NA
WP_134801643.1|521208_522364_+|transposase	IS3-like element IS600 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
WP_087786203.1|523515_524209_+|transposase	IS1-like element IS1N family transposase	transposase	A0A0U2RK18	Escherichia_phage	95.2	4.4e-130
>prophage 4
NC_007606	Shigella dysenteriae Sd197, complete sequence	4369232	602306	673647	4369232	integrase,transposase	Escherichia_phage(28.57%)	59	662218:662232	672668:672682
WP_134801557.1|602306_603001_-|transposase	IS1-like element IS1N family transposase	transposase	A0A0U2RK18	Escherichia_phage	95.7	2.6e-130
WP_164924995.1|603706_604401_-|transposase	IS1-like element IS1N family transposase	transposase	A0A0U2RK18	Escherichia_phage	95.2	8.3e-129
WP_000954499.1|604544_604802_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001076008.1|604975_605485_+	YbgA family protein	NA	NA	NA	NA	NA
WP_000207124.1|605481_606900_+	deoxyribodipyrimidine photo-lyase	NA	A0A1V0SGL1	Hokovirus	32.8	2.6e-60
WP_000798878.1|608801_609545_+	radiation resistance protein YbgI	NA	NA	NA	NA	NA
WP_001188362.1|609567_610224_+	5-oxoprolinase subunit PxpB	NA	NA	NA	NA	NA
WP_000912729.1|610217_611150_+	5-oxoprolinase subunit PxpC	NA	NA	NA	NA	NA
WP_000687138.1|611139_611874_+	5-oxoprolinase subunit PxpA	NA	NA	NA	NA	NA
WP_001114030.1|611909_612701_+	endonuclease VIII	NA	A0A1V0CNR6	Kaumoebavirus	28.8	4.9e-08
WP_024259447.1|612697_613744_-	AbrB family transcriptional regulator	NA	NA	NA	NA	NA
WP_001209724.1|613892_614954_-	fimbrial protein	NA	NA	NA	NA	NA
WP_134801557.1|615568_616262_+|transposase	IS1-like element IS1N family transposase	transposase	A0A0U2RK18	Escherichia_phage	95.7	2.6e-130
WP_000472401.1|618979_619546_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_000132663.1|620709_621993_-	citrate (Si)-synthase	NA	NA	NA	NA	NA
WP_001305582.1|622198_622306_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000263347.1|622686_623091_+	succinate dehydrogenase cytochrome b556 subunit	NA	NA	NA	NA	NA
WP_000254365.1|623084_623432_+	succinate dehydrogenase membrane anchor subunit	NA	NA	NA	NA	NA
WP_000775528.1|623431_625198_+	succinate dehydrogenase flavoprotein subunit	NA	NA	NA	NA	NA
WP_001235253.1|625213_625930_+	succinate dehydrogenase iron-sulfur subunit SdhB	NA	NA	NA	NA	NA
WP_001181467.1|626230_629032_+	2-oxoglutarate dehydrogenase E1 component	NA	NA	NA	NA	NA
WP_000099820.1|629046_630264_+	2-oxoglutarate dehydrogenase complex dihydrolipoyllysine-residue succinyltransferase	NA	NA	NA	NA	NA
WP_001048585.1|630357_631524_+	ADP-forming succinate--CoA ligase subunit beta	NA	NA	NA	NA	NA
WP_000025448.1|631523_632393_+	succinate--CoA ligase subunit alpha	NA	NA	NA	NA	NA
WP_000124253.1|634674_636045_-	acyclic terpene utilization AtuA family protein	NA	NA	NA	NA	NA
WP_000695033.1|636048_637290_-	methylaspartate ammonia-lyase	NA	NA	NA	NA	NA
WP_000423331.1|637289_638654_-	methylaspartate mutase subunit E	NA	NA	NA	NA	NA
WP_001167716.1|638672_640061_-	glutamate mutase L	NA	NA	NA	NA	NA
WP_000710390.1|640060_640510_-	methylaspartate mutase subunit S	NA	NA	NA	NA	NA
WP_005019962.1|644085_645654_+	cytochrome ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_000568281.1|645669_646809_+	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_000270282.1|646823_646937_+	cytochrome bd-I oxidase subunit CydX	NA	NA	NA	NA	NA
WP_000034602.1|646936_647230_+	cyd operon protein YbgE	NA	NA	NA	NA	NA
WP_001098373.1|647379_647784_+	tol-pal system-associated acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_000131320.1|647780_648473_+	Tol-Pal system protein TolQ	NA	NA	NA	NA	NA
WP_000090097.1|648476_648905_+	colicin uptake protein TolR	NA	NA	NA	NA	NA
WP_000030103.1|648969_650235_+	cell envelope integrity protein TolA	NA	NA	NA	NA	NA
WP_011378599.1|650367_651660_+	Tol-Pal system protein TolB	NA	NA	NA	NA	NA
WP_005019976.1|651694_652216_+	peptidoglycan-associated lipoprotein Pal	NA	NA	NA	NA	NA
WP_000097577.1|652225_653017_+	cell division protein CpoB	NA	NA	NA	NA	NA
WP_000115269.1|653865_654909_+	quinolinate synthase NadA	NA	NA	NA	NA	NA
WP_000345429.1|654946_655666_+	nicotinamide riboside transporter PnuC	NA	A0A126HGA3	Vibrio_phage	32.7	9.2e-22
WP_000951292.1|655662_656604_-	CDF family zinc transporter ZitB	NA	A0A1V0SED0	Indivirus	28.2	2.2e-23
WP_000784362.1|656717_657098_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001109196.1|658186_659239_+	3-deoxy-7-phosphoheptulonate synthase AroG	NA	A0A2I6UFP9	Klebsiella_phage	49.4	3.4e-81
WP_005019991.1|659397_660150_-	2,3-diphosphoglycerate-dependent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_000931374.1|660354_661395_-	galactose-1-epimerase	NA	NA	NA	NA	NA
WP_000053411.1|661388_662537_-	galactokinase	NA	NA	NA	NA	NA
662218:662232	attL	TTACGCAGTTGCAGA	NA	NA	NA	NA
WP_000191540.1|662540_663587_-	galactose-1-phosphate uridylyltransferase	NA	NA	NA	NA	NA
WP_001265469.1|663596_664613_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	45.7	8.9e-79
WP_000096866.1|664874_666347_-	molybdate ABC transporter ATP-binding protein ModF	NA	A0A1M7XV31	Cedratvirus	28.3	4.2e-13
WP_001147428.1|666414_667203_-	molybdenum-dependent transcriptional regulator	NA	NA	NA	NA	NA
WP_000891515.1|667331_667481_+	multidrug efflux pump accessory protein AcrZ	NA	NA	NA	NA	NA
WP_000101990.1|667647_668421_+	molybdate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000604034.1|668420_669110_+	molybdate ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_000891685.1|669112_670171_+	molybdenum ABC transporter ATP-binding protein ModC	NA	G9BWD6	Planktothrix_phage	35.7	2.6e-20
WP_023636798.1|671225_671669_-|integrase	tyrosine-type recombinase/integrase	integrase	K7PHK0	Enterobacteria_phage	49.3	9.9e-35
WP_171554035.1|671725_672882_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.7	1.4e-67
672668:672682	attR	TTACGCAGTTGCAGA	NA	NA	NA	NA
WP_134801664.1|672952_673647_-|transposase	IS1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	93.9	1.6e-127
>prophage 5
NC_007606	Shigella dysenteriae Sd197, complete sequence	4369232	679623	741403	4369232	terminase,transposase,tail	Shigella_phage(13.64%)	54	NA	NA
WP_024259448.1|679623_680415_+|terminase	PBSX family phage terminase large subunit	terminase	K4NXU1	Acinetobacter_phage	72.4	1.5e-113
WP_134805572.1|681710_682939_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	98.7	2.5e-176
WP_005020049.1|683391_683625_+	hypothetical protein	NA	A0A077KAW0	Edwardsiella_phage	65.8	6.2e-20
WP_001149702.1|684953_686081_-	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A1X9I6F4	Streptococcus_phage	27.3	1.5e-26
WP_000389260.1|686121_686610_-	YbjO family protein	NA	NA	NA	NA	NA
WP_001061658.1|686670_687516_-	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_000105439.1|687512_688466_-	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_000995999.1|688475_689609_-	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.0	1.1e-29
WP_000126081.1|689703_690816_-	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_005020065.1|691166_691643_-	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_000684321.1|691730_692633_-	30S ribosomal protein S6--L-glutamate ligase	NA	I3ULC9	Synechococcus_phage	34.4	2.6e-37
WP_000189165.1|692693_693416_-	nitroreductase NfsA	NA	NA	NA	NA	NA
WP_001201584.1|693399_693687_-	YbjC family protein	NA	NA	NA	NA	NA
WP_001195231.1|693846_694104_+	glutaredoxin 1	NA	A0A2I7SAE2	Vibrio_phage	63.1	7.8e-24
WP_000681108.1|694133_694511_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001024869.1|694780_696466_+	aspartate:alanine antiporter	NA	NA	NA	NA	NA
WP_000353913.1|696798_697350_+	serine acetyltransferase	NA	NA	NA	NA	NA
WP_005020071.1|697409_697946_-	DNA-binding transcriptional regulator RcdA	NA	NA	NA	NA	NA
WP_000217875.1|698029_699238_+	MFS transporter	NA	NA	NA	NA	NA
WP_001236050.1|700281_701193_-	glutathione ABC transporter permease GsiD	NA	NA	NA	NA	NA
WP_000936043.1|701195_702116_-	glutathione ABC transporter permease GsiC	NA	NA	NA	NA	NA
WP_000090187.1|702133_703672_-	glutathione ABC transporter substrate-binding protein GsiB	NA	NA	NA	NA	NA
WP_024259449.1|703691_705563_-	glutathione ABC transporter ATP-binding protein GsiA	NA	G9BWD6	Planktothrix_phage	30.1	1.0e-16
WP_000513793.1|705549_706515_-	beta-aspartyl-peptidase	NA	NA	NA	NA	NA
WP_000397374.1|706718_707954_+	molybdopterin molybdotransferase MoeA	NA	NA	NA	NA	NA
WP_000829230.1|707953_708703_+	molybdopterin-synthase adenylyltransferase MoeB	NA	NA	NA	NA	NA
WP_011378607.1|708778_709441_-	fructose-6-phosphate aldolase	NA	A0A0E3HJ81	Synechococcus_phage	33.6	1.6e-25
WP_005020080.1|709571_710471_+	glycyl-radical enzyme activating protein	NA	NA	NA	NA	NA
WP_000209337.1|710476_712909_+	glycyl radical protein	NA	A0A076YHZ7	Citrobacter_phage	44.9	1.6e-09
WP_134801557.1|713707_714402_-|transposase	IS1-like element IS1N family transposase	transposase	A0A0U2RK18	Escherichia_phage	95.7	2.6e-130
WP_000359371.1|714682_715228_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000987081.1|715406_715643_+	helix-turn-helix domain-containing protein	NA	A0A2D1GNH1	Pseudomonas_phage	52.1	9.3e-16
WP_171554036.1|716049_717206_-|transposase	IS3-like element IS600 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.7	2.3e-67
WP_000114014.1|717244_717574_+|tail	tail fiber assembly protein	tail	A0A1B0VCD0	Salmonella_phage	58.9	2.6e-24
WP_000930139.1|718913_719540_+	DUF4376 domain-containing protein	NA	A0A0U2QQK4	Escherichia_phage	70.1	1.2e-70
WP_038348398.1|719664_719850_+	Com family DNA-binding transcriptional regulator	NA	A0A0C4UQS3	Shigella_phage	71.0	2.9e-20
WP_000514036.1|719800_720517_+	protein mom	NA	A0A0C4UQZ7	Shigella_phage	94.8	1.2e-127
WP_000144242.1|720884_722144_+	DUF1479 domain-containing protein	NA	NA	NA	NA	NA
WP_000961450.1|722384_723977_-	ABC-F family ATPase	NA	A0A2K9L0W2	Tupanvirus	28.7	1.5e-61
WP_001056384.1|724195_725116_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_000091024.1|726289_726757_-	manganese-binding transcriptional regulator MntR	NA	NA	NA	NA	NA
WP_001001761.1|726942_727071_+	manganase accumulation protein MntS	NA	NA	NA	NA	NA
WP_001054682.1|727342_728926_+	phosphoethanolamine transferase	NA	NA	NA	NA	NA
WP_001295296.1|728974_729490_-	outer membrane protein OmpX	NA	H6WZM8	Escherichia_phage	33.8	1.1e-16
WP_120795379.1|729542_729608_-	protein YliM	NA	NA	NA	NA	NA
WP_000100800.1|731029_731533_+	DNA starvation/stationary phase protection protein Dps	NA	A0A222YYG6	Streptomyces_phage	29.0	4.9e-06
WP_000843879.1|732582_733329_+	glutamine ABC transporter substrate-binding protein GlnH	NA	NA	NA	NA	NA
WP_001159065.1|733467_734127_+	glutamine ABC transporter permease GlnP	NA	NA	NA	NA	NA
WP_000569103.1|734123_734846_+	glutamine ABC transporter ATP-binding protein GlnQ	NA	G9BWD6	Planktothrix_phage	41.8	9.5e-35
WP_134801530.1|736331_737026_-|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
WP_024262959.1|737958_738885_-	23S rRNA (adenine(1618)-N(6))-methyltransferase RlmF	NA	NA	NA	NA	NA
WP_000710621.1|739160_739421_+	DUF1471 domain-containing protein	NA	A0A1B2ICL8	Erwinia_phage	51.0	1.6e-05
WP_001538493.1|739685_740018_+	TonB-dependent receptor plug domain-containing protein	NA	NA	NA	NA	NA
WP_000483776.1|740056_741403_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 6
NC_007606	Shigella dysenteriae Sd197, complete sequence	4369232	749981	818652	4369232	protease,transposase	Escherichia_phage(27.78%)	48	NA	NA
WP_134801557.1|749981_750676_-|transposase	IS1-like element IS1N family transposase	transposase	A0A0U2RK18	Escherichia_phage	95.7	2.6e-130
WP_134801557.1|751301_751995_+|transposase	IS1-like element IS1N family transposase	transposase	A0A0U2RK18	Escherichia_phage	95.7	2.6e-130
WP_000007092.1|752215_753580_-	ATP-dependent RNA helicase RhlE	NA	A0A1V0SBR7	Catovirus	31.8	1.5e-52
WP_001296991.1|753808_754480_+	DNA-binding transcriptional regulator CecR	NA	NA	NA	NA	NA
WP_005020174.1|754482_755478_+	secretion protein HlyD	NA	NA	NA	NA	NA
WP_005020178.1|755470_757207_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	29.3	1.1e-17
WP_000070130.1|757199_758333_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000469022.1|758343_759450_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000871981.1|759411_759822_-	membrane protein	NA	NA	NA	NA	NA
WP_001113366.1|759954_760716_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000650344.1|760712_761945_+	cardiolipin synthase ClsB	NA	NA	NA	NA	NA
WP_134801997.1|763713_764408_-|transposase	IS1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	94.8	2.2e-129
WP_134801998.1|764467_765695_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	98.7	1.1e-176
WP_000852295.1|766001_766454_-	molybdopterin synthase catalytic subunit MoaE	NA	NA	NA	NA	NA
WP_000598610.1|766455_766701_-	molybdopterin synthase sulfur carrier subunit	NA	NA	NA	NA	NA
WP_000080885.1|766693_767179_-	cyclic pyranopterin monophosphate synthase MoaC	NA	NA	NA	NA	NA
WP_000084629.1|767181_767694_-	molybdenum cofactor biosynthesis protein B	NA	NA	NA	NA	NA
WP_001408763.1|767715_768705_-	GTP 3',8-cyclase MoaA	NA	NA	NA	NA	NA
WP_005020190.1|769101_770010_+	uridine diphosphate-N-acetylglucosamine-binding protein YvcK	NA	A1IMD5	Streptococcus_phage	30.7	1.4e-27
WP_000042529.1|770200_772222_-	excinuclease ABC subunit B	NA	NA	NA	NA	NA
WP_000033939.1|772800_773478_-	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_000246789.1|773470_774226_-	malonyl-ACP O-methyltransferase BioC	NA	NA	NA	NA	NA
WP_000118818.1|774212_775367_-	8-amino-7-oxononanoate synthase	NA	NA	NA	NA	NA
WP_000951215.1|775363_776404_-	biotin synthase BioB	NA	NA	NA	NA	NA
WP_000205520.1|776491_777781_+	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	28.6	6.5e-18
WP_000767384.1|777839_778316_+	kinase inhibitor	NA	NA	NA	NA	NA
WP_000801157.1|778895_780659_+	invasion plasmid antigen	NA	NA	NA	NA	NA
WP_171554037.1|780983_782139_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.7	8.9e-67
WP_000261580.1|782151_782379_+	PQQ-dependent sugar dehydrogenase	NA	NA	NA	NA	NA
WP_024262961.1|782375_783002_-	glutathione S-transferase GstB	NA	NA	NA	NA	NA
WP_134802002.1|783237_783932_-|transposase	IS1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	94.4	1.1e-128
WP_011378637.1|784023_785226_+	serine-type D-Ala-D-Ala carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	47.8	3.1e-99
WP_000450127.1|785272_786031_-	DNA-binding transcriptional repressor DeoR	NA	NA	NA	NA	NA
WP_000892317.1|786088_786685_-	undecaprenyl-diphosphate phosphatase	NA	NA	NA	NA	NA
WP_134801779.1|788514_789682_+|transposase	IS3-like element IS911 family transposase	transposase	Q716C2	Shigella_phage	99.7	2.6e-183
WP_000536576.1|795137_799652_+	alpha-2-macroglobulin family protein	NA	NA	NA	NA	NA
WP_001104490.1|799652_801302_+	DUF2300 domain-containing protein	NA	NA	NA	NA	NA
WP_000875993.1|802356_805206_+	two-component system sensor histidine kinase RcsC	NA	A0A1V0SGX0	Hokovirus	27.2	1.4e-41
WP_001061917.1|805405_806056_-	transcriptional regulator RcsB	NA	NA	NA	NA	NA
WP_001249153.1|806072_808745_-	phosphotransferase RcsD	NA	NA	NA	NA	NA
WP_134801664.1|809181_809876_-|transposase	IS1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	93.9	1.6e-127
WP_000865544.1|810257_811385_+	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	57.7	1.0e-115
WP_000406061.1|811496_812552_+	FAD:protein FMN transferase ApbE	NA	NA	NA	NA	NA
WP_000786384.1|812625_813690_+	bifunctional DNA-binding transcriptional regulator/O6-methylguanine-DNA methyltransferase Ada	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	38.5	4.1e-18
WP_000884975.1|813689_814340_+	DNA oxidative demethylase AlkB	NA	A0A2K9L3R7	Tupanvirus	31.7	1.1e-05
WP_000422221.1|814415_816059_+	microcin J25 efflux ABC transporter YojI	NA	W8CYL7	Bacillus_phage	24.0	4.7e-13
WP_000758085.1|816276_817923_+	malate dehydrogenase (quinone)	NA	NA	NA	NA	NA
WP_164924997.1|818298_818652_-|protease	serine protease inhibitor ecotin	protease	NA	NA	NA	NA
>prophage 7
NC_007606	Shigella dysenteriae Sd197, complete sequence	4369232	913329	1113503	4369232	integrase,tRNA,transposase,tail	Escherichia_phage(28.57%)	172	976043:976102	1119708:1119891
WP_134801775.1|913329_914024_-|transposase	IS1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	94.8	1.7e-129
WP_005020309.1|914691_915648_-	response regulator	NA	B5LWN8	Feldmannia_species_virus	22.6	7.7e-08
WP_001264923.1|917511_918540_+	TMAO reductase system periplasmic protein TorT	NA	NA	NA	NA	NA
WP_001120104.1|918512_919205_-	two-component system response regulator TorR	NA	W8CYM9	Bacillus_phage	27.6	1.5e-16
WP_001063160.1|920451_921861_+	molybdopterin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_005020315.1|921841_921994_+	molybdopterin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_000209888.1|922988_923588_+	molecular chaperone TorD	NA	NA	NA	NA	NA
WP_000024562.1|923739_924045_-	chaperone modulator CbpM	NA	NA	NA	NA	NA
WP_000420595.1|924044_924965_-	curved DNA-binding protein	NA	A0A1V0SIM1	Klosneuvirus	43.0	3.2e-11
WP_134802568.1|927375_927561_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001044363.1|927853_929095_+	bifunctional glucose-1-phosphatase/inositol phosphatase	NA	NA	NA	NA	NA
WP_001143120.1|929132_929360_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000170081.1|929380_929977_-	NAD(P)H:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_001273658.1|930349_930523_+	general stress protein	NA	Q9KX95	Enterobacteria_phage	96.3	4.9e-06
WP_024262965.1|930605_931934_-	pyrimidine utilization transport protein G	NA	Q9KX94	Enterobacteria_phage	98.2	3.1e-233
WP_001028095.1|931954_932449_-	pyrimidine utilization flavin reductase protein F	NA	Q9KX93	Enterobacteria_phage	97.9	5.0e-51
WP_001001203.1|932459_933050_-	malonic semialdehyde reductase	NA	NA	NA	NA	NA
WP_001126780.1|933741_934128_-	pyrimidine utilization protein C	NA	NA	NA	NA	NA
WP_024262966.1|934831_935923_-	pyrimidine utilization protein A	NA	NA	NA	NA	NA
WP_005020332.1|936211_936850_+	HTH-type transcriptional regulator RutR	NA	NA	NA	NA	NA
WP_000979516.1|940906_941116_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001018473.1|941274_942783_+	sodium/proline symporter PutP	NA	NA	NA	NA	NA
WP_000833289.1|946489_946879_+	curli production assembly/transport protein CsgE	NA	NA	NA	NA	NA
WP_001264087.1|946903_947320_+	curli production assembly/transport protein CsgF	NA	NA	NA	NA	NA
WP_001189330.1|947346_948180_+	curli production assembly/transport protein CsgG	NA	M1ICK2	Pelagibacter_phage	40.1	1.3e-38
WP_164925000.1|948271_948965_+|transposase	IS1-like element IS1N family transposase	transposase	A0A0U2RK18	Escherichia_phage	95.2	1.3e-129
WP_001300785.1|949017_949509_-	DUF1097 domain-containing protein	NA	NA	NA	NA	NA
WP_001001927.1|949610_950165_-	molecular chaperone YcdY	NA	NA	NA	NA	NA
WP_000283663.1|950188_950926_-	zinc-binding phosphatase	NA	NA	NA	NA	NA
WP_000351336.1|950980_951919_-	glyoxylate/hydroxypyruvate reductase GhrA	NA	NA	NA	NA	NA
WP_005020348.1|952389_953232_-	DUF4942 domain-containing protein	NA	NA	NA	NA	NA
WP_011378633.1|953328_953526_-	DUF957 domain-containing protein	NA	NA	NA	NA	NA
WP_000976859.1|953537_954029_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001094433.1|954025_954400_-	toxin	NA	NA	NA	NA	NA
WP_001285603.1|954446_954824_-	type IV toxin-antitoxin system YeeU family antitoxin	NA	NA	NA	NA	NA
WP_000086764.1|954873_955518_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000692331.1|955536_955758_-	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.9e-10
WP_001186198.1|955826_956279_-	RadC family protein	NA	NA	NA	NA	NA
WP_001313575.1|956294_956768_-	antirestriction protein	NA	A9J566	Pseudomonas_phage	31.2	4.3e-12
WP_001234573.1|957047_957869_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	37.8	3.4e-44
WP_000088742.1|957969_958143_-	DUF905 family protein	NA	NA	NA	NA	NA
WP_000668907.1|959176_959644_-	hypothetical protein	NA	NA	NA	NA	NA
WP_078164616.1|959776_960040_-	phospholipase	NA	NA	NA	NA	NA
WP_165442258.1|961256_962485_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.0	6.5e-177
WP_134802123.1|963196_963891_-|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
WP_011378642.1|963984_966162_+	siderophore salmochelin receptor IroN	NA	NA	NA	NA	NA
WP_000271275.1|966206_967163_-	catecholate siderophore esterase IroE	NA	NA	NA	NA	NA
WP_000933674.1|967247_968477_-	catecholate siderophore esterase IroD	NA	NA	NA	NA	NA
WP_011378643.1|968580_972240_-	salmochelin/enterobactin export ABC transporter IroC	NA	W8CYL7	Bacillus_phage	29.2	2.7e-45
WP_005020367.1|972379_973495_-	salmochelin biosynthesis C-glycosyltransferase IroB	NA	NA	NA	NA	NA
976043:976102	attL	GGTGATGCTTCCAATTAGTAGAACATGTGTTTTTCAATAAACGTCCCGATGACTTTTTCG	NA	NA	NA	NA
WP_134801557.1|976056_976751_-|transposase	IS1-like element IS1N family transposase	transposase	A0A0U2RK18	Escherichia_phage	95.7	2.6e-130
976043:976102	attL	GGTGATGCTTCCAATTAGTAGAACATGTGTTTTTCAATAAACGTCCCGATGACTTTTTCG	NA	NA	NA	NA
WP_001007762.1|977102_977753_-	metal-binding protein ZinT	NA	NA	NA	NA	NA
WP_001240091.1|978009_978645_-	protein-methionine-sulfoxide reductase heme-binding subunit MsrQ	NA	NA	NA	NA	NA
WP_000740056.1|978645_979650_-	protein-methionine-sulfoxide reductase catalytic subunit MsrP	NA	NA	NA	NA	NA
WP_134801777.1|979875_980570_-|transposase	IS1-like element IS1N family transposase	transposase	A0A0U2RK18	Escherichia_phage	95.2	7.5e-130
WP_005020386.1|981068_981719_+	response regulator transcription factor HprR	NA	W8CYM9	Bacillus_phage	34.3	1.6e-28
WP_134801567.1|981693_982388_-|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
WP_078164536.1|982528_982894_+	permease	NA	NA	NA	NA	NA
WP_001157258.1|983684_985103_+	DNA-cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	55.5	1.8e-101
WP_000785996.1|985083_985554_+	VSPR family DNA mismatch endonuclease	NA	E5E3X5	Burkholderia_phage	47.6	4.4e-33
WP_001212213.1|985542_986463_-	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
WP_000922683.1|986635_987553_+	DUF808 domain-containing protein	NA	NA	NA	NA	NA
WP_000009307.1|987631_987814_+	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
WP_000431441.1|988002_989679_+	cellulose biosynthesis regulator YedQ	NA	A0A127AWB9	Bacillus_phage	35.6	1.3e-18
WP_000491523.1|989675_990491_-	mannosyl-3-phosphoglycerate phosphatase-related protein	NA	NA	NA	NA	NA
WP_000844800.1|990788_991016_-	peroxide/acid resistance protein YodD	NA	NA	NA	NA	NA
WP_000867217.1|991164_991353_+	protein DsrB	NA	NA	NA	NA	NA
WP_134801557.1|991692_992386_+|transposase	IS1-like element IS1N family transposase	transposase	A0A0U2RK18	Escherichia_phage	95.7	2.6e-130
WP_134801577.1|993492_994187_-|transposase	IS1-like element IS1N family transposase	transposase	NA	NA	NA	NA
WP_023600695.1|994263_994641_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011378644.1|994555_995281_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	60.4	1.2e-77
WP_000239883.1|996100_996769_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_134801557.1|997132_997826_+|transposase	IS1-like element IS1N family transposase	transposase	A0A0U2RK18	Escherichia_phage	95.7	2.6e-130
WP_000114005.1|1000590_1000767_+	hypothetical protein	NA	NA	NA	NA	NA
997782:998547	attR	CGAAAAAGTCATCGGGACGTTTATTGAAAAACACATGTTCTACTAATTGGAAGCATCACCCCTTCTGCGAGGTTATTATGCTTCCTGTAAATAATCCCCCCCTATCCACTGGAAACGTCTCTTTTTACAGAACTACATCAATCGACAATGTTCACAATAATTATCTCTCCGAATGGGTTGAATGGACTAAAAACAGCATTTCCGGAGAAAACAGGGAAACTGCTTTTACCCGGCTCCAATTATGTCTGGAGAACAGTGAAACATCGTTGGACTTATCTTGTTTAGGTCTCAGATCTCTACCACGATTGCCTGACAATCTTGATGAAATTAATGTAAGCAATAACCAACTATCAATGCTCCCCGAGCTACCAAGGGCATTGAAAGAGCTGAATGCAAGCAGTAATTATCTGCACTTCCTGAATTACCAGTGTCGCTGGAATATATAAATGTGAGTGATAACCATTTGTTCGCACTCCCTGAATTACCTGCGTCACTAGAATATATTAATGTAAGTGACAATCACCTGTCTGTACTTCCGAGGTTACCAATGTCATTGGAATTACTTGATGCAGCCAGAAATGCTTTGGAAGTAATACCAGATTTTCCAGAAAGAGATGATCATATTATAAGAATATTCTGGCTTAATCAGAACCGGATCACGGCAATTCCGGAAAGCATACTTGGCCTCAGTTCTGATAGCGTTGTCAATCTTAGAGAAAATCAACTATCTCCCAGAATAATGCAAACTTTGTTACAACAAACCGCC	NA	NA	NA	NA
WP_001039884.1|1000767_1000947_-	hypothetical protein	NA	NA	NA	NA	NA
997782:998547	attR	CGAAAAAGTCATCGGGACGTTTATTGAAAAACACATGTTCTACTAATTGGAAGCATCACCCCTTCTGCGAGGTTATTATGCTTCCTGTAAATAATCCCCCCCTATCCACTGGAAACGTCTCTTTTTACAGAACTACATCAATCGACAATGTTCACAATAATTATCTCTCCGAATGGGTTGAATGGACTAAAAACAGCATTTCCGGAGAAAACAGGGAAACTGCTTTTACCCGGCTCCAATTATGTCTGGAGAACAGTGAAACATCGTTGGACTTATCTTGTTTAGGTCTCAGATCTCTACCACGATTGCCTGACAATCTTGATGAAATTAATGTAAGCAATAACCAACTATCAATGCTCCCCGAGCTACCAAGGGCATTGAAAGAGCTGAATGCAAGCAGTAATTATCTGCACTTCCTGAATTACCAGTGTCGCTGGAATATATAAATGTGAGTGATAACCATTTGTTCGCACTCCCTGAATTACCTGCGTCACTAGAATATATTAATGTAAGTGACAATCACCTGTCTGTACTTCCGAGGTTACCAATGTCATTGGAATTACTTGATGCAGCCAGAAATGCTTTGGAAGTAATACCAGATTTTCCAGAAAGAGATGATCATATTATAAGAATATTCTGGCTTAATCAGAACCGGATCACGGCAATTCCGGAAAGCATACTTGGCCTCAGTTCTGATAGCGTTGTCAATCTTAGAGAAAATCAACTATCTCCCAGAATAATGCAAACTTTGTTACAACAAACCGCC	NA	NA	NA	NA
WP_000902887.1|1002152_1002698_-|tail	tail fiber assembly protein	tail	Q8W612	Enterobacteria_phage	71.4	3.4e-69
WP_000111993.1|1002700_1002814_-|tail	tail protein	tail	A0A0C4UQV0	Shigella_phage	85.7	1.3e-07
WP_171554038.1|1002852_1004008_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.4	6.8e-67
WP_134801557.1|1004264_1004959_-|transposase	IS1-like element IS1N family transposase	transposase	A0A0U2RK18	Escherichia_phage	95.7	2.6e-130
WP_005023745.1|1005314_1006112_+	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_165442258.1|1008821_1010050_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.0	6.5e-177
WP_005023733.1|1010434_1011220_-	hypothetical protein	NA	R9TNM7	Vibrio_phage	29.1	1.5e-22
WP_134801736.1|1011243_1011938_-|transposase	IS1-like element IS1N family transposase	transposase	A0A0U2RK18	Escherichia_phage	95.2	9.8e-130
WP_087786203.1|1012082_1012777_-|transposase	IS1-like element IS1N family transposase	transposase	A0A0U2RK18	Escherichia_phage	95.2	4.4e-130
WP_000334642.1|1012901_1013573_-	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	59.9	1.8e-80
WP_000790504.1|1013681_1013915_-	sulfurtransferase-like selenium metabolism protein YedF	NA	NA	NA	NA	NA
WP_000118917.1|1013911_1015117_-	selenium metabolism membrane protein YedE/FdhT	NA	NA	NA	NA	NA
WP_001295642.1|1015303_1015717_+	lipoprotein	NA	NA	NA	NA	NA
WP_001245709.1|1015750_1017238_-	alpha-amylase	NA	NA	NA	NA	NA
WP_000270670.1|1017680_1018091_-	flagellar export chaperone FliS	NA	NA	NA	NA	NA
WP_000146756.1|1018115_1019513_-	flagellar filament capping protein FliD	NA	NA	NA	NA	NA
WP_001087458.1|1022537_1023257_+	RNA polymerase sigma factor FliA	NA	NA	NA	NA	NA
WP_001362553.1|1023302_1023854_+	flagella biosynthesis regulatory protein FliZ	NA	NA	NA	NA	NA
WP_011378649.1|1023941_1024742_+	cystine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001128217.1|1024846_1025833_+	D-cysteine desulfhydrase	NA	NA	NA	NA	NA
WP_001158223.1|1025847_1026516_+	cystine ABC transporter permease	NA	NA	NA	NA	NA
WP_001272979.1|1026512_1027265_+	L-cystine ABC transporter ATP-binding protein YecC	NA	G9BWD6	Planktothrix_phage	40.1	3.0e-31
WP_134801557.1|1028107_1028801_+|transposase	IS1-like element IS1N family transposase	transposase	A0A0U2RK18	Escherichia_phage	95.7	2.6e-130
WP_000106474.1|1029058_1029283_-	DUF2594 family protein	NA	NA	NA	NA	NA
WP_000590344.1|1029269_1029446_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000611328.1|1029741_1030398_+	UvrY/SirA/GacA family response regulator transcription factor	NA	NA	NA	NA	NA
WP_001160187.1|1032285_1032834_+	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_000847882.1|1033483_1034149_+	UPF0149 family protein YecA	NA	NA	NA	NA	NA
WP_000797563.1|1034210_1035422_-	tyrosine transporter TyrP	NA	NA	NA	NA	NA
WP_000377227.1|1035613_1035853_+	YecH family protein	NA	NA	NA	NA	NA
WP_000917208.1|1035890_1036388_-	non-heme ferritin	NA	NA	NA	NA	NA
WP_001237866.1|1036558_1036882_-	hypothetical protein	NA	NA	NA	NA	NA
WP_134801571.1|1037092_1037787_-|transposase	IS1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	94.8	2.9e-129
WP_000179469.1|1038289_1038793_+	non-heme ferritin-like protein	NA	NA	NA	NA	NA
WP_000082127.1|1038871_1039123_-	DUF2766 domain-containing protein	NA	NA	NA	NA	NA
WP_010723106.1|1039237_1039324_-	stress response protein AzuC	NA	NA	NA	NA	NA
WP_000548680.1|1040221_1041211_+	arabinose ABC transporter substrate-binding protein AraF	NA	NA	NA	NA	NA
WP_001187828.1|1041280_1042795_+	arabinose ABC transporter ATP binding protein AraG	NA	A0A2H4PQG7	Staphylococcus_phage	27.1	4.3e-13
WP_000100195.1|1042809_1043796_+	arabinose ABC transporter permease AraH	NA	NA	NA	NA	NA
WP_171554039.1|1044339_1045495_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.7	1.4e-67
WP_001212335.1|1045559_1045982_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	49.6	5.4e-30
WP_000976472.1|1046364_1046706_-	YebY family protein	NA	NA	NA	NA	NA
WP_000168738.1|1047595_1047970_-	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_000916763.1|1048108_1048339_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	61.8	1.3e-14
WP_000896381.1|1048440_1049097_+	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
WP_000944256.1|1049120_1049783_+	exodeoxyribonuclease X	NA	Q6UAU3	Klebsiella_phage	41.6	2.0e-07
WP_001134771.1|1049779_1051840_-	oligopeptidase B	NA	NA	NA	NA	NA
WP_000024746.1|1052048_1052708_-	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
WP_005023611.1|1053031_1053388_-	protein YebF	NA	NA	NA	NA	NA
WP_000257738.1|1053454_1053745_-	DNA damage-inducible protein YebG	NA	NA	NA	NA	NA
WP_000173490.1|1053878_1055057_+	formate-dependent phosphoribosylglycinamide formyltransferase	NA	NA	NA	NA	NA
WP_000800516.1|1055112_1055754_-	bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase	NA	NA	NA	NA	NA
WP_001069439.1|1055790_1057602_-	phosphogluconate dehydratase	NA	NA	NA	NA	NA
WP_000301727.1|1057836_1059312_-	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	37.5	4.4e-79
WP_000091154.1|1060645_1062088_+	pyruvate kinase	NA	NA	NA	NA	NA
WP_000448373.1|1062218_1063190_-	lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase	NA	NA	NA	NA	NA
WP_001184039.1|1063309_1064632_-	murein DD-endopeptidase MepM	NA	A8ATH6	Listeria_phage	40.9	1.2e-14
WP_005023617.1|1064647_1065580_-	zinc ABC transporter substrate-binding protein ZnuA	NA	NA	NA	NA	NA
WP_000202986.1|1065658_1066414_+	zinc ABC transporter ATP-binding protein ZnuC	NA	G3M9Y6	Bacillus_virus	28.3	1.7e-18
WP_000571488.1|1066410_1067196_+	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
WP_000568519.1|1067342_1068353_-	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	25.5	5.6e-09
WP_000580325.1|1068361_1068973_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_010723105.1|1069111_1069177_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001024959.1|1069247_1069850_+	YebB family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_001295503.1|1069851_1070373_-	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	2.0e-10
WP_000907249.1|1070407_1071148_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_001300367.1|1071176_1071629_-	dihydroneopterin triphosphate diphosphatase	NA	NA	NA	NA	NA
WP_001258651.1|1071746_1073519_-|tRNA	aspartate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_000891605.1|1073828_1074083_+	isochorismatase family protein	NA	NA	NA	NA	NA
WP_011378654.1|1074274_1075471_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_165442258.1|1079902_1081131_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.0	6.5e-177
WP_000245719.1|1081612_1081819_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001204616.1|1082589_1083207_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000599619.1|1083310_1083658_+	DUF72 domain-containing protein	NA	NA	NA	NA	NA
WP_000252980.1|1083710_1084106_+	MAPEG family protein	NA	NA	NA	NA	NA
WP_000019588.1|1084146_1084890_+	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.0	4.6e-24
WP_000564728.1|1084886_1085858_+|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
WP_000176816.1|1086022_1088365_-	trimethylamine N-oxide reductase TorZ	NA	NA	NA	NA	NA
WP_087786203.1|1090043_1090738_-|transposase	IS1-like element IS1N family transposase	transposase	A0A0U2RK18	Escherichia_phage	95.2	4.4e-130
WP_134801520.1|1091344_1092039_-|transposase	IS1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	94.8	1.7e-129
WP_001185749.1|1092198_1092945_-	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_005023645.1|1092958_1093525_-	VOC family protein	NA	NA	NA	NA	NA
WP_001025331.1|1093740_1095474_+|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.3	1.3e-85
WP_001259578.1|1097037_1097430_-	flagellar protein FlhE	NA	NA	NA	NA	NA
WP_087786203.1|1099044_1099739_-|transposase	IS1-like element IS1N family transposase	transposase	A0A0U2RK18	Escherichia_phage	95.2	4.4e-130
WP_171554040.1|1099852_1101008_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.7	3.4e-66
WP_000906323.1|1101936_1102824_-	flagellar motor stator protein MotA	NA	NA	NA	NA	NA
WP_001291610.1|1102949_1103495_-	flagellar transcriptional regulator FlhC	NA	NA	NA	NA	NA
WP_001295647.1|1103497_1103848_-	flagellar transcriptional regulator FlhD	NA	NA	NA	NA	NA
WP_000122432.1|1104627_1105056_+	universal stress protein UspC	NA	NA	NA	NA	NA
WP_001295646.1|1105062_1106487_-	alpha,alpha-trehalose-phosphate synthase	NA	NA	NA	NA	NA
WP_164925003.1|1107027_1108196_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	99.3	2.9e-182
WP_078164586.1|1110294_1110576_-	excisionase	NA	A0A2H4J5E1	uncultured_Caudovirales_phage	42.4	9.8e-12
WP_134802562.1|1110727_1111421_+|transposase	IS1-like element IS1N family transposase	transposase	A0A0U2RK18	Escherichia_phage	95.2	1.7e-129
WP_023637031.1|1111613_1111799_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001131442.1|1111759_1111879_+	hypothetical protein	NA	NA	NA	NA	NA
WP_134801557.1|1112808_1113503_-|transposase	IS1-like element IS1N family transposase	transposase	A0A0U2RK18	Escherichia_phage	95.7	2.6e-130
1119708:1119891	attR	CGAAAAAGTCATCGGGACGTTTATTGAAAAACACATGTTCTACTAATTGGAAGCATCACCGGCGTGCGGCGTTGTTTGCGACCCGTATATTTGTGTGAACTCAGATGGCATTTCCCCAGAGTTAACAAGGAAATATCTCGGCGAAAAAGCCGCTGAAAACTTACAATCATTACAAGGCTACGAT	NA	NA	NA	NA
>prophage 8
NC_007606	Shigella dysenteriae Sd197, complete sequence	4369232	1118831	1176522	4369232	tRNA,transposase	Escherichia_phage(38.46%)	47	NA	NA
WP_134801520.1|1118831_1119526_-|transposase	IS1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	94.8	1.7e-129
WP_000388335.1|1119753_1120038_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000693755.1|1120157_1120559_-	pre-peptidase C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_024259536.1|1120798_1121092_+	YcgL domain-containing protein	NA	NA	NA	NA	NA
WP_000284286.1|1121163_1121823_+	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_032151304.1|1121899_1122361_+	YcgN family cysteine cluster protein	NA	NA	NA	NA	NA
WP_087786203.1|1123371_1124065_+|transposase	IS1-like element IS1N family transposase	transposase	A0A0U2RK18	Escherichia_phage	95.2	4.4e-130
WP_134801758.1|1124222_1124916_+|transposase	IS1-like element IS1N family transposase	transposase	A0A0U2RK18	Escherichia_phage	95.2	9.8e-130
WP_000897370.1|1125535_1125955_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	62.9	3.1e-38
WP_000457640.1|1125954_1127214_+	DNA polymerase V catalytic protein	NA	I6RSM4	Salmonella_phage	82.7	1.2e-205
WP_000943459.1|1127259_1127790_-	disulfide bond formation protein DsbB	NA	NA	NA	NA	NA
WP_000406391.1|1127935_1129477_-	Na(+)/H(+) antiporter NhaB	NA	NA	NA	NA	NA
WP_000234823.1|1129698_1130418_+	fatty acid metabolism transcriptional regulator FadR	NA	NA	NA	NA	NA
WP_000190868.1|1130469_1132002_-	SpoVR family protein	NA	NA	NA	NA	NA
WP_001266921.1|1132331_1133630_+	D-amino acid dehydrogenase	NA	NA	NA	NA	NA
WP_005023590.1|1136679_1136841_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000340211.1|1136961_1138698_-	potassium/proton antiporter	NA	NA	NA	NA	NA
WP_000051550.1|1138792_1139707_-	muramoyltetrapeptide carboxypeptidase	NA	NA	NA	NA	NA
WP_001310262.1|1139806_1140418_+	membrane-bound lytic murein transglycosylase EmtA	NA	NA	NA	NA	NA
WP_000020123.1|1140419_1141154_-	flagellar brake protein	NA	NA	NA	NA	NA
WP_000511315.1|1141354_1141609_+	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_011378673.1|1141658_1143629_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_000576838.1|1143654_1144509_-	ModD protein	NA	NA	NA	NA	NA
WP_134801557.1|1145009_1145703_+|transposase	IS1-like element IS1N family transposase	transposase	A0A0U2RK18	Escherichia_phage	95.7	2.6e-130
WP_000173325.1|1146101_1146860_-	ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	30.3	8.8e-15
WP_001223661.1|1146856_1147837_-	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_000841751.1|1149965_1151663_-	alpha,alpha-trehalase	NA	NA	NA	NA	NA
WP_164925005.1|1157843_1158538_-|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
WP_000505866.1|1158811_1159903_-	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_000152942.1|1160019_1160604_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_000823887.1|1160881_1161160_+	stress-induced protein YchH	NA	NA	NA	NA	NA
WP_001033352.1|1161214_1162894_-	C4-dicarboxylic acid transporter DauA	NA	A0A2H4J153	uncultured_Caudovirales_phage	23.6	1.3e-23
WP_001298109.1|1163018_1163966_-	ribose-phosphate diphosphokinase	NA	A0A2K9L2G2	Tupanvirus	37.8	3.9e-44
WP_001260351.1|1164116_1164968_-	4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase	NA	NA	NA	NA	NA
WP_001130688.1|1164967_1165591_-	lipoprotein localization protein LolB	NA	NA	NA	NA	NA
WP_005023559.1|1165804_1167061_+|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_000804726.1|1167102_1168185_+	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	41.6	1.5e-07
WP_000456449.1|1168184_1169018_+	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_000200378.1|1169014_1169407_+	SirB family protein	NA	NA	NA	NA	NA
WP_001257060.1|1169410_1170220_+	tetratricopeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_000811065.1|1170255_1171110_+	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	39.0	8.3e-46
WP_094110601.1|1171257_1171365_-	type I toxin-antitoxin system toxin Ldr family protein	NA	NA	NA	NA	NA
WP_005023555.1|1171769_1172870_-	sodium-potassium/proton antiporter ChaA	NA	NA	NA	NA	NA
WP_001146444.1|1173916_1174147_+	putative cation transport regulator ChaB	NA	A5IZT6	Spodoptera_litura_granulovirus	40.0	8.5e-06
WP_000632705.1|1174304_1174940_+	glutathione-specific gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
WP_001169669.1|1175043_1175397_-	DsrE/F sulfur relay family protein YchN	NA	NA	NA	NA	NA
WP_134801664.1|1175828_1176522_+|transposase	IS1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	93.9	1.6e-127
>prophage 9
NC_007606	Shigella dysenteriae Sd197, complete sequence	4369232	1195954	1336532	4369232	tRNA,protease,transposase,integrase,holin	Escherichia_phage(39.62%)	113	1266230:1266289	1298283:1299050
WP_134801753.1|1195954_1196649_-|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
WP_000301651.1|1199205_1201881_-	bifunctional acetaldehyde-CoA/alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_134801584.1|1202288_1202982_+|transposase	IS1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	94.8	2.9e-129
WP_134801557.1|1204065_1204760_-|transposase	IS1-like element IS1N family transposase	transposase	A0A0U2RK18	Escherichia_phage	95.7	2.6e-130
WP_005023475.1|1205559_1207191_+	oligopeptide ABC transporter substrate-binding protein OppA	NA	NA	NA	NA	NA
WP_000911088.1|1207276_1208197_+	oligopeptide ABC transporter permease OppB	NA	NA	NA	NA	NA
WP_000979659.1|1208211_1209120_+	oligopeptide ABC transporter permease OppC	NA	NA	NA	NA	NA
WP_000538199.1|1209131_1210145_+	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppD	NA	G9BWD6	Planktothrix_phage	31.7	2.0e-14
WP_000994907.1|1210141_1211146_+	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppF	NA	G9BWD6	Planktothrix_phage	35.6	8.0e-24
WP_000366959.1|1211198_1211528_-	YciU family protein	NA	NA	NA	NA	NA
WP_000214509.1|1211562_1213023_-	cardiolipin synthase	NA	NA	NA	NA	NA
WP_001309467.1|1213165_1213339_+	YciY family protein	NA	NA	NA	NA	NA
WP_011378679.1|1213392_1214646_-	voltage-gated potassium channel protein	NA	NA	NA	NA	NA
WP_000967602.1|1214945_1215242_-	YciI family protein	NA	NA	NA	NA	NA
WP_000072663.1|1215593_1216259_+	hypothetical protein	NA	NA	NA	NA	NA
WP_134801749.1|1216726_1217927_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	97.6	4.1e-168
WP_000447713.1|1218132_1218684_+	recombinase family protein	NA	G8I4U3	Mycobacterium_phage	39.0	4.7e-26
WP_000171277.1|1220190_1220910_+	TonB system transport protein TonB	NA	NA	NA	NA	NA
WP_000108160.1|1220949_1221348_-	acyl-CoA thioester hydrolase YciA	NA	NA	NA	NA	NA
WP_000808678.1|1221452_1221992_-	septation protein A	NA	NA	NA	NA	NA
WP_000028547.1|1222021_1222765_-	UPF0259 family protein	NA	NA	NA	NA	NA
WP_000737234.1|1223121_1223760_+	outer membrane protein OmpW	NA	NA	NA	NA	NA
WP_051394736.1|1223819_1224278_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_131139925.1|1225495_1226141_+|transposase	IS1-like element IS1N family transposase	transposase	A0A0U2RK18	Escherichia_phage	95.3	1.3e-120
WP_094096554.1|1226203_1227359_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.7	1.4e-67
WP_000443088.1|1227672_1228479_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_000209513.1|1228478_1229672_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_000983874.1|1229683_1231045_-	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.7	3.0e-37
WP_000763549.1|1231045_1232641_-	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	3.8e-52
WP_001194571.1|1232640_1234203_-	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_001700591.1|1234294_1234339_-	trp operon leader peptide	NA	NA	NA	NA	NA
WP_001285665.1|1234476_1235358_+	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_005023354.1|1235354_1235975_+	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_001110815.1|1236765_1237191_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001291204.1|1237403_1238276_+	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_001278902.1|1238315_1238906_-	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_000559269.1|1238902_1239661_-	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.9	6.7e-07
WP_000422072.1|1239880_1240921_+|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
WP_001031530.1|1240956_1241208_-	YciN family protein	NA	NA	NA	NA	NA
WP_011378684.1|1241587_1244185_+	type I DNA topoisomerase	NA	A0A2K9L1Q2	Tupanvirus	34.5	7.0e-88
WP_000776240.1|1244394_1245369_+	HTH-type transcriptional regulator CysB	NA	NA	NA	NA	NA
WP_000908596.1|1246439_1246604_+	YmiA family putative membrane protein	NA	NA	NA	NA	NA
WP_000233043.1|1246606_1246774_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001310756.1|1246887_1246983_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001176302.1|1251154_1251745_-	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	48.7	2.3e-42
WP_001256538.1|1251914_1252679_+	phosphatidylglycerophosphatase B	NA	NA	NA	NA	NA
WP_000876292.1|1252827_1253136_+	lipopolysaccharide assembly protein LapA	NA	NA	NA	NA	NA
WP_000891360.1|1253142_1254312_+	lipopolysaccharide assembly protein LapB	NA	NA	NA	NA	NA
WP_000176280.1|1254504_1255242_+	orotidine-5'-phosphate decarboxylase	NA	NA	NA	NA	NA
WP_005023299.1|1255241_1255568_+	stress response translation initiation inhibitor YciH	NA	NA	NA	NA	NA
WP_001088621.1|1256728_1257478_-	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_001288368.1|1257567_1257741_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000484963.1|1260886_1262821_-	exoribonuclease II	NA	Q0GXV6	Lactococcus_phage	27.9	4.1e-32
WP_000506494.1|1264140_1264929_-	enoyl-ACP reductase FabI	NA	NA	NA	NA	NA
WP_134801557.1|1265365_1266060_-|transposase	IS1-like element IS1N family transposase	transposase	A0A0U2RK18	Escherichia_phage	95.7	2.6e-130
1266230:1266289	attL	TTGGTGATGCTTCCAATTAGTAGAACATGTGTTTTTCAATAAACGTCCCGATGACTTTTT	NA	NA	NA	NA
WP_087786203.1|1266245_1266940_-|transposase	IS1-like element IS1N family transposase	transposase	A0A0U2RK18	Escherichia_phage	95.2	4.4e-130
WP_000492802.1|1267289_1270391_+	multidrug efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_000135021.1|1271782_1272934_+	multidrug effflux MFS transporter	NA	S4TR35	Salmonella_phage	26.1	6.8e-27
WP_005023257.1|1272982_1274179_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_000573413.1|1274437_1275244_-	peptide ABC transporter ATP-binding protein SapF	NA	G3M9Y6	Bacillus_virus	28.6	7.2e-15
WP_001128862.1|1275245_1276238_-	peptide ABC transporter ATP-binding protein SapD	NA	NA	NA	NA	NA
WP_001146142.1|1276237_1277128_-	peptide ABC transporter permease SapC	NA	NA	NA	NA	NA
WP_005023250.1|1277262_1278492_+|integrase	site-specific integrase	integrase	K7PGY1	Enterobacteria_phage	51.4	1.8e-118
WP_000497818.1|1279526_1279778_-	DUF4222 domain-containing protein	NA	G9L6F5	Escherichia_phage	91.6	2.3e-36
WP_000186873.1|1279826_1280507_-	YqaJ viral recombinase family protein	NA	A0A0P0ZBV6	Stx2-converting_phage	98.2	1.1e-130
WP_000100825.1|1280503_1281289_-	phage recombination protein Bet	NA	A0A088CBI3	Shigella_phage	96.6	5.1e-143
WP_000995032.1|1281294_1281591_-	host-nuclease inhibitor protein Gam	NA	V5URU8	Shigella_phage	93.9	5.8e-47
WP_054518486.1|1281587_1281986_-	hypothetical protein	NA	A0A088CD28	Shigella_phage	66.7	2.8e-44
WP_000691354.1|1283864_1284812_+	Shiga toxin Stx1 subunit A	NA	Q777W4	Enterobacteria_phage	100.0	3.2e-171
WP_000752026.1|1284821_1285091_+	Shiga toxin Stx1a subunit B	NA	Q7AYI7	Enterobacteria_phage	100.0	1.6e-43
WP_000874472.1|1285600_1287511_+	SASA family carbohydrate esterase	NA	A0A0N7CGH9	Escherichia_phage	75.0	2.2e-280
WP_023600905.1|1287651_1287834_+	DUF1378 family protein	NA	S5MBZ5	Escherichia_phage	90.0	1.0e-22
WP_162147602.1|1287757_1288105_+	DUF826 domain-containing protein	NA	A0A0N7C077	Escherichia_phage	83.2	8.1e-24
WP_000284488.1|1288181_1288397_+|holin	class II holin family protein	holin	G9L6J5	Escherichia_phage	97.2	1.0e-32
WP_000087463.1|1288401_1288935_+	lysozyme	NA	A0A088CC28	Shigella_phage	91.0	1.3e-92
WP_000825812.1|1291369_1292767_+	YcjX family protein	NA	NA	NA	NA	NA
WP_000138724.1|1292763_1293798_+	TIGR01620 family protein	NA	NA	NA	NA	NA
WP_001295587.1|1293972_1295514_+	transcriptional regulator TyrR	NA	NA	NA	NA	NA
WP_000084387.1|1295557_1296064_-	thiol peroxidase	NA	NA	NA	NA	NA
WP_005023164.1|1296182_1297148_+	L-Ala-D/L-Glu epimerase	NA	NA	NA	NA	NA
WP_024262975.1|1297122_1297851_-	murein tripeptide amidase MpaA	NA	NA	NA	NA	NA
WP_087786203.1|1298298_1298993_-|transposase	IS1-like element IS1N family transposase	transposase	A0A0U2RK18	Escherichia_phage	95.2	4.4e-130
WP_087786203.1|1299404_1300098_+|transposase	IS1-like element IS1N family transposase	transposase	A0A0U2RK18	Escherichia_phage	95.2	4.4e-130
1298283:1299050	attR	TTGGTGATGCTTCCAATTAGTAGAACATGTGTTTTTCAATAAACGTCCCGATGACTTTTTCGTGGATCTCTACTGAACGCGAGAAGCAGATTGTTTTACGAGCCAAGCGCTTAATGCGGGTGCGCAGCGTCAGGTTATTGCGCTCAATCCGTTGGGTGAATATTTTTCCGGTCAGATGCTTATCCTTCGGCACCTCCCGGCCATAGCTGCCCCAGTCGTCGCTGGTGATCATGCCGATGTTGAATGGCGTAAGCAGTGCCAGTAGTTCCCGGCAGGTTTCATCGGTACGGGGACCAAAAGTGTAGGCCAGTACCCCCCCTGTTTTGGTGTTATACGCGTACCAGAGCCAGTGTTGCCGGGCTTTACTGCCAACGAAACTCCATTGCTCATCAAGTTCGCAGATAAGCGCCACATCAGCATGAGCAACGGGCGAAGACGTTATTCGCTTTGGCGTGAGTTTTTTAAAGTCCGGATGACGGTGTTAATGCCAATTTTCAGTGTCCTGGCGGTATCGCGAACCCCGGCGCCATTGAAGGCCATTTCAGTGATCAGCTCTTTAATGCCCGGCTTACGGGCCTCATAAGTGTAAGTGAGCTGAAAAACGCGGTGGCAGTCACGGCAGCGAAATCTGTCATGGCCTTTAGGGTTCTGACCATGGCGGTAGACCTGTGCAGACTGACAACGAGGACAATGAATGTTAACGCTGGCCATGAAAGAACCTCAAAAGCCCGCATTATACATCAGATTCAACTAATTAGAGGCATCACC	NA	NA	NA	NA
WP_000817681.1|1300228_1301128_+	DNA-binding transcriptional regulator PgrR	NA	NA	NA	NA	NA
WP_000683023.1|1301464_1303078_+	murein tripeptide ABC transporter substrate-binding protein MppA	NA	NA	NA	NA	NA
WP_000559905.1|1303128_1304160_-	low conductance mechanosensitive channel YnaI	NA	NA	NA	NA	NA
WP_001252110.1|1305487_1306438_-	universal stress protein UspE	NA	NA	NA	NA	NA
WP_134801577.1|1306531_1307226_-|transposase	IS1-like element IS1N family transposase	transposase	NA	NA	NA	NA
WP_000611904.1|1307363_1308116_-	fumarate/nitrate reduction transcriptional regulator Fnr	NA	NA	NA	NA	NA
WP_000945008.1|1308310_1308826_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	42.1	2.0e-23
WP_134801743.1|1309445_1310139_+|transposase	IS1-like element IS1N family transposase	transposase	A0A0U2RK18	Escherichia_phage	95.2	9.8e-130
WP_001046828.1|1310831_1311395_+	DNA endonuclease SmrA	NA	NA	NA	NA	NA
WP_011378691.1|1312935_1313916_-	diguanylate cyclase	NA	G3MA91	Bacillus_virus	32.9	4.8e-05
WP_000387388.1|1314170_1315154_+	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_001157400.1|1316534_1317470_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.1	3.2e-144
WP_134801741.1|1319800_1320494_+|transposase	IS1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	94.8	1.7e-129
WP_000887491.1|1320958_1321171_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	97.1	1.7e-29
WP_000980987.1|1321387_1321639_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001515373.1|1321705_1321984_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	9.7e-12
WP_001265032.1|1321985_1323035_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.3	4.2e-108
WP_000904112.1|1323047_1323422_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	8.4e-35
WP_000762869.1|1323418_1324240_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	57.9	1.5e-76
WP_087786203.1|1325913_1326607_+|transposase	IS1-like element IS1N family transposase	transposase	A0A0U2RK18	Escherichia_phage	95.2	4.4e-130
WP_000562553.1|1326683_1326815_+	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	100.0	3.7e-06
WP_094081558.1|1326984_1328140_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.7	8.9e-67
WP_134801557.1|1328534_1329229_-|transposase	IS1-like element IS1N family transposase	transposase	A0A0U2RK18	Escherichia_phage	95.7	2.6e-130
WP_005023054.1|1329314_1329542_+	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	90.4	5.8e-31
WP_165442259.1|1329899_1331127_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	98.7	3.2e-176
WP_000372595.1|1331146_1331362_+|holin	class II holin family protein	holin	A0A2R2Z340	Escherichia_phage	98.6	3.4e-33
WP_094081558.1|1331592_1332749_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.7	8.9e-67
WP_000968135.1|1333996_1334854_-	iron/manganese ABC transporter permease subunit SitD	NA	NA	NA	NA	NA
WP_001101728.1|1334850_1335708_-	iron/manganese ABC transporter permease subunit SitC	NA	NA	NA	NA	NA
WP_000983722.1|1335704_1336532_-	iron/manganese ABC transporter ATP-binding protein SitB	NA	G9BWD6	Planktothrix_phage	28.5	3.8e-11
>prophage 10
NC_007606	Shigella dysenteriae Sd197, complete sequence	4369232	1350244	1424158	4369232	protease,transposase	Escherichia_phage(50.0%)	52	NA	NA
WP_134801557.1|1350244_1350938_+|transposase	IS1-like element IS1N family transposase	transposase	A0A0U2RK18	Escherichia_phage	95.7	2.6e-130
WP_000177505.1|1352731_1353346_+	CDP-alcohol phosphatidyltransferase family protein	NA	NA	NA	NA	NA
WP_134801570.1|1353320_1354015_-|transposase	IS1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	94.8	7.5e-130
WP_000805710.1|1354067_1354238_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000860167.1|1354382_1355141_-	type I 3-dehydroquinate dehydratase	NA	NA	NA	NA	NA
WP_000798754.1|1355171_1356065_-	quinate/shikimate dehydrogenase	NA	NA	NA	NA	NA
WP_085948186.1|1358040_1359197_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
WP_134801756.1|1360778_1361473_-|transposase	IS1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	94.8	8.3e-129
WP_000163771.1|1361642_1362389_+	scaffolding protein MipA	NA	NA	NA	NA	NA
WP_001186334.1|1362478_1363330_+	methylglyoxal reductase YeaE	NA	A0A1V0SDE7	Indivirus	24.3	1.4e-08
WP_005022969.1|1363380_1364265_-	D-hexose-6-phosphate mutarotase	NA	NA	NA	NA	NA
WP_000153502.1|1364348_1365344_-	glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_001284607.1|1365685_1366099_+	peptide-methionine (R)-S-oxide reductase MsrB	NA	NA	NA	NA	NA
WP_005022962.1|1366140_1366413_+	YeaC family protein	NA	NA	NA	NA	NA
WP_000645219.1|1366781_1367858_+	zinc-binding dehydrogenase	NA	NA	NA	NA	NA
WP_000435282.1|1367884_1369264_+	MFS transporter	NA	NA	NA	NA	NA
WP_000719095.1|1372786_1373545_+	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_134801630.1|1375959_1376654_-|transposase	IS1-like element IS1N family transposase	transposase	A0A0U2RK18	Escherichia_phage	95.2	1.7e-129
WP_001135078.1|1377056_1377698_-	bifunctional nicotinamidase/pyrazinamidase	NA	A0A2K9L2K0	Tupanvirus	34.9	2.9e-19
WP_001170167.1|1377708_1378725_-	asparaginase	NA	NA	NA	NA	NA
WP_001259856.1|1378878_1380735_-	signal peptide peptidase SppA	NA	NA	NA	NA	NA
WP_000339260.1|1380895_1381447_+	NAD(P)H nitroreductase	NA	NA	NA	NA	NA
WP_001298241.1|1381563_1382607_+	selenide, water dikinase SelD	NA	NA	NA	NA	NA
WP_001235843.1|1382611_1384573_+	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	29.2	2.4e-40
WP_134801736.1|1385350_1386045_-|transposase	IS1-like element IS1N family transposase	transposase	A0A0U2RK18	Escherichia_phage	95.2	9.8e-130
WP_038814340.1|1386271_1387288_+	DUF1266 domain-containing protein	NA	NA	NA	NA	NA
WP_000373050.1|1387404_1388748_-	NADP-specific glutamate dehydrogenase	NA	NA	NA	NA	NA
WP_000085233.1|1388983_1389256_+	YnjH family protein	NA	NA	NA	NA	NA
WP_000781880.1|1389221_1389629_-	CTP pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_005022897.1|1391717_1392371_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	32.3	1.4e-13
WP_000524067.1|1395055_1395604_-	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_000977144.1|1395603_1396311_-	TVP38/TMEM64 family protein	NA	NA	NA	NA	NA
WP_005022884.1|1396325_1397003_-	protein YdjY	NA	NA	NA	NA	NA
WP_000673907.1|1397737_1398544_-	exodeoxyribonuclease III	NA	NA	NA	NA	NA
WP_000989462.1|1400982_1402017_+	arginine N-succinyltransferase	NA	NA	NA	NA	NA
WP_000177312.1|1402013_1403015_+	succinylglutamate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_164925045.1|1403447_1404830_+	N-succinylarginine dihydrolase	NA	NA	NA	NA	NA
WP_001228993.1|1406109_1406595_+	ATP-independent periplasmic protein-refolding chaperone	NA	NA	NA	NA	NA
WP_000252406.1|1408107_1408974_-	excinuclease Cho	NA	NA	NA	NA	NA
WP_000175020.1|1409203_1410031_-	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	54.6	3.5e-73
WP_001039044.1|1410232_1410571_+	osmotically-inducible lipoprotein OsmE	NA	NA	NA	NA	NA
WP_134801557.1|1410799_1411493_+|transposase	IS1-like element IS1N family transposase	transposase	A0A0U2RK18	Escherichia_phage	95.7	2.6e-130
WP_000524868.1|1414087_1414423_+	GlpM family protein	NA	NA	NA	NA	NA
WP_000520804.1|1414419_1415142_-	dihydromonapterin reductase	NA	NA	NA	NA	NA
WP_000412385.1|1415178_1416561_-	amino acid permease	NA	NA	NA	NA	NA
WP_000769322.1|1416746_1417691_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_011378711.1|1418214_1419747_+	Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha	NA	NA	NA	NA	NA
WP_000014036.1|1419757_1421146_+	Re/Si-specific NAD(P)(+) transhydrogenase subunit beta	NA	NA	NA	NA	NA
WP_001118210.1|1421170_1422205_-	AI-2 transporter TqsA	NA	NA	NA	NA	NA
WP_000276149.1|1422616_1422982_+	multidrug/spermidine efflux SMR transporter subunit MdtJ	NA	NA	NA	NA	NA
WP_000046670.1|1422968_1423298_+	multidrug/spermidine efflux SMR transporter subunit MdtI	NA	NA	NA	NA	NA
WP_001260863.1|1423336_1424158_-|protease	serine protease	protease	NA	NA	NA	NA
>prophage 11
NC_007606	Shigella dysenteriae Sd197, complete sequence	4369232	1441141	1533852	4369232	transposase	Escherichia_phage(55.56%)	56	NA	NA
WP_134801557.1|1441141_1441835_+|transposase	IS1-like element IS1N family transposase	transposase	A0A0U2RK18	Escherichia_phage	95.7	2.6e-130
WP_000705200.1|1442265_1442607_-	DUF1283 family protein	NA	NA	NA	NA	NA
WP_005022787.1|1442741_1443068_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	54.5	9.9e-24
WP_164925008.1|1445213_1445908_-|transposase	IS1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	94.8	4.9e-129
WP_000151258.1|1446350_1447718_+	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_000214712.1|1449302_1449506_-	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
WP_000215556.1|1449682_1450369_-	DNA-binding transcriptional regulator YdfH	NA	NA	NA	NA	NA
WP_001296081.1|1450457_1451204_-	bifunctional NADP-dependent 3-hydroxy acid dehydrogenase/3-hydroxypropionate dehydrogenase YdfG	NA	NA	NA	NA	NA
WP_011378718.1|1451340_1453386_+	peptidyl-dipeptidase Dcp	NA	NA	NA	NA	NA
WP_001024558.1|1453430_1453949_-	2-oxo-tetronate isomerase	NA	NA	NA	NA	NA
WP_000671733.1|1454224_1454617_+	YdeI family stress tolerance OB fold protein	NA	NA	NA	NA	NA
WP_000592774.1|1454871_1455762_+	diguanylate cyclase DgcZ	NA	A0A127AWB9	Bacillus_phage	37.0	2.4e-19
WP_000901365.1|1455979_1456075_-	protein MgtS	NA	NA	NA	NA	NA
WP_001054206.1|1456978_1458166_-	efflux MFS transporter YdeE	NA	NA	NA	NA	NA
WP_000087228.1|1458360_1459260_+	O-acetylserine/cysteine exporter	NA	NA	NA	NA	NA
WP_000044507.1|1459539_1459923_-	MDR efflux pump AcrAB transcriptional activator MarA	NA	D0R0F8	Streptococcus_phage	32.3	4.7e-09
WP_000843419.1|1459942_1460377_-	multiple antibiotic resistance transcriptional regulator MarR	NA	NA	NA	NA	NA
WP_000885033.1|1460588_1461254_+	NAAT family transporter MarC	NA	NA	NA	NA	NA
WP_000312405.1|1461278_1462442_-	L-arabinose MFS transporter	NA	NA	NA	NA	NA
WP_164925009.1|1462518_1463212_+|transposase	IS1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	94.8	2.9e-129
WP_000198226.1|1463783_1464665_-	aromatic amino acid efflux DMT transporter YddG	NA	NA	NA	NA	NA
WP_001240591.1|1467968_1468853_+	formate dehydrogenase N subunit beta	NA	NA	NA	NA	NA
WP_000520400.1|1468845_1469499_+	formate dehydrogenase-N subunit gamma	NA	NA	NA	NA	NA
WP_005022720.1|1469726_1470011_-	HigA family addiction module antidote protein	NA	A0A2L1IV52	Escherichia_phage	48.9	7.5e-20
WP_000152315.1|1472719_1473151_+	peroxiredoxin OsmC	NA	NA	NA	NA	NA
WP_001285518.1|1473206_1474133_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.1	7.7e-13
WP_000350393.1|1475495_1476815_-	glycoside hydrolase family 10 protein	NA	NA	NA	NA	NA
WP_011378687.1|1476945_1478481_-	acid resistance gamma-aminobutyrate antiporter GadC	NA	NA	NA	NA	NA
WP_000358851.1|1478636_1480037_-	glutamate decarboxylase	NA	NA	NA	NA	NA
WP_005022697.1|1482488_1482611_+	fimbria/pilus outer membrane usher protein	NA	NA	NA	NA	NA
WP_011378689.1|1484105_1484918_+	3-hydroxy-5-phosphonooxypentane-2,4-dione thiolase	NA	NA	NA	NA	NA
WP_000558527.1|1484941_1485232_+	(4S)-4-hydroxy-5-phosphonooxypentane-2,3-dione isomerase	NA	NA	NA	NA	NA
WP_001286580.1|1485288_1486047_+	trans-aconitate 2-methyltransferase	NA	NA	NA	NA	NA
WP_005022666.1|1488677_1490177_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	36.1	1.2e-18
WP_001191033.1|1490315_1490675_-	DUF4186 domain-containing protein	NA	NA	NA	NA	NA
WP_000257407.1|1490674_1491601_-	glutaminase B	NA	NA	NA	NA	NA
WP_000156625.1|1491664_1493053_-	succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_000366509.1|1493153_1494035_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_134801565.1|1494750_1495445_-|transposase	IS1-like element IS1N family transposase	transposase	A0A0U2RK18	Escherichia_phage	95.2	5.8e-130
WP_001015099.1|1496221_1496467_+	YmjA family protein	NA	NA	NA	NA	NA
WP_001250231.1|1496779_1498423_+	peptide ABC transporter substrate-binding protein SapA	NA	NA	NA	NA	NA
WP_000583257.1|1498419_1499385_+	peptide ABC transporter permease SapB	NA	NA	NA	NA	NA
WP_164925010.1|1504709_1505404_-|transposase	IS1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	94.4	4.9e-129
WP_165442260.1|1506829_1508058_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	98.7	4.2e-176
WP_134801565.1|1511426_1512121_-|transposase	IS1-like element IS1N family transposase	transposase	A0A0U2RK18	Escherichia_phage	95.2	5.8e-130
WP_000702520.1|1513879_1515403_+	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	39.2	6.3e-20
WP_001166373.1|1515402_1516098_+	nitrate reductase molybdenum cofactor assembly chaperone	NA	NA	NA	NA	NA
WP_000617116.1|1516094_1516775_+	respiratory nitrate reductase subunit gamma	NA	NA	NA	NA	NA
WP_000804408.1|1516854_1517748_+	PhzF family isomerase	NA	NA	NA	NA	NA
WP_000726693.1|1520205_1522485_+	acid resistance putative oxidoreductase YdeP	NA	NA	NA	NA	NA
WP_000543400.1|1522733_1522931_+	two-component system connector SafA	NA	NA	NA	NA	NA
WP_000060463.1|1523005_1523785_+	acid stress response transcriptional regulator YdeO	NA	NA	NA	NA	NA
WP_134801557.1|1524904_1525599_-|transposase	IS1-like element IS1N family transposase	transposase	A0A0U2RK18	Escherichia_phage	95.7	2.6e-130
WP_134801567.1|1528215_1528909_+|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
WP_000012439.1|1531310_1532576_-	hypothetical protein	NA	A0A2L1IV65	Escherichia_phage	95.0	1.5e-192
WP_171554041.1|1532695_1533852_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.7	1.8e-67
>prophage 12
NC_007606	Shigella dysenteriae Sd197, complete sequence	4369232	1541786	1680054	4369232	tRNA,transposase	Escherichia_phage(29.63%)	110	NA	NA
WP_087786203.1|1541786_1542481_-|transposase	IS1-like element IS1N family transposase	transposase	A0A0U2RK18	Escherichia_phage	95.2	4.4e-130
WP_164925046.1|1543720_1544161_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	31.0	6.0e-08
WP_000138043.1|1544203_1544707_+|tRNA	mischarged aminoacyl-tRNA deacylase	tRNA	NA	NA	NA	NA
WP_000999630.1|1544707_1544812_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000460711.1|1544981_1545428_+	DUF441 domain-containing protein	NA	NA	NA	NA	NA
WP_000990348.1|1545384_1546206_-	DNA-binding transcriptional regulator NimR	NA	NA	NA	NA	NA
WP_000752434.1|1546302_1547484_+	2-nitroimidazole transporter	NA	NA	NA	NA	NA
WP_005022608.1|1547538_1547886_+	DUF488 domain-containing protein	NA	NA	NA	NA	NA
WP_000691935.1|1547907_1548162_-	DUF333 domain-containing lipoprotein YoaF	NA	NA	NA	NA	NA
WP_001306169.1|1548344_1549370_+	diguanylate cyclase DgcP	NA	NA	NA	NA	NA
WP_001219350.1|1549402_1549501_+	YoaK family small membrane protein	NA	NA	NA	NA	NA
WP_164925012.1|1549528_1550223_-|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
WP_032199931.1|1550298_1550352_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000512153.1|1550410_1550659_-	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_000513737.1|1550806_1550989_-	DUF1869 domain-containing protein	NA	NA	NA	NA	NA
WP_000939317.1|1550992_1551352_-	DUF1971 domain-containing protein	NA	NA	NA	NA	NA
WP_000457207.1|1551524_1552163_-	leucine efflux protein LeuE	NA	NA	NA	NA	NA
WP_005022591.1|1553026_1553950_-	DNA-binding transcriptional regulator DmlR	NA	NA	NA	NA	NA
WP_000978503.1|1554052_1555138_+	multifunctional D-malate/3-isopropylmalate/tartarate dehydrogenase	NA	NA	NA	NA	NA
WP_000067841.1|1557774_1558899_+	carnitine monooxygenase subunit YeaW	NA	NA	NA	NA	NA
WP_001287011.1|1558954_1559920_+	carnitine monooxygenase subunit YeaX	NA	NA	NA	NA	NA
WP_024262984.1|1559973_1561089_-	ribonuclease D	NA	NA	NA	NA	NA
WP_000758422.1|1561170_1562856_-	long-chain-fatty-acid--CoA ligase FadD	NA	A0A2H4PQM9	Staphylococcus_phage	26.0	1.5e-35
WP_000290575.1|1563060_1563642_-	Slp family lipoprotein YeaY	NA	NA	NA	NA	NA
WP_001220995.1|1563681_1564377_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_000128816.1|1564434_1566345_-	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	31.8	9.1e-93
WP_001295493.1|1566476_1566821_+	RidA family protein	NA	NA	NA	NA	NA
WP_000457334.1|1568438_1568618_-	YoaH family protein	NA	NA	NA	NA	NA
WP_000854998.1|1568691_1570053_+	aminodeoxychorismate synthase component 1	NA	S4VT78	Pandoravirus	39.8	6.4e-40
WP_000456725.1|1570056_1570635_+	CoA pyrophosphatase	NA	NA	NA	NA	NA
WP_000624284.1|1570818_1572183_+	L-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_005022547.1|1573693_1574731_-	NADPH-dependent curcumin/dihydrocurcumin reductase	NA	NA	NA	NA	NA
WP_000027563.1|1574908_1575427_+	L-methionine sulfoximine/L-methionine sulfone acetyltransferase	NA	NA	NA	NA	NA
WP_001076550.1|1575423_1575873_+	DMT family transporter	NA	NA	NA	NA	NA
WP_164925013.1|1576052_1576747_-|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
WP_000061178.1|1576966_1577140_-	orphan toxin OrtT	NA	NA	NA	NA	NA
WP_001303494.1|1577334_1577430_+	stress response membrane protein YncL	NA	NA	NA	NA	NA
WP_001163896.1|1577526_1578951_-	aminobutyraldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_000220392.1|1580609_1581623_-	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	36.9	3.9e-26
WP_000047467.1|1581640_1582786_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000760650.1|1583030_1584437_-	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_001270286.1|1584515_1584932_-	type II toxin-antitoxin system antitoxin HicB	NA	F1C593	Cronobacter_phage	57.8	6.3e-31
WP_134802034.1|1585245_1585940_-|transposase	IS1-like element IS1N family transposase	transposase	A0A0U2RK18	Escherichia_phage	95.2	1.3e-129
WP_000494245.1|1586149_1586329_+	DUF2554 family protein	NA	NA	NA	NA	NA
WP_000429144.1|1587865_1588402_-	DNA-binding transcriptional regulator SutR	NA	NA	NA	NA	NA
WP_000586725.1|1591268_1591862_-	tellurite resistance methyltransferase TehB	NA	NA	NA	NA	NA
WP_005022519.1|1591858_1592839_-	dicarboxylate transporter/tellurite-resistance protein TehA	NA	NA	NA	NA	NA
WP_005022514.1|1593935_1594475_-	50S ribosomal protein L7/L12-serine acetyltransferase	NA	NA	NA	NA	NA
WP_038814345.1|1594537_1594753_-	YdcH family protein	NA	NA	NA	NA	NA
WP_000375932.1|1595678_1597334_-	glucan biosynthesis protein OpgD	NA	NA	NA	NA	NA
WP_000013787.1|1597558_1598902_-	VOC family protein	NA	NA	NA	NA	NA
WP_024259509.1|1599118_1600033_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_134801567.1|1600068_1600762_+|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
WP_134801577.1|1602319_1603014_-|transposase	IS1-like element IS1N family transposase	transposase	NA	NA	NA	NA
WP_024259507.1|1603648_1603798_+	type I toxin-antitoxin system toxin HokB	NA	NA	NA	NA	NA
WP_000731831.1|1603869_1604043_-	hypothetical protein	NA	A0A0R6PKG1	Moraxella_phage	67.4	1.5e-07
WP_005022464.1|1604287_1604818_-	cytochrome b561	NA	A0A0U2QLA7	Escherichia_phage	44.9	3.1e-19
WP_171554042.1|1607107_1608264_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.7	8.9e-67
WP_000344426.1|1608451_1608829_-	hypothetical protein	NA	NA	NA	NA	NA
WP_134801557.1|1609011_1609706_-|transposase	IS1-like element IS1N family transposase	transposase	A0A0U2RK18	Escherichia_phage	95.7	2.6e-130
WP_001102901.1|1609745_1610159_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000350193.1|1610145_1610307_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000086427.1|1611265_1611691_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000139549.1|1611836_1615739_-	ATP-dependent RNA helicase HrpA	NA	A0A1V0SIV3	Klosneuvirus	29.5	2.9e-53
WP_000048980.1|1615939_1616545_+	FMN-dependent NADH-azoreductase	NA	NA	NA	NA	NA
WP_134802047.1|1617755_1618449_+|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
WP_000431831.1|1618678_1620436_-	bifunctional alpha/beta hydrolase/class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_164925014.1|1621398_1622045_-|transposase	IS1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	88.7	8.9e-117
WP_000347832.1|1622392_1623544_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_005022426.1|1625224_1625767_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_094096554.1|1626631_1627788_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.7	1.4e-67
WP_001278515.1|1629126_1630416_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_000081064.1|1630412_1630706_+	ferredoxin family protein	NA	NA	NA	NA	NA
WP_000069392.1|1632466_1634845_-	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	36.5	2.3e-170
WP_000368046.1|1636514_1637348_+	posphoenolpyruvate synthetase regulatory kinase/phosphorylase PpsR	NA	NA	NA	NA	NA
WP_001082213.1|1637504_1638551_+	3-deoxy-7-phosphoheptulonate synthase AroH	NA	S4W5F1	Pandoravirus	47.4	9.4e-84
WP_001270809.1|1638682_1638874_+	hemin uptake protein HemP	NA	NA	NA	NA	NA
WP_011378745.1|1640374_1641088_-	anti-FlhDC factor	NA	NA	NA	NA	NA
WP_001209787.1|1641334_1641799_-	lipoprotein	NA	S5MM68	Bacillus_phage	37.7	9.5e-12
WP_000029466.1|1641876_1642626_-	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A2R8FG22	Brazilian_cedratvirus	28.2	9.3e-09
WP_001154187.1|1642625_1643177_-	bifunctional thioredoxin/glutathione peroxidase	NA	NA	NA	NA	NA
WP_000956510.1|1643239_1644220_-	vitamin B12 ABC transporter permease BtuC	NA	NA	NA	NA	NA
WP_001229265.1|1644320_1644620_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.2e-13
WP_000672334.1|1644624_1647012_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_000018581.1|1647026_1648010_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.5	1.1e-33
WP_001386830.1|1648292_1648337_-	pheST operon leader peptide PheM	NA	NA	NA	NA	NA
WP_000124857.1|1648459_1648816_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_001124225.1|1648868_1649066_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_001700733.1|1649159_1649702_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.9	6.3e-15
WP_001144210.1|1649705_1651634_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.1	2.1e-129
WP_134801557.1|1652078_1652772_+|transposase	IS1-like element IS1N family transposase	transposase	A0A0U2RK18	Escherichia_phage	95.7	2.6e-130
WP_005022381.1|1652939_1653869_+	6-phosphofructokinase II	NA	NA	NA	NA	NA
WP_000146159.1|1653969_1654260_+	type V toxin-antitoxin system endoribonuclease antitoxin GhoS	NA	NA	NA	NA	NA
WP_000267654.1|1654365_1655226_+	fructosamine kinase family protein	NA	NA	NA	NA	NA
WP_000222172.1|1655266_1655803_-	YniB family protein	NA	NA	NA	NA	NA
WP_000106813.1|1655949_1656618_+	hexitol phosphatase HxpB	NA	NA	NA	NA	NA
WP_001295408.1|1656781_1657372_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_001092515.1|1658227_1658935_+	two-component system response regulator RstA	NA	NA	NA	NA	NA
WP_000732491.1|1658938_1660240_+	two-component system sensor histidine kinase RstB	NA	W8CYF6	Bacillus_phage	23.9	3.2e-17
WP_005022373.1|1660315_1661245_+	DNA replication terminus site-binding protein	NA	NA	NA	NA	NA
WP_001099094.1|1661241_1662645_-	class II fumarate hydratase	NA	NA	NA	NA	NA
WP_000066631.1|1662786_1664433_-	class I fumarate hydratase	NA	NA	NA	NA	NA
WP_001170637.1|1664631_1665807_+	mannose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_001043359.1|1665907_1667416_+	YdgA family protein	NA	NA	NA	NA	NA
WP_005022368.1|1667476_1667737_-	hypothetical protein	NA	NA	NA	NA	NA
WP_134801557.1|1668647_1669341_+|transposase	IS1-like element IS1N family transposase	transposase	A0A0U2RK18	Escherichia_phage	95.7	2.6e-130
WP_000969092.1|1673678_1674269_-	DNA-binding transcriptional regulator UidR	NA	NA	NA	NA	NA
WP_000483353.1|1674497_1675265_-	7-alpha-hydroxysteroid dehydrogenase	NA	NA	NA	NA	NA
WP_000179522.1|1676799_1677828_-	mal regulon transcriptional regulator MalI	NA	NA	NA	NA	NA
WP_134801707.1|1679377_1680054_-|transposase	IS1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	92.2	2.7e-124
>prophage 13
NC_007606	Shigella dysenteriae Sd197, complete sequence	4369232	1706251	1774063	4369232	transposase	Escherichia_phage(35.0%)	50	NA	NA
WP_134802034.1|1706251_1706946_-|transposase	IS1-like element IS1N family transposase	transposase	A0A0U2RK18	Escherichia_phage	95.2	1.3e-129
WP_134801706.1|1707007_1708045_+	N-ethylmaleimide reductase	NA	NA	NA	NA	NA
WP_001237796.1|1708125_1708533_+	lactoylglutathione lyase	NA	NA	NA	NA	NA
WP_001282281.1|1708635_1709283_+	ribonuclease T	NA	NA	NA	NA	NA
WP_000108172.1|1714042_1714390_-	monothiol glutaredoxin 4	NA	NA	NA	NA	NA
WP_000101186.1|1714724_1715552_+	peptidoglycan DD-endopeptidase MepH	NA	A0A2H5BM69	Streptomyces_phage	42.7	1.7e-19
WP_000007283.1|1715679_1716261_+	superoxide dismutase [Fe]	NA	Q56AR7	Bacillus_thuringiensis_phage	46.0	2.6e-43
WP_000701040.1|1716406_1717576_-	MFS transporter	NA	NA	NA	NA	NA
WP_000102278.1|1717741_1717831_-	stress response protein YnhF	NA	NA	NA	NA	NA
WP_000190986.1|1718129_1719155_+	HTH-type transcriptional repressor PurR	NA	C6ZCU4	Enterobacteria_phage	31.4	6.3e-32
WP_000269493.1|1719151_1720084_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001182366.1|1720196_1721408_+	Bcr/CflA family multidrug efflux MFS transporter	NA	NA	NA	NA	NA
WP_000098908.1|1721698_1722847_+	cyclopropane fatty acyl phospholipid synthase	NA	A0A2K9L4K8	Tupanvirus	45.4	2.1e-84
WP_000493947.1|1722886_1723528_-	riboflavin synthase	NA	A0A2I2L4R9	Orpheovirus	35.2	7.4e-23
WP_134801567.1|1723678_1724372_+|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
WP_001174959.1|1724516_1725890_+	multidrug efflux MATE transporter MdtK	NA	NA	NA	NA	NA
WP_000534306.1|1725930_1727187_-	AIDA repeat-containing protein	NA	NA	NA	NA	NA
WP_000587577.1|1730728_1731541_-	hypothetical protein	NA	A0A077K9W7	Edwardsiella_phage	35.9	6.5e-08
WP_001069988.1|1731544_1732330_-	thiosulfate reductase cytochrome B subunit	NA	NA	NA	NA	NA
WP_001349911.1|1732326_1732995_-	4Fe-4S dicluster domain-containing protein	NA	A0A077SL61	Escherichia_phage	37.2	1.0e-22
WP_024259502.1|1733058_1733697_-	YdhW family putative oxidoreductase system protein	NA	NA	NA	NA	NA
WP_005022284.1|1733709_1733859_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000528342.1|1735128_1735338_-	fumarate hydratase FumD	NA	NA	NA	NA	NA
WP_011378751.1|1735894_1737307_+	pyruvate kinase PykF	NA	NA	NA	NA	NA
WP_000648420.1|1738393_1738630_+	murein lipoprotein Lpp	NA	NA	NA	NA	NA
WP_000817117.1|1738692_1739697_-	L,D-transpeptidase LdtE	NA	NA	NA	NA	NA
WP_000279738.1|1739845_1740262_-	cysteine desulfuration protein SufE	NA	NA	NA	NA	NA
WP_000907952.1|1741491_1742763_-	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_000948870.1|1742737_1743484_-	Fe-S cluster assembly ATPase SufC	NA	A0A285PWH2	Cedratvirus	31.4	4.9e-10
WP_000514018.1|1744549_1745257_-	hypothetical protein	NA	A0A0C4UQZ7	Shigella_phage	97.4	1.5e-130
WP_024259501.1|1745207_1745396_-	Com family DNA-binding transcriptional regulator	NA	A0A0C4UQS3	Shigella_phage	98.4	8.2e-31
WP_000905066.1|1745478_1746072_-	recombinase family protein	NA	A0A0C4UR34	Shigella_phage	100.0	2.6e-107
WP_171554043.1|1746782_1747942_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	4.7e-68
WP_164925015.1|1749619_1750314_-|transposase	IS1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	94.8	2.9e-129
WP_171554044.1|1750427_1751583_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	1.8e-67
WP_119164607.1|1752280_1752661_-	hypothetical protein	NA	A0A286S263	Klebsiella_phage	44.0	4.4e-23
WP_001240876.1|1753198_1753402_-	Cro/CI family transcriptional regulator	NA	A0A2R2Z333	Escherichia_phage	100.0	2.0e-30
WP_001056251.1|1753497_1754211_+	LexA family transcriptional regulator	NA	A0A2R2X2B0	Escherichia_phage	99.6	4.1e-131
WP_000939561.1|1754304_1755774_+	Eco57I restriction-modification methylase domain-containing protein	NA	A0A2L1IV91	Escherichia_phage	99.4	5.6e-284
WP_001064715.1|1755770_1756724_+	type II restriction endonuclease BsuBI	NA	A0A0P0ZG22	Escherichia_phage	99.4	5.0e-185
WP_000473115.1|1761845_1762160_-	thiosulfate sulfurtransferase PspE	NA	NA	NA	NA	NA
WP_001295585.1|1762234_1762456_-	phage shock protein PspD	NA	NA	NA	NA	NA
WP_000907387.1|1762464_1762824_-	envelope stress response membrane protein PspC	NA	NA	NA	NA	NA
WP_001274963.1|1762823_1763048_-	envelope stress response membrane protein PspB	NA	NA	NA	NA	NA
WP_000511015.1|1763101_1763770_-	phage shock protein PspA	NA	NA	NA	NA	NA
WP_000852837.1|1763936_1764914_+	phage shock protein operon transcriptional activator	NA	NA	NA	NA	NA
WP_000134883.1|1766346_1767627_-	gamma-glutamylputrescine oxidase	NA	NA	NA	NA	NA
WP_001278727.1|1769265_1769823_-	HTH-type transcriptional regulator PuuR	NA	NA	NA	NA	NA
WP_120795382.1|1772392_1772557_+	protein YmjE	NA	NA	NA	NA	NA
WP_134801698.1|1773368_1774063_-|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
>prophage 14
NC_007606	Shigella dysenteriae Sd197, complete sequence	4369232	1780360	1828599	4369232	tRNA,protease,holin,transposase	Escherichia_phage(25.0%)	42	NA	NA
WP_134801698.1|1780360_1781054_+|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
WP_000395004.1|1783913_1785464_-	CNNM family cation transport protein YoaE	NA	A0A0R6PEZ3	Moraxella_phage	44.9	2.9e-41
WP_000150527.1|1785927_1786899_+	PTS mannose transporter subunit IIAB	NA	NA	NA	NA	NA
WP_000228655.1|1787775_1788627_+	PTS mannose transporter subunit IID	NA	NA	NA	NA	NA
WP_000156255.1|1788681_1789140_+	DUF986 domain-containing protein	NA	NA	NA	NA	NA
WP_001296134.1|1789568_1790135_+	manganese efflux pump MntP	NA	NA	NA	NA	NA
WP_000010115.1|1790131_1790941_-	23S rRNA (guanine(745)-N(1))-methyltransferase	NA	NA	NA	NA	NA
WP_001062678.1|1791106_1791316_-	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	1.6e-22
WP_001295496.1|1791328_1791472_-	YobF family protein	NA	NA	NA	NA	NA
WP_134802058.1|1792050_1792744_+|transposase	IS1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	94.4	1.1e-128
WP_001014738.1|1792761_1793049_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000714550.1|1793123_1793267_-	PhoP/PhoQ regulator MgrB	NA	NA	NA	NA	NA
WP_001211011.1|1793425_1793665_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001262180.1|1793808_1794600_-	DNA-binding transcriptional regulator KdgR	NA	NA	NA	NA	NA
WP_000984517.1|1796190_1797072_-|protease	protease HtpX	protease	NA	NA	NA	NA
WP_001055786.1|1797263_1799312_-	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.7	2.3e-86
WP_000431368.1|1799331_1800030_-	RNA chaperone ProQ	NA	NA	NA	NA	NA
WP_001043882.1|1800126_1800624_-	L-methionine (R)-S-oxide reductase	NA	NA	NA	NA	NA
WP_134801557.1|1801650_1802344_+|transposase	IS1-like element IS1N family transposase	transposase	A0A0U2RK18	Escherichia_phage	95.7	2.6e-130
WP_005022197.1|1802780_1805402_+	lipid-binding membrane homeostasis protein YebT	NA	NA	NA	NA	NA
WP_005022196.1|1805481_1806921_+	16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF	NA	NA	NA	NA	NA
WP_001295499.1|1807038_1807275_+	DUF1480 family protein	NA	NA	NA	NA	NA
WP_000457841.1|1807379_1807571_+	YebW family protein	NA	NA	NA	NA	NA
WP_096266769.1|1808750_1809918_+|transposase	IS3-like element IS911 family transposase	transposase	Q716C2	Shigella_phage	100.0	1.8e-184
WP_000839577.1|1810826_1811042_+|holin	class II holin family protein	holin	M1FN85	Enterobacteria_phage	94.4	2.9e-32
WP_005022186.1|1811041_1811170_+	hypothetical protein	NA	A0A0N7KZA0	Stx2-converting_phage	97.5	2.6e-12
WP_158249630.1|1812371_1812509_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001039888.1|1812508_1812688_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011378765.1|1812688_1814404_-	T3SS effector E3 ubiquitin-protein ligase IpaH3	NA	NA	NA	NA	NA
WP_164925017.1|1814861_1815555_+|transposase	IS1-like element IS1N family transposase	transposase	A0A0U2RK18	Escherichia_phage	95.2	1.4e-128
WP_005022148.1|1816132_1817884_+	T3SS effector E3 ubiquitin-protein ligase IpaH2	NA	NA	NA	NA	NA
WP_001039888.1|1817884_1818064_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158249630.1|1818063_1818201_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000388336.1|1819407_1819680_-	DUF4376 domain-containing protein	NA	Q8W610	Enterobacteria_phage	80.0	5.7e-33
WP_164925018.1|1819680_1820375_-|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
WP_000815435.1|1821903_1822899_+	6-phosphogluconolactonase	NA	NA	NA	NA	NA
WP_164925019.1|1823443_1824138_-|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
WP_000872356.1|1824466_1824790_+	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	65.4	4.0e-41
WP_000444472.1|1824892_1826143_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	98.1	8.5e-23
WP_001248676.1|1826314_1826968_+	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000476093.1|1826977_1827439_+	phosphatase NudJ	NA	NA	NA	NA	NA
WP_005022119.1|1827492_1828599_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
>prophage 15
NC_007606	Shigella dysenteriae Sd197, complete sequence	4369232	1873767	1906110	4369232	transposase	Escherichia_phage(66.67%)	30	NA	NA
WP_134801756.1|1873767_1874462_-|transposase	IS1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	94.8	8.3e-129
WP_000846354.1|1874863_1875823_-	23S rRNA pseudouridine(955/2504/2580) synthase RluC	NA	NA	NA	NA	NA
WP_000827432.1|1876395_1879581_+	ribonuclease E	NA	NA	NA	NA	NA
WP_005022062.1|1879824_1880721_-	flagellar hook-associated protein FlgL	NA	NA	NA	NA	NA
WP_001323587.1|1882426_1883368_-	flagellar assembly peptidoglycan hydrolase FlgJ	NA	S5M633	Brevibacillus_phage	31.3	3.6e-10
WP_005022057.1|1883367_1884465_-	flagellar basal body P-ring protein FlgI	NA	NA	NA	NA	NA
WP_011378771.1|1884476_1885175_-	flagellar basal body L-ring protein FlgH	NA	NA	NA	NA	NA
WP_000885869.1|1886918_1888127_-	flagellar hook protein FlgE	NA	NA	NA	NA	NA
WP_000020462.1|1888151_1888847_-	flagellar hook assembly protein FlgD	NA	NA	NA	NA	NA
WP_001196467.1|1888858_1889263_-	flagellar basal body rod protein FlgC	NA	NA	NA	NA	NA
WP_000884712.1|1889266_1889683_-	flagellar basal body rod protein FlgB	NA	NA	NA	NA	NA
WP_134806239.1|1889766_1890460_+|transposase	IS1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	94.4	3.7e-129
WP_000879694.1|1890611_1891271_+	flagellar basal body P-ring formation protein FlgA	NA	NA	NA	NA	NA
WP_000020884.1|1891346_1891640_+	anti-sigma-28 factor FlgM	NA	NA	NA	NA	NA
WP_001050691.1|1892092_1893628_-	murein biosynthesis integral membrane protein MurJ	NA	NA	NA	NA	NA
WP_000736132.1|1893737_1894661_-	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_000877086.1|1894662_1895310_-	YceH family protein	NA	NA	NA	NA	NA
WP_000468184.1|1895320_1895905_-	ribosomal protein S5-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_134802063.1|1896074_1896769_-|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
WP_000780928.1|1898184_1898832_+	glutaredoxin 2	NA	NA	NA	NA	NA
WP_005022016.1|1898965_1899526_+	lipoprotein	NA	NA	NA	NA	NA
WP_000126536.1|1899631_1900678_+	dihydroorotase	NA	NA	NA	NA	NA
WP_001258621.1|1900751_1900997_+	DNA damage-inducible protein I	NA	H6WRY5	Salmonella_phage	46.2	1.1e-11
WP_134801691.1|1901072_1901767_-|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
WP_000414438.1|1902060_1902315_+	biofilm formation regulator BssS	NA	NA	NA	NA	NA
WP_000872799.1|1902429_1903548_+	N-methyl-L-tryptophan oxidase	NA	NA	NA	NA	NA
WP_001253418.1|1903595_1903709_+	DUF2770 family protein	NA	NA	NA	NA	NA
WP_134801557.1|1903912_1904607_-|transposase	IS1-like element IS1N family transposase	transposase	A0A0U2RK18	Escherichia_phage	95.7	2.6e-130
WP_005021998.1|1904732_1905392_-	transcriptional regulator YeiL	NA	NA	NA	NA	NA
WP_134801662.1|1905415_1906110_-|transposase	IS1-like element IS1N family transposase	transposase	A0A0U2RK18	Escherichia_phage	95.7	2.6e-130
>prophage 16
NC_007606	Shigella dysenteriae Sd197, complete sequence	4369232	1922535	1988663	4369232	tRNA,capsid,transposase,lysis	Escherichia_phage(28.57%)	40	NA	NA
WP_000184975.1|1922535_1923279_-|capsid	minor capsid protein	capsid	A0A0M4REK0	Salmonella_phage	84.4	5.3e-89
WP_001201594.1|1925131_1926613_+	sulfatase-like hydrolase/transferase	NA	NA	NA	NA	NA
WP_001139613.1|1928843_1929512_+	GTP cyclohydrolase I FolE	NA	M1Q6X8	Cellulophaga_phage	56.3	9.0e-56
WP_000628676.1|1930826_1931867_+	HTH-type transcriptional regulator GalS	NA	NA	NA	NA	NA
WP_001036964.1|1932146_1933145_+	galactose/glucose ABC transporter substrate-binding protein MglB	NA	NA	NA	NA	NA
WP_000883479.1|1935820_1936057_+	galactose ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_134801557.1|1938144_1938839_-|transposase	IS1-like element IS1N family transposase	transposase	A0A0U2RK18	Escherichia_phage	95.7	2.6e-130
WP_134801557.1|1941263_1941957_+|transposase	IS1-like element IS1N family transposase	transposase	A0A0U2RK18	Escherichia_phage	95.7	2.6e-130
WP_000383097.1|1942156_1942396_-	DUF2542 family protein	NA	NA	NA	NA	NA
WP_000920064.1|1942398_1943118_-	outer membrane permeability protein SanA	NA	NA	NA	NA	NA
WP_000553543.1|1943267_1944152_-	cytidine deaminase	NA	NA	NA	NA	NA
WP_000968198.1|1944281_1944977_-|lysis	CidB/LrgB family autolysis modulator	lysis	NA	NA	NA	NA
WP_005021862.1|1944973_1945372_-	CidA/LrgA family protein	NA	NA	NA	NA	NA
WP_000691708.1|1946780_1946864_-	protein YohP	NA	NA	NA	NA	NA
WP_134801736.1|1946878_1947573_-|transposase	IS1-like element IS1N family transposase	transposase	A0A0U2RK18	Escherichia_phage	95.2	9.8e-130
WP_000079517.1|1949350_1950112_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_000365433.1|1950241_1950820_-	DedA family protein	NA	NA	NA	NA	NA
WP_005021842.1|1950989_1951577_+	YIP1 family protein	NA	NA	NA	NA	NA
WP_001319943.1|1951750_1952683_+	D-alanyl-D-alanine endopeptidase	NA	NA	NA	NA	NA
WP_000097406.1|1952721_1954437_-	D-lactate dehydrogenase	NA	NA	NA	NA	NA
WP_000871526.1|1954632_1956930_+	beta-glucosidase BglX	NA	NA	NA	NA	NA
WP_001131279.1|1957181_1958099_+	glycine betaine ABC transporter substrate-binding protein OsmF	NA	NA	NA	NA	NA
WP_000783124.1|1960182_1960914_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216963.1|1960894_1961002_-	protein YohO	NA	NA	NA	NA	NA
WP_001240406.1|1961061_1961793_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.0	3.7e-111
WP_005021819.1|1962014_1963700_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.3	8.1e-303
WP_000598644.1|1963696_1964416_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295430.1|1964462_1964933_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_005021815.1|1964974_1965436_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	98.7	7.8e-75
WP_165442258.1|1966559_1967788_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.0	6.5e-177
WP_005021809.1|1970021_1971080_-	hypothetical protein	NA	NA	NA	NA	NA
WP_134801571.1|1972240_1972934_+|transposase	IS1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	94.8	2.9e-129
WP_134802065.1|1976252_1976950_-|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
WP_011378786.1|1978812_1980846_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	8.9e-54
WP_001005462.1|1980977_1982087_+	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_011378787.1|1982349_1982613_+	DUF2574 family protein	NA	NA	NA	NA	NA
WP_000929409.1|1983847_1984147_-	YegP family protein	NA	NA	NA	NA	NA
WP_000137877.1|1984337_1985060_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.6	3.7e-31
WP_000675153.1|1985056_1986460_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	29.0	7.8e-33
WP_005021650.1|1987466_1988663_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
>prophage 17
NC_007606	Shigella dysenteriae Sd197, complete sequence	4369232	1999266	2063280	4369232	tRNA,transposase	Escherichia_phage(30.0%)	59	NA	NA
WP_001234777.1|1999266_1999848_+	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	42.1	1.8e-31
WP_001252372.1|1999869_2001723_+	outer membrane assembly protein AsmA	NA	NA	NA	NA	NA
WP_000687871.1|2001775_2002066_-	XRE family transcriptional regulator	NA	A0A2D1GR59	Pseudomonas_phage	37.2	2.1e-09
WP_001014550.1|2002055_2002277_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000454702.1|2002614_2004198_-	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	42.6	7.2e-35
WP_134801630.1|2004603_2005297_+|transposase	IS1-like element IS1N family transposase	transposase	A0A0U2RK18	Escherichia_phage	95.2	1.7e-129
WP_000183052.1|2005516_2006410_+	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	42.0	1.3e-46
WP_000699445.1|2006781_2007867_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	54.5	9.4e-103
WP_001023636.1|2007866_2008766_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	34.5	6.3e-28
WP_000857520.1|2008823_2009702_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.5	3.9e-107
WP_001100803.1|2009704_2010262_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.9	1.1e-51
WP_000739384.1|2010258_2011449_+	O148 family O-antigen flippase	NA	NA	NA	NA	NA
WP_000220864.1|2011445_2012588_+	O148 family O-antigen polymerase	NA	NA	NA	NA	NA
WP_001045977.1|2012580_2013429_+	rhamnosyltransferase	NA	NA	NA	NA	NA
WP_000592106.1|2013453_2014365_+	rhamnosyltransferase	NA	NA	NA	NA	NA
WP_000043456.1|2015550_2016957_+	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.3	1.4e-37
WP_000704836.1|2017206_2018373_+	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	52.2	1.7e-110
WP_005021694.1|2018519_2019497_+	LPS O-antigen chain length determinant protein WzzB	NA	NA	NA	NA	NA
WP_000954883.1|2019593_2020205_-	bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE	NA	NA	NA	NA	NA
WP_000880181.1|2020198_2020975_-	imidazole glycerol phosphate synthase subunit HisF	NA	NA	NA	NA	NA
WP_000586449.1|2020956_2021694_-	1-(5-phosphoribosyl)-5-[(5- phosphoribosylamino)methylideneamino]imidazole-4- carboxamide isomerase	NA	NA	NA	NA	NA
WP_001103560.1|2021693_2022284_-	imidazole glycerol phosphate synthase subunit HisH	NA	NA	NA	NA	NA
WP_000080078.1|2022283_2023351_-	bifunctional histidinol-phosphatase/imidazoleglycerol-phosphate dehydratase HisB	NA	NA	NA	NA	NA
WP_000108929.1|2023350_2024421_-	histidinol-phosphate transaminase	NA	NA	NA	NA	NA
WP_005021699.1|2024417_2025722_-	histidinol dehydrogenase	NA	NA	NA	NA	NA
WP_000131774.1|2025727_2026627_-	ATP phosphoribosyltransferase	NA	A0A0F7Q4B0	Cellulophaga_phage	94.7	1.8e-11
WP_010989201.1|2026772_2026814_-	his operon leader peptide	NA	NA	NA	NA	NA
WP_000754700.1|2027229_2028054_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_119164546.1|2029243_2029306_+	membrane protein YoeI	NA	NA	NA	NA	NA
WP_000019197.1|2029295_2030654_+	putrescine/proton symporter PlaP	NA	NA	NA	NA	NA
WP_165442261.1|2031173_2032402_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.0	1.9e-176
WP_000985271.1|2033228_2033456_+	sulfurtransferase TusA family protein	NA	NA	NA	NA	NA
WP_000980578.1|2033498_2034926_-	exodeoxyribonuclease I	NA	NA	NA	NA	NA
WP_087786203.1|2035176_2035871_-|transposase	IS1-like element IS1N family transposase	transposase	A0A0U2RK18	Escherichia_phage	95.2	4.4e-130
WP_038815513.1|2035913_2037074_+	serine-type D-Ala-D-Ala carboxypeptidase DacD	NA	B6DZZ7	Stx2-converting_phage	98.2	6.7e-224
WP_001105370.1|2037192_2037555_+	DNA gyrase inhibitor SbmC	NA	NA	NA	NA	NA
WP_134801679.1|2037590_2038284_+|transposase	IS1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	93.9	1.1e-128
WP_001200870.1|2038638_2039697_+	FUSC family protein	NA	NA	NA	NA	NA
WP_005021706.1|2039868_2040198_+	DUF496 family protein	NA	NA	NA	NA	NA
WP_064734059.1|2040298_2040427_-	hypothetical protein	NA	NA	NA	NA	NA
WP_134801520.1|2040426_2041121_-|transposase	IS1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	94.8	1.7e-129
WP_023601432.1|2041347_2041638_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000973159.1|2041771_2042317_+	bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase	NA	NA	NA	NA	NA
WP_005021725.1|2042313_2043057_+	adenosylcobinamide-GDP ribazoletransferase	NA	NA	NA	NA	NA
WP_001193813.1|2043068_2044148_+	nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000986320.1|2044209_2045145_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_001011469.1|2045601_2046519_+	nitrogen assimilation transcriptional regulator	NA	NA	NA	NA	NA
WP_001011001.1|2046620_2047571_+	HTH-type transcriptional regulator Cbl	NA	NA	NA	NA	NA
WP_001060215.1|2050351_2051806_-	AMP nucleosidase	NA	NA	NA	NA	NA
WP_000378541.1|2051907_2053224_-	shikimate transporter	NA	NA	NA	NA	NA
WP_000124651.1|2054302_2054554_+	type II toxin-antitoxin system ParD family antitoxin	NA	NA	NA	NA	NA
WP_001220184.1|2054555_2054852_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000475997.1|2054954_2056316_+|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	98.9	8.7e-215
WP_000716757.1|2056645_2056963_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000807364.1|2057376_2058276_+	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	28.6	6.3e-12
WP_000178558.1|2058357_2059137_-	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_000844242.1|2059236_2060277_-	galactitol-1-phosphate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_005021741.1|2061708_2061969_-	PTS galactitol transporter subunit IIB	NA	NA	NA	NA	NA
WP_087786203.1|2062585_2063280_-|transposase	IS1-like element IS1N family transposase	transposase	A0A0U2RK18	Escherichia_phage	95.2	4.4e-130
>prophage 18
NC_007606	Shigella dysenteriae Sd197, complete sequence	4369232	2076762	2145811	4369232	tRNA,transposase	Escherichia_phage(18.18%)	49	NA	NA
WP_164925023.1|2076762_2077457_-|transposase	IS1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	94.8	1.3e-129
WP_011378794.1|2081394_2082447_-	rhodanese-related sulfurtransferase	NA	NA	NA	NA	NA
WP_005021633.1|2082671_2083592_+	kdo(2)-lipid IV(A) lauroyltransferase	NA	A0A1W6JP29	Morganella_phage	40.7	9.5e-56
WP_000074156.1|2083763_2083961_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000180056.1|2086989_2087364_+	acidic protein MsyB	NA	NA	NA	NA	NA
WP_001237205.1|2087364_2087592_-	YceK/YidQ family lipoprotein	NA	NA	NA	NA	NA
WP_011378796.1|2087764_2090308_-	glucans biosynthesis glucosyltransferase MdoH	NA	NA	NA	NA	NA
WP_011378797.1|2090300_2091836_-	glucans biosynthesis protein MdoG	NA	NA	NA	NA	NA
WP_001070377.1|2092229_2093387_+	glucans biosynthesis protein MdoC	NA	NA	NA	NA	NA
WP_011378798.1|2093394_2094876_-	cardiolipin synthase ClsC	NA	NA	NA	NA	NA
WP_000857417.1|2094817_2095351_-	O-acetyl-ADP-ribose deacetylase	NA	Q71G61	Red_sea_bream_iridovirus	39.1	3.9e-25
WP_000489580.1|2095445_2095757_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_000749273.1|2097981_2098569_-	YceI family protein	NA	NA	NA	NA	NA
WP_000011095.1|2098572_2099139_-	cytochrome b	NA	NA	NA	NA	NA
WP_134801557.1|2099275_2099969_+|transposase	IS1-like element IS1N family transposase	transposase	A0A0U2RK18	Escherichia_phage	95.7	2.6e-130
WP_000854441.1|2100399_2102091_-	PTS fructose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_000091263.1|2102107_2103046_-	1-phosphofructokinase	NA	NA	NA	NA	NA
WP_000487223.1|2103045_2104176_-	fused PTS fructose transporter subunit IIA/HPr protein	NA	NA	NA	NA	NA
WP_134802047.1|2104447_2105142_-|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
WP_001263921.1|2105309_2105885_+	NADPH-dependent FMN reductase	NA	NA	NA	NA	NA
WP_005021579.1|2105877_2106870_+	aliphatic sulfonate ABC transporter substrate-binding protein SsuA	NA	NA	NA	NA	NA
WP_000235210.1|2107844_2108636_+	aliphatic sulfonate ABC transporter permease SsuC	NA	NA	NA	NA	NA
WP_000193837.1|2109426_2112039_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.8	5.3e-19
WP_005021568.1|2112304_2113507_+	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000117883.1|2113676_2115077_+|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	36.1	1.5e-81
WP_000977911.1|2115679_2116768_+	porin OmpF	NA	Q1MVN1	Enterobacteria_phage	54.1	1.4e-98
WP_000462687.1|2116952_2118143_+	aspartate transaminase	NA	NA	NA	NA	NA
WP_001109448.1|2118192_2118840_-	hydroxyacylglutathione hydrolase GloC	NA	NA	NA	NA	NA
WP_001295932.1|2118866_2119415_-	YcbK family protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	7.0e-06
WP_000925983.1|2119595_2121443_-	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_134801671.1|2121628_2122323_-|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
WP_000572767.1|2122425_2126877_-	chromosome partition protein MukB	NA	NA	NA	NA	NA
WP_001295347.1|2126876_2127581_-	chromosome partition protein MukE	NA	NA	NA	NA	NA
WP_001288850.1|2127561_2128884_-	chromosome partition protein MukF	NA	NA	NA	NA	NA
WP_001298300.1|2128880_2129666_-|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
WP_000899608.1|2129803_2130583_+	envelope biogenesis factor ElyC	NA	NA	NA	NA	NA
WP_000436931.1|2130559_2131453_-	YcbJ family phosphotransferase	NA	NA	NA	NA	NA
WP_000011593.1|2131606_2132353_-	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000350058.1|2132349_2132532_-	protein YcaR	NA	NA	NA	NA	NA
WP_000056533.1|2132583_2133816_-	winged helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000570528.1|2133852_2134839_-	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_000551270.1|2134835_2136584_-	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	29.8	2.5e-57
WP_000705678.1|2136620_2138885_-	ComEC family protein	NA	NA	NA	NA	NA
WP_000167336.1|2139091_2139376_-	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	40.2	3.2e-10
WP_000140321.1|2139535_2141209_-	30S ribosomal protein S1	NA	NA	NA	NA	NA
WP_000125018.1|2141319_2142003_-	(d)CMP kinase	NA	NA	NA	NA	NA
WP_000799175.1|2142175_2142940_-	metallopeptidase YcaL	NA	NA	NA	NA	NA
WP_164925025.1|2142993_2144266_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	98.7	5.7e-176
WP_011378800.1|2144464_2145811_+|transposase	IS4-like element IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 19
NC_007606	Shigella dysenteriae Sd197, complete sequence	4369232	2156212	2243211	4369232	tRNA,protease,transposase,integrase	Enterobacteria_phage(13.79%)	59	2171737:2171753	2257677:2257693
WP_134801689.1|2156212_2156906_+|transposase	IS1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	95.2	4.4e-130
WP_005016041.1|2159104_2159323_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000109295.1|2159532_2160681_-	MFS transporter	NA	NA	NA	NA	NA
WP_000534674.1|2161657_2162521_-	dimethyl sulfoxide reductase anchor subunit DmsC	NA	NA	NA	NA	NA
WP_000850308.1|2163149_2165594_-	dimethylsulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.7	3.3e-220
WP_000886672.1|2165832_2167125_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.2	3.3e-94
WP_000067755.1|2167215_2168559_-	replication-associated recombination protein RarA	NA	G3MBE0	Bacillus_virus	40.8	2.1e-80
WP_001295343.1|2168569_2169181_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_000076991.1|2169335_2173442_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.4	2.7e-86
2171737:2171753	attL	GCAACGGTTGCGGCAGC	NA	NA	NA	NA
WP_000228473.1|2173576_2174071_-	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_000537418.1|2174615_2175581_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	8.5e-63
WP_001043606.1|2175703_2177470_+	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	24.3	5.4e-23
WP_001202234.1|2177470_2179192_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	25.0	4.9e-21
WP_001241684.1|2179233_2179938_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001040187.1|2180222_2180441_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_000934044.1|2181124_2183401_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
WP_000520781.1|2183430_2183751_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
WP_000410785.1|2184073_2184298_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	2.3e-16
WP_000188167.1|2184370_2186323_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	39.6	3.2e-37
WP_000746449.1|2186319_2187369_-	macrolide transporter subunit MacA	NA	NA	NA	NA	NA
WP_130091671.1|2187519_2188476_+	DUF535 domain-containing protein	NA	NA	NA	NA	NA
WP_000599782.1|2188472_2190131_-	ATP-dependent endonuclease	NA	NA	NA	NA	NA
WP_000488717.1|2191333_2192011_+	aquaporin Z	NA	NA	NA	NA	NA
WP_000491144.1|2192144_2193044_+	L-lysine exporter LysO	NA	NA	NA	NA	NA
WP_000458823.1|2193187_2194840_+	hydroxylamine reductase	NA	NA	NA	NA	NA
WP_000178644.1|2194851_2195820_+	NADH oxidoreductase	NA	NA	NA	NA	NA
WP_000815336.1|2195952_2197671_+	ubiquinone-dependent pyruvate dehydrogenase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	24.1	5.2e-31
WP_000566392.1|2197707_2198709_+	low-specificity L-threonine aldolase	NA	NA	NA	NA	NA
WP_001136565.1|2198719_2200150_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_005016000.1|2200248_2201262_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_001255151.1|2201258_2202089_-	N-acetylmuramoyl-L-alanine amidase AmiD	NA	A0A1B0UZW5	Roseobacter_phage	30.0	5.7e-07
WP_001160737.1|2202085_2202409_-	heavy metal-binding domain-containing protein	NA	NA	NA	NA	NA
WP_134801577.1|2204332_2205027_-|transposase	IS1-like element IS1N family transposase	transposase	NA	NA	NA	NA
WP_134801557.1|2206169_2206863_+|transposase	IS1-like element IS1N family transposase	transposase	A0A0U2RK18	Escherichia_phage	95.7	2.6e-130
WP_000027205.1|2208002_2208731_+	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	36.7	6.0e-29
WP_000756570.1|2208748_2209480_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001001693.1|2209486_2210203_+	arginine ABC transporter permease ArtQ	NA	NA	NA	NA	NA
WP_000464490.1|2210202_2210871_+	arginine ABC transporter permease ArtM	NA	NA	NA	NA	NA
WP_001004003.1|2213695_2214418_-	phage antirepressor KilAC domain-containing protein	NA	O48426	Enterobacteria_phage	97.1	1.1e-126
WP_000957540.1|2214492_2215170_-	phage antirepressor Ant	NA	Q4A1A4	Enterobacteria_phage	87.6	6.9e-112
WP_024258354.1|2215490_2215820_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A088CBP5	Shigella_phage	93.1	1.6e-42
WP_000147081.1|2215809_2216118_+	helix-turn-helix transcriptional regulator	NA	A0A088CD40	Shigella_phage	98.0	3.5e-47
WP_001254231.1|2216114_2216336_-	NinE family protein	NA	K7PHE6	Enterobacteria_phage	98.3	3.2e-26
WP_000814621.1|2216332_2216743_-	recombination protein NinB	NA	A0A0P0ZCW6	Stx2-converting_phage	98.5	8.0e-71
WP_000334721.1|2218145_2219165_+|integrase	tyrosine-type recombinase/integrase	integrase	K7PHK0	Enterobacteria_phage	96.1	1.8e-180
WP_001215754.1|2219222_2219783_-	DUF1175 domain-containing protein	NA	NA	NA	NA	NA
WP_000012330.1|2219779_2220208_-	DUF2138 family protein	NA	NA	NA	NA	NA
WP_001281279.1|2220356_2222984_-	DNA topoisomerase (ATP-hydrolyzing) subunit A	NA	G3M9Z5	Bacillus_virus	31.4	2.4e-88
WP_000990765.1|2223130_2223853_+	bifunctional 3-demethylubiquinone 3-O-methyltransferase/2-octaprenyl-6-hydroxy phenol methylase	NA	NA	NA	NA	NA
WP_001075157.1|2228441_2230727_+	ribonucleoside-diphosphate reductase subunit alpha	NA	A0A2D1GNB1	Pseudoalteromonas_phage	63.4	3.7e-282
WP_000332037.1|2230872_2232003_+	ribonucleotide-diphosphate reductase subunit beta	NA	G9IAA3	Pseudomonas_phage	79.1	1.5e-175
WP_000124825.1|2232002_2232257_+	ferredoxin-like diferric-tyrosyl radical cofactor maintenance protein YfaE	NA	G9IAA2	Pseudomonas_phage	73.1	2.6e-24
WP_000660231.1|2233041_2234232_-	MFS transporter	NA	NA	NA	NA	NA
WP_000779098.1|2235312_2236392_-	glycerophosphodiester phosphodiesterase	NA	A0A220BYK6	Staphylococcus_phage	46.0	5.1e-08
WP_000948705.1|2236396_2237755_-	glycerol-3-phosphate transporter	NA	NA	NA	NA	NA
WP_000857263.1|2238027_2239656_+	anaerobic glycerol-3-phosphate dehydrogenase subunit A	NA	NA	NA	NA	NA
WP_001209957.1|2239645_2240905_+	glycerol-3-phosphate dehydrogenase subunit GlpB	NA	NA	NA	NA	NA
WP_001000380.1|2240901_2242092_+	anaerobic glycerol-3-phosphate dehydrogenase subunit C	NA	NA	NA	NA	NA
WP_000140558.1|2242284_2243211_+|transposase	ISNCY family transposase	transposase	Q2A0A7	Sodalis_phage	54.4	3.4e-69
2257677:2257693	attR	GCAACGGTTGCGGCAGC	NA	NA	NA	NA
>prophage 20
NC_007606	Shigella dysenteriae Sd197, complete sequence	4369232	2395063	2453361	4369232	tRNA,transposase	Escherichia_phage(30.77%)	48	NA	NA
WP_000826379.1|2395063_2396272_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	93.3	1.6e-207
WP_001031490.1|2396294_2396822_+|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	58.4	3.8e-41
WP_000695636.1|2396822_2398238_-|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_000201408.1|2399045_2399387_+	FlxA-like family protein	NA	NA	NA	NA	NA
WP_000765591.1|2400393_2401392_+	bile acid:sodium symporter	NA	NA	NA	NA	NA
WP_000410201.1|2401388_2401607_-	DUF3820 family protein	NA	NA	NA	NA	NA
WP_000443676.1|2401608_2403624_-	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	43.5	5.0e-150
WP_001299866.1|2403694_2404693_-	cell division protein ZipA	NA	NA	NA	NA	NA
WP_000254849.1|2404922_2405684_+	sulfate transporter CysZ	NA	NA	NA	NA	NA
WP_000034409.1|2405868_2406840_+	cysteine synthase A	NA	A0A1X9I5F1	Streptococcus_phage	51.0	3.7e-74
WP_000487600.1|2407223_2407481_+	phosphocarrier protein Hpr	NA	NA	NA	NA	NA
WP_000623136.1|2407525_2409253_+	phosphoenolpyruvate-protein phosphotransferase PtsI	NA	A0A1V0SGR7	Hokovirus	31.1	9.6e-17
WP_000522248.1|2409293_2409803_+	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_000096652.1|2409845_2410697_-	pyridoxine/pyridoxal/pyridoxamine kinase	NA	NA	NA	NA	NA
WP_000719946.1|2410801_2411170_+	YfeK family protein	NA	NA	NA	NA	NA
WP_001358955.1|2411172_2412084_-	cysteine synthase B	NA	A0A1X9I5F1	Streptococcus_phage	41.9	4.5e-58
WP_000021037.1|2412217_2413315_-	sulfate/thiosulfate ABC transporter ATP-binding protein CysA	NA	G3M9Y6	Bacillus_virus	34.1	4.2e-26
WP_000852687.1|2413304_2414180_-	sulfate/thiosulfate ABC transporter permease CysW	NA	NA	NA	NA	NA
WP_000458410.1|2414179_2415013_-	sulfate/thiosulfate ABC transporter permease CysT	NA	NA	NA	NA	NA
WP_000290236.1|2415012_2416029_-	thiosulfate/sulfate ABC transporter substrate-binding protein CysP	NA	NA	NA	NA	NA
WP_000517423.1|2416332_2417124_-	SDR family oxidoreductase UcpA	NA	A0A0M4JSW6	Mollivirus	35.9	1.1e-07
WP_000966455.1|2417252_2418110_-	HTH-type transcriptional regulator MurR	NA	NA	NA	NA	NA
WP_001175604.1|2418273_2419170_+	N-acetylmuramic acid 6-phosphate etherase	NA	NA	NA	NA	NA
WP_001040498.1|2419173_2420598_+	PTS N-acetylmuramic acid transporter subunit IIBC	NA	NA	NA	NA	NA
WP_005017682.1|2422737_2423637_-	porphyrinogen peroxidase	NA	S4VVJ7	Pandoravirus	32.6	4.5e-26
WP_000838945.1|2423732_2424308_-	RpoE-regulated lipoprotein	NA	NA	NA	NA	NA
WP_024259408.1|2424368_2424818_-	DUF2919 domain-containing protein	NA	NA	NA	NA	NA
WP_000406000.1|2424804_2425230_-	GNAT family acetyltransferase	NA	NA	NA	NA	NA
WP_000102893.1|2425443_2426313_+	N-acetylmuramoyl-L-alanine amidase AmiA	NA	E5DV68	Deep-sea_thermophilic_phage	27.4	3.2e-13
WP_000801385.1|2426316_2427216_+	oxygen-dependent coproporphyrinogen oxidase	NA	NA	NA	NA	NA
WP_000753735.1|2427221_2428274_-	HTH-type transcriptional regulator EutR	NA	NA	NA	NA	NA
WP_001295463.1|2428319_2428820_-	ethanolamine utilization microcompartment protein EutK	NA	NA	NA	NA	NA
WP_001111025.1|2428832_2429492_-	ethanolamine utilization microcompartment protein EutL	NA	NA	NA	NA	NA
WP_000372372.1|2429501_2430389_-	ethanolamine ammonia-lyase subunit beta	NA	NA	NA	NA	NA
WP_134801689.1|2432252_2432947_-|transposase	IS1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	95.2	4.4e-130
WP_000342643.1|2433383_2435663_-	NADP-dependent oxaloacetate-decarboxylating malate dehydrogenase	NA	NA	NA	NA	NA
WP_134801557.1|2437902_2438597_-|transposase	IS1-like element IS1N family transposase	transposase	A0A0U2RK18	Escherichia_phage	95.7	2.6e-130
WP_001270535.1|2439778_2440846_-	DUF1176 domain-containing protein	NA	NA	NA	NA	NA
WP_001301627.1|2440971_2441547_-	GDP-mannose pyrophosphatase NudK	NA	NA	NA	NA	NA
WP_001078833.1|2441614_2443594_-	formate-dependent uric acid utilization protein AegA	NA	NA	NA	NA	NA
WP_134801577.1|2443625_2444320_-|transposase	IS1-like element IS1N family transposase	transposase	NA	NA	NA	NA
WP_001307936.1|2444573_2446274_+	nitrate/nitrite two-component system sensor histidine kinase NarQ	NA	NA	NA	NA	NA
WP_001273124.1|2446437_2449551_+	multidrug efflux RND transporter permease AcrD	NA	NA	NA	NA	NA
WP_001386977.1|2449649_2449709_-	protein YpfM	NA	NA	NA	NA	NA
WP_000258247.1|2450089_2450446_+	ArsC family reductase	NA	NA	NA	NA	NA
WP_001277808.1|2450449_2451577_+	succinyl-diaminopimelate desuccinylase	NA	NA	NA	NA	NA
WP_000383836.1|2451604_2451805_+	YpfN family protein	NA	NA	NA	NA	NA
WP_134801557.1|2452666_2453361_-|transposase	IS1-like element IS1N family transposase	transposase	A0A0U2RK18	Escherichia_phage	95.7	2.6e-130
>prophage 21
NC_007606	Shigella dysenteriae Sd197, complete sequence	4369232	2475731	2536710	4369232	tRNA,protease,transposase	Escherichia_phage(40.0%)	46	NA	NA
WP_000489648.1|2475731_2477195_+|protease	beta-barrel assembly-enhancing protease	protease	NA	NA	NA	NA
WP_000166449.1|2477215_2477575_+	arsenate reductase (glutaredoxin)	NA	NA	NA	NA	NA
WP_000248247.1|2477712_2478459_-	DnaA inactivator Hda	NA	NA	NA	NA	NA
WP_000198331.1|2478508_2479798_-	uracil permease	NA	Q9KX94	Enterobacteria_phage	37.1	1.1e-62
WP_001295473.1|2479883_2480510_-	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_005017486.1|2480835_2481873_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A1D7SE90	Cyanophage	43.3	1.1e-71
WP_001028628.1|2481872_2482511_+	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	42.9	3.1e-29
WP_000529580.1|2482681_2484748_+	polyphosphate kinase 1	NA	NA	NA	NA	NA
WP_001121358.1|2484752_2486294_+	exopolyphosphatase	NA	NA	NA	NA	NA
WP_134801689.1|2488580_2489275_-|transposase	IS1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	95.2	4.4e-130
WP_000017549.1|2490288_2490441_-	hypothetical protein	NA	G9L6F3	Escherichia_phage	94.0	4.9e-18
WP_000076001.1|2490458_2490650_+	DUF2633 family protein	NA	G9L6F2	Escherichia_phage	100.0	7.3e-27
WP_134801986.1|2491020_2491714_+|transposase	IS1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	94.8	2.9e-129
WP_011378838.1|2491734_2492265_+	glycine zipper 2TM domain-containing protein	NA	G9L6F1	Escherichia_phage	100.0	1.4e-56
WP_165442262.1|2492235_2493464_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.0	3.8e-177
WP_000755178.1|2493604_2494144_+	DUF5384 family protein	NA	G9L6F0	Escherichia_phage	98.9	1.4e-43
WP_000138271.1|2494236_2495814_-	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
WP_005017448.1|2495882_2497349_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	39.4	3.6e-89
WP_000937889.1|2497510_2498881_+	exodeoxyribonuclease VII large subunit	NA	A0A2H4UVM9	Bodo_saltans_virus	35.0	2.0e-41
WP_001300368.1|2498877_2499093_-	zinc ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_005017442.1|2499161_2500634_-	ribosome biogenesis GTPase Der	NA	NA	NA	NA	NA
WP_001177048.1|2500751_2501930_-	outer membrane protein assembly factor BamB	NA	NA	NA	NA	NA
WP_000409205.1|2501940_2502561_-	ancillary SecYEG translocon subunit YfgM	NA	NA	NA	NA	NA
WP_001107194.1|2502578_2503853_-|tRNA	histidine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_000556021.1|2503963_2505082_-	flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase	NA	NA	NA	NA	NA
WP_001090858.1|2505108_2506122_-	cytoskeleton protein RodZ	NA	NA	NA	NA	NA
WP_000003317.1|2506406_2507561_-|tRNA	bifunctional tRNA (adenosine(37)-C2)-methyltransferase TrmG/ribosomal RNA large subunit methyltransferase RlmN	tRNA	NA	NA	NA	NA
WP_000963837.1|2507710_2508142_-	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	37.9	3.7e-18
WP_000108651.1|2515770_2516616_+	3-mercaptopyruvate sulfurtransferase	NA	NA	NA	NA	NA
WP_001354817.1|2517762_2518539_-	enhanced serine sensitivity protein SseB	NA	NA	NA	NA	NA
WP_000133554.1|2518681_2519965_-	aminopeptidase PepB	NA	Q6GYZ8	Mycoplasma_phage	37.8	2.9e-34
WP_000523616.1|2520142_2520343_-	Fe-S cluster assembly protein IscX	NA	NA	NA	NA	NA
WP_001124474.1|2520354_2520690_-	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
WP_001196613.1|2520691_2522542_-	Fe-S protein assembly chaperone HscA	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	41.6	5.5e-103
WP_000384418.1|2522558_2523074_-	co-chaperone HscB	NA	NA	NA	NA	NA
WP_000028953.1|2523169_2523493_-	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	48.6	5.4e-22
WP_000331707.1|2523509_2523896_-	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	78.9	1.4e-53
WP_001295373.1|2523923_2525138_-	cysteine desulfurase	NA	A0A1X7C038	Faustovirus	31.8	8.8e-33
WP_001241357.1|2525249_2525738_-	Fe-S cluster assembly transcriptional regulator IscR	NA	NA	NA	NA	NA
WP_000940018.1|2526037_2526775_-|tRNA	tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ	tRNA	NA	NA	NA	NA
WP_000553453.1|2526893_2527697_+	inositol-1-monophosphatase	NA	NA	NA	NA	NA
WP_005017389.1|2527841_2528696_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000982995.1|2528886_2530167_+	stationary phase inducible protein CsiE	NA	NA	NA	NA	NA
WP_000244209.1|2530158_2531298_-	3-phenylpropionate MFS transporter	NA	NA	NA	NA	NA
WP_134801589.1|2531670_2532364_+|transposase	IS1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	94.8	1.7e-129
WP_087786203.1|2536015_2536710_-|transposase	IS1-like element IS1N family transposase	transposase	A0A0U2RK18	Escherichia_phage	95.2	4.4e-130
>prophage 22
NC_007606	Shigella dysenteriae Sd197, complete sequence	4369232	2551234	2611465	4369232	tRNA,transposase	Escherichia_phage(28.57%)	50	NA	NA
WP_001298403.1|2551234_2551771_-|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	NA	NA	NA	NA
WP_000190651.1|2551795_2552431_-	phosphatidylglycerophosphatase C	NA	NA	NA	NA	NA
WP_005017334.1|2552639_2553488_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005017326.1|2555308_2557135_+	invasion plasmid antigen	NA	NA	NA	NA	NA
WP_171554045.1|2557294_2558451_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.7	1.4e-67
WP_134801557.1|2561098_2561792_+|transposase	IS1-like element IS1N family transposase	transposase	A0A0U2RK18	Escherichia_phage	95.7	2.6e-130
WP_005017277.1|2561767_2562136_-	DUF2799 domain-containing protein	NA	NA	NA	NA	NA
WP_001168045.1|2563122_2564193_+	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.2	4.0e-90
WP_000225197.1|2564203_2565325_+	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_000200092.1|2565367_2566528_-	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_000178456.1|2566778_2567120_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_094096554.1|2569221_2570377_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.7	1.4e-67
WP_001181754.1|2570451_2571057_+	DUF2612 domain-containing protein	NA	A0A2R3UAM9	Myoviridae_environmental_samples	37.4	2.7e-30
WP_134801557.1|2573129_2573824_-|transposase	IS1-like element IS1N family transposase	transposase	A0A0U2RK18	Escherichia_phage	95.7	2.6e-130
WP_000065253.1|2575806_2576154_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_000264777.1|2576195_2576963_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_000043335.1|2576993_2577542_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_000256450.1|2577560_2577809_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_000460041.1|2577945_2579307_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_001338897.1|2579473_2580265_+	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_078164533.1|2580285_2581572_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001296310.1|2581626_2582220_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_001059174.1|2582342_2583221_+	NAD(+) kinase	NA	NA	NA	NA	NA
WP_000880906.1|2583306_2584968_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001203437.1|2585116_2585458_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_001117839.1|2585519_2585810_-	RnfH family protein	NA	NA	NA	NA	NA
WP_000600190.1|2585799_2586276_-	type II toxin-antitoxin system toxin RatA	NA	NA	NA	NA	NA
WP_000162574.1|2586407_2586890_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
WP_134801557.1|2590093_2590787_+|transposase	IS1-like element IS1N family transposase	transposase	A0A0U2RK18	Escherichia_phage	95.7	2.6e-130
WP_001291430.1|2591919_2592120_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000054753.1|2593727_2593988_+	4Fe-4S dicluster ferredoxin YfhL	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	53.5	3.8e-18
WP_000128773.1|2594182_2594263_-	type I toxin-antitoxin system toxin ShoB	NA	NA	NA	NA	NA
WP_134801557.1|2594467_2595162_-|transposase	IS1-like element IS1N family transposase	transposase	A0A0U2RK18	Escherichia_phage	95.7	2.6e-130
WP_000986037.1|2595457_2595838_-	holo-ACP synthase	NA	NA	NA	NA	NA
WP_005017178.1|2595837_2596569_-	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_000399404.1|2596580_2597309_-	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_000020733.1|2597320_2598226_-	GTPase Era	NA	NA	NA	NA	NA
WP_001068343.1|2598222_2598903_-	ribonuclease III	NA	A0A2P0VNZ5	Tetraselmis_virus	39.6	5.6e-21
WP_000002535.1|2599175_2600150_-	signal peptidase I	NA	NA	NA	NA	NA
WP_000790175.1|2600165_2601965_-	elongation factor 4	NA	A0A2K9L6L3	Tupanvirus	41.9	4.2e-23
WP_000589063.1|2602162_2602642_-	SoxR-reducing system protein RseC	NA	NA	NA	NA	NA
WP_000812053.1|2602638_2603595_-	sigma-E factor regulatory protein RseB	NA	NA	NA	NA	NA
WP_001168459.1|2603594_2604245_-	anti-sigma-E factor RseA	NA	NA	NA	NA	NA
WP_001295364.1|2604277_2604853_-	RNA polymerase sigma factor RpoE	NA	NA	NA	NA	NA
WP_001303621.1|2604849_2605005_-	rpoE leader peptide RseD	NA	NA	NA	NA	NA
WP_001094490.1|2605260_2606883_+	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_005017152.1|2606867_2607605_-|tRNA	tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase TrmN	tRNA	NA	NA	NA	NA
WP_000219209.1|2607736_2609071_+	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	30.8	1.4e-44
WP_005017147.1|2609103_2609985_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_094096554.1|2610309_2611465_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.7	1.4e-67
>prophage 23
NC_007606	Shigella dysenteriae Sd197, complete sequence	4369232	2710641	2760452	4369232	tRNA,transposase	Acinetobacter_phage(14.29%)	41	NA	NA
WP_134802098.1|2710641_2711798_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.4	4.2e-69
WP_000455153.1|2711866_2712172_+	formate hydrogenlyase	NA	NA	NA	NA	NA
WP_005019630.1|2712216_2712645_+	TOBE domain-containing protein	NA	NA	NA	NA	NA
WP_000015494.1|2712683_2713028_-	nitrous oxide-stimulated promoter family protein	NA	NA	NA	NA	NA
WP_000611927.1|2713104_2713239_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001272908.1|2713314_2715876_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.4	1.7e-30
WP_000562994.1|2716733_2716970_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000767723.1|2718406_2719000_-	UbiX family flavin prenyltransferase	NA	NA	NA	NA	NA
WP_001208063.1|2719146_2719554_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000081545.1|2719673_2720666_-	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.3	3.9e-31
WP_001272592.1|2720728_2721868_-	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	1.7e-06
WP_000254708.1|2722007_2722634_-	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.7	5.7e-36
WP_005019613.1|2722627_2723389_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	52.8	5.3e-68
WP_000568924.1|2723369_2724419_-|tRNA	tRNA pseudouridine(13) synthase TruD	tRNA	NA	NA	NA	NA
WP_001219242.1|2724415_2724895_-	2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase	NA	NA	NA	NA	NA
WP_000246138.1|2724894_2725605_-	2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000517476.1|2725623_2725935_-	cell division protein FtsB	NA	NA	NA	NA	NA
WP_001246104.1|2726128_2726452_-	DUF3561 family protein	NA	NA	NA	NA	NA
WP_001173673.1|2726501_2727107_-	adenylyl-sulfate kinase	NA	A0A2K9L4R9	Tupanvirus	38.1	4.2e-28
WP_001090340.1|2727106_2728534_-	sulfate adenylyltransferase subunit CysN	NA	A0A1V0SGC3	Hokovirus	31.4	1.6e-30
WP_000372107.1|2728535_2729444_-	sulfate adenylyltransferase subunit CysD	NA	NA	NA	NA	NA
WP_000490453.1|2729696_2730734_+	alkaline phosphatase isozyme conversion aminopeptidase	NA	NA	NA	NA	NA
WP_011378852.1|2731132_2731417_-	type I-E CRISPR-associated endoribonuclease Cas2	NA	NA	NA	NA	NA
WP_000281401.1|2732351_2732951_-	type I-E CRISPR-associated protein Cas6/Cse3/CasE	NA	NA	NA	NA	NA
WP_000039858.1|2737232_2737967_-	phosphoadenosine phosphosulfate reductase	NA	NA	NA	NA	NA
WP_001290733.1|2738040_2739753_-	assimilatory sulfite reductase (NADPH) hemoprotein subunit	NA	NA	NA	NA	NA
WP_000211931.1|2739752_2741552_-	NADPH-dependent assimilatory sulfite reductase flavoprotein subunit	NA	NA	NA	NA	NA
WP_000108292.1|2741870_2742233_+	6-carboxytetrahydropterin synthase QueD	NA	NA	NA	NA	NA
WP_005019594.1|2742310_2743582_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_000109535.1|2743572_2743833_+	ferredoxin family protein	NA	NA	NA	NA	NA
WP_001116197.1|2743849_2744425_+	glycerol-3-phosphate responsive antiterminator	NA	NA	NA	NA	NA
WP_000971928.1|2746186_2747596_-	MFS transporter	NA	NA	NA	NA	NA
WP_000059303.1|2747698_2749072_-	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_134801557.1|2749114_2749809_-|transposase	IS1-like element IS1N family transposase	transposase	A0A0U2RK18	Escherichia_phage	95.7	2.6e-130
WP_000021348.1|2749915_2750701_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.5	1.9e-20
WP_000039732.1|2752321_2753800_+	kinase	NA	NA	NA	NA	NA
WP_165442258.1|2753972_2755201_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.0	6.5e-177
WP_001199973.1|2755548_2756220_-	7-carboxy-7-deazaguanine synthase QueE	NA	A0A2I7S8X1	Vibrio_phage	25.0	1.7e-14
WP_134801567.1|2756463_2757157_+|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
WP_087786203.1|2757726_2758421_-|transposase	IS1-like element IS1N family transposase	transposase	A0A0U2RK18	Escherichia_phage	95.2	4.4e-130
WP_094081558.1|2759295_2760452_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.7	8.9e-67
>prophage 24
NC_007606	Shigella dysenteriae Sd197, complete sequence	4369232	2867020	2928528	4369232	tRNA,protease,transposase	Staphylococcus_phage(33.33%)	60	NA	NA
WP_134801567.1|2867020_2867715_-|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
WP_000135089.1|2867865_2868825_+	type II secretion system protein GspC	NA	NA	NA	NA	NA
WP_000498818.1|2868854_2870900_+	type II secretion system secretin GspD	NA	NA	NA	NA	NA
WP_000249362.1|2870899_2872393_+	type II secretion system ATPase GspE	NA	NA	NA	NA	NA
WP_001173470.1|2872392_2873592_+	type II secretion system inner membrane protein GspF	NA	NA	NA	NA	NA
WP_001087302.1|2873632_2874088_+	type II secretion system major pseudopilin GspG	NA	NA	NA	NA	NA
WP_001115126.1|2874091_2874655_+	type II secretion system minor pseudopilin GspH	NA	NA	NA	NA	NA
WP_000820136.1|2874651_2875023_+	type II secretion system minor pseudopilin GspI	NA	NA	NA	NA	NA
WP_001250462.1|2875019_2875625_+	type II secretion system minor pseudopilin GspJ	NA	NA	NA	NA	NA
WP_000633233.1|2875621_2876599_+	type II secretion system minor pseudopilin GspK	NA	NA	NA	NA	NA
WP_000097229.1|2876595_2877774_+	type II secretion system protein GspL	NA	NA	NA	NA	NA
WP_000839556.1|2880515_2882651_+	ornithine decarboxylase	NA	NA	NA	NA	NA
WP_001049792.1|2882700_2883957_-	nucleoside permease NupG	NA	NA	NA	NA	NA
WP_024259418.1|2884158_2885238_-	membrane-bound lytic murein transglycosylase MltC	NA	NA	NA	NA	NA
WP_000091700.1|2885302_2885578_-	oxidative damage protection protein	NA	NA	NA	NA	NA
WP_005018290.1|2885605_2886658_-	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_000786904.1|2886818_2887538_+|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_001107564.1|2887537_2887864_+	YggL family protein	NA	NA	NA	NA	NA
WP_000984796.1|2888047_2888767_+	DUF2884 domain-containing protein	NA	NA	NA	NA	NA
WP_000394107.1|2888942_2889989_+	L-asparaginase 2	NA	NA	NA	NA	NA
WP_000737723.1|2890105_2891113_+	DUF1202 family protein	NA	NA	NA	NA	NA
WP_000239935.1|2891264_2892401_-	radical SAM family heme chaperone HemW	NA	NA	NA	NA	NA
WP_001174741.1|2892393_2892987_-	XTP/dITP diphosphatase	NA	NA	NA	NA	NA
WP_001277216.1|2892994_2893285_-	YggU family protein	NA	NA	NA	NA	NA
WP_001094831.1|2893281_2893848_-	osmotic shock tolerance protein YggT	NA	NA	NA	NA	NA
WP_000997795.1|2893865_2894570_-	pyridoxal phosphate homeostasis protein	NA	NA	NA	NA	NA
WP_078164563.1|2894587_2895568_+	type IV pilus twitching motility protein PilT	NA	NA	NA	NA	NA
WP_000017103.1|2895756_2896173_-	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_001053178.1|2896172_2896736_-	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_000593287.1|2896844_2897795_-	glutathione synthase	NA	NA	NA	NA	NA
WP_005018319.1|2897807_2898539_-	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_000286506.1|2898618_2899326_-	deoxyribonuclease I	NA	NA	NA	NA	NA
WP_000858391.1|2899420_2899918_-|protease	SprT family zinc-dependent metalloprotease	protease	NA	NA	NA	NA
WP_001112301.1|2899994_2901389_-	galactose/proton symporter	NA	NA	NA	NA	NA
WP_001062128.1|2901825_2902980_-	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	63.2	4.0e-128
WP_011378864.1|2903283_2903499_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001297406.1|2903634_2903766_+	acid stress response protein YqgB	NA	NA	NA	NA	NA
WP_001295380.1|2903774_2905751_+	biosynthetic arginine decarboxylase	NA	NA	NA	NA	NA
WP_000758919.1|2905896_2906169_+	hypothetical protein	NA	NA	NA	NA	NA
WP_134801788.1|2906208_2906902_+|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
WP_000105567.1|2907544_2908465_+	agmatinase	NA	NA	NA	NA	NA
WP_000701840.1|2908512_2909271_-|protease	metalloprotease LoiP	protease	NA	NA	NA	NA
WP_000098596.1|2909548_2911540_+	transketolase	NA	NA	NA	NA	NA
WP_134802105.1|2911855_2912550_-|transposase	IS1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	94.8	6.4e-129
WP_001239656.1|2912627_2913071_+	PTS mannitol transporter subunit IIA	NA	NA	NA	NA	NA
WP_000428788.1|2913098_2914487_+	PTS mannitol transporter subunit IICB	NA	NA	NA	NA	NA
WP_000853237.1|2914501_2915779_+	zinc-binding dehydrogenase	NA	NA	NA	NA	NA
WP_000224152.1|2916762_2917272_+	fumarase E	NA	NA	NA	NA	NA
WP_000687772.1|2917268_2917982_+	nucleoside/nucleotide kinase family protein	NA	NA	NA	NA	NA
WP_000956896.1|2917953_2918631_-	sulfate/molybdate ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	25.6	6.4e-09
WP_000283196.1|2919289_2919997_-	energy-coupling factor transporter transmembrane protein EcfT	NA	NA	NA	NA	NA
WP_000124305.1|2919997_2920576_-	ECF transporter S component	NA	NA	NA	NA	NA
WP_000988700.1|2920598_2921030_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_000218474.1|2921401_2922421_+	erythrose-4-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_005018348.1|2922470_2923634_+	phosphoglycerate kinase	NA	NA	NA	NA	NA
WP_000034372.1|2923848_2924928_+	class II fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_000389825.1|2925118_2925979_+	small-conductance mechanosensitive channel MscS	NA	NA	NA	NA	NA
WP_000493346.1|2926117_2926753_+	arginine exporter ArgO	NA	NA	NA	NA	NA
WP_000669834.1|2926845_2927586_+	oxidative stress defense protein	NA	NA	NA	NA	NA
WP_134801567.1|2927834_2928528_+|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
>prophage 25
NC_007606	Shigella dysenteriae Sd197, complete sequence	4369232	2958868	3037289	4369232	tRNA,transposase	Escherichia_phage(17.65%)	60	NA	NA
WP_000003082.1|2958868_2960386_+|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.9	9.1e-88
WP_001192818.1|2960428_2960977_-	isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
WP_120795390.1|2961031_2961103_+	protein YqfH	NA	NA	NA	NA	NA
WP_134801577.1|2963432_2964126_+|transposase	IS1-like element IS1N family transposase	transposase	NA	NA	NA	NA
WP_005018485.1|2964215_2964989_-	zinc transporter ZupT	NA	NA	NA	NA	NA
WP_000442866.1|2965957_2967118_-	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	42.9	4.5e-87
WP_000831535.1|2967123_2967795_-	DUF1190 family protein	NA	A0A173GEW8	Erwinia_phage	44.3	4.8e-33
WP_000735268.1|2967942_2969424_-	outer membrane channel protein TolC	NA	NA	NA	NA	NA
WP_000917117.1|2969628_2970258_+	ADP-ribose diphosphatase	NA	A0A1S6L1P8	Vibrio_phage	32.5	9.2e-18
WP_000833389.1|2970258_2970681_+	DUF1249 family protein	NA	NA	NA	NA	NA
WP_000444747.1|2970705_2971533_+	3',5'-cyclic-AMP phosphodiesterase	NA	NA	NA	NA	NA
WP_000105733.1|2971532_2972114_+	esterase YqiA	NA	NA	NA	NA	NA
WP_000195274.1|2972142_2974035_+	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	35.2	2.6e-92
WP_000958585.1|2974082_2974397_-	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_000065426.1|2974427_2975009_-	NADPH:quinone oxidoreductase MdaB	NA	NA	NA	NA	NA
WP_000673359.1|2975118_2976468_-	two-component system sensor histidine kinase QseC	NA	NA	NA	NA	NA
WP_001221504.1|2976464_2977124_-	two-component system response regulator QseB	NA	NA	NA	NA	NA
WP_000712658.1|2977275_2977668_+	OB fold stress tolerance protein YgiW	NA	A0A1I9LJU6	Stx_converting_phage	49.1	9.4e-21
WP_000183496.1|2977720_2978203_+	GyrI-like domain-containing protein	NA	NA	NA	NA	NA
WP_011378868.1|2978311_2979919_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001281874.1|2980056_2982315_+	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	35.1	3.1e-84
WP_000965721.1|2982548_2983286_+	1-acylglycerol-3-phosphate O-acyltransferase	NA	NA	NA	NA	NA
WP_000059377.1|2983360_2984773_+	cell division protein FtsP	NA	NA	NA	NA	NA
WP_000848536.1|2987146_2987404_-	lipoprotein YqhH	NA	NA	NA	NA	NA
WP_001076997.1|2989127_2989781_-	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	44.3	4.9e-46
WP_005018535.1|2990154_2990454_+	accessory factor UbiK family protein	NA	NA	NA	NA	NA
WP_000401250.1|2990488_2990689_-	cell surface composition regulator GlgS	NA	NA	NA	NA	NA
WP_134801557.1|2990705_2991400_-|transposase	IS1-like element IS1N family transposase	transposase	A0A0U2RK18	Escherichia_phage	95.7	2.6e-130
WP_134801567.1|2992528_2993222_+|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
WP_001387081.1|2994880_2994940_+	type I toxin-antitoxin system Ibs family toxin	NA	NA	NA	NA	NA
WP_010723221.1|2995256_2995316_+	type I toxin-antitoxin system toxin IbsE	NA	NA	NA	NA	NA
WP_000869201.1|2995435_2996869_-	bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE	NA	A0A1B1IUK5	uncultured_Mediterranean_phage	29.6	5.1e-40
WP_011378869.1|2996916_2999757_-	bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase	NA	NA	NA	NA	NA
WP_000046284.1|2999779_3001081_-	inorganic triphosphatase	NA	NA	NA	NA	NA
WP_001125325.1|3001322_3001943_+	SH3 domain-containing protein	NA	NA	NA	NA	NA
WP_000708467.1|3002006_3003245_+|tRNA	fused tRNA nucleotidyltransferase/2',3'-cyclic phosphodiesterase/2' nucleotidase/phosphatase Cca	tRNA	A0A0F6YPT7	Sinorhizobium_phage	51.9	5.9e-93
WP_001295541.1|3004318_3004687_-	bifunctional dihydroneopterin aldolase/7,8-dihydroneopterin epimerase	NA	NA	NA	NA	NA
WP_001272796.1|3004791_3005409_+	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
WP_134802110.1|3006080_3006774_+|transposase	IS1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	94.4	8.3e-129
WP_001038236.1|3006794_3007172_+	fumarate hydratase	NA	NA	NA	NA	NA
WP_000897013.1|3007214_3007676_+	fumarate hydratase	NA	NA	NA	NA	NA
WP_000804907.1|3008326_3009790_+	L-tartrate/succinate antiporter	NA	NA	NA	NA	NA
WP_001264352.1|3009832_3010846_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	59.2	6.3e-109
WP_001144069.1|3011083_3011299_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_000918829.1|3011410_3013156_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.4	1.1e-76
WP_000437383.1|3013350_3015192_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.3e-35
WP_000228931.1|3015270_3015777_-	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
WP_001065880.1|3016030_3016795_-	NADPH-dependent ferric chelate reductase	NA	NA	NA	NA	NA
WP_000017998.1|3017082_3017706_+	DNA-binding transcriptional regulator NfeR	NA	NA	NA	NA	NA
WP_000094663.1|3017812_3019333_-	aerotaxis sensor receptor Aer	NA	A0A1B0V854	Salmonella_phage	50.0	7.6e-34
WP_000450585.1|3021171_3021504_-|tRNA	tRNA-binding protein	tRNA	NA	NA	NA	NA
WP_000212445.1|3021722_3022706_+	transcriptional regulator EbgR	NA	NA	NA	NA	NA
WP_134801567.1|3025538_3026233_-|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
WP_000695521.1|3027513_3029865_+	alpha-glucosidase	NA	NA	NA	NA	NA
WP_000609075.1|3030249_3031689_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000121488.1|3031992_3034011_+	NADPH-dependent 2,4-dienoyl-CoA reductase	NA	NA	NA	NA	NA
WP_000560259.1|3034055_3034472_-	type II toxin-antitoxin system antitoxin HigA	NA	NA	NA	NA	NA
WP_000018683.1|3034741_3035878_-	23S rRNA (guanine(1835)-N(2))-methyltransferase RlmG	NA	NA	NA	NA	NA
WP_001295542.1|3035962_3036466_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_134802034.1|3036595_3037289_+|transposase	IS1-like element IS1N family transposase	transposase	A0A0U2RK18	Escherichia_phage	95.2	1.3e-129
>prophage 26
NC_007606	Shigella dysenteriae Sd197, complete sequence	4369232	3361213	3434999	4369232	tRNA,protease,transposase	Escherichia_phage(27.27%)	60	NA	NA
WP_134801557.1|3361213_3361907_+|transposase	IS1-like element IS1N family transposase	transposase	A0A0U2RK18	Escherichia_phage	95.7	2.6e-130
WP_000198477.1|3363130_3364360_+	beta-ketoacyl-ACP synthase	NA	NA	NA	NA	NA
WP_000285785.1|3364361_3364949_+	4'-phosphopantetheinyl transferase AcpT	NA	NA	NA	NA	NA
WP_000953378.1|3365059_3366634_+	nickel ABC transporter, nickel/metallophore periplasmic binding protein	NA	NA	NA	NA	NA
WP_000947084.1|3366633_3367578_+	nickel ABC transporter permease subunit NikB	NA	NA	NA	NA	NA
WP_001008803.1|3367574_3368408_+	nickel ABC transporter permease subunit NikC	NA	NA	NA	NA	NA
WP_001136199.1|3368407_3369172_+	nickel import ATP-binding protein NikD	NA	NA	NA	NA	NA
WP_000173685.1|3369168_3369975_+	nickel import ATP-binding protein NikE	NA	G3M9Y6	Bacillus_virus	29.1	1.5e-17
WP_001190062.1|3369980_3370382_+	nickel-responsive transcriptional regulator NikR	NA	NA	NA	NA	NA
WP_134801618.1|3370871_3371565_+|transposase	IS1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	94.8	9.8e-130
WP_164925032.1|3372021_3372716_-|transposase	IS1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	94.8	3.7e-129
WP_134801851.1|3372695_3372875_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001161552.1|3372899_3373373_+	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_000084022.1|3373369_3373651_+	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_051394730.1|3374926_3375532_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000448119.1|3377118_3378624_-	glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_000371932.1|3378813_3379140_+	thiosulfate sulfurtransferase GlpE	NA	NA	NA	NA	NA
WP_000928722.1|3379184_3380015_+|protease	rhomboid family intramembrane serine protease GlpG	protease	NA	NA	NA	NA
WP_000815099.1|3380031_3380790_+	DeoR/GlpR family transcriptional regulator	NA	NA	NA	NA	NA
WP_024259430.1|3381784_3382813_+	RNA 3'-terminal phosphate cyclase	NA	NA	NA	NA	NA
WP_000513068.1|3382862_3383348_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000801913.1|3383338_3383617_-	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_000907050.1|3383683_3386383_-	HTH-type transcriptional regulator MalT	NA	NA	NA	NA	NA
WP_000081869.1|3386994_3389388_+	maltodextrin phosphorylase	NA	Q8B3H5	Iris_mild_mosaic_virus	42.5	4.3e-15
WP_000444321.1|3389397_3391482_+	4-alpha-glucanotransferase	NA	NA	NA	NA	NA
WP_001131760.1|3391526_3392843_-	gluconate transporter	NA	NA	NA	NA	NA
WP_000619389.1|3393203_3393779_-	Fe-S biogenesis protein NfuA	NA	NA	NA	NA	NA
WP_001060094.1|3394544_3395315_+	pimeloyl-ACP methyl ester esterase BioH	NA	NA	NA	NA	NA
WP_000039052.1|3395341_3396220_-	recombination-promoting nuclease RpnA	NA	Q2A0A7	Sodalis_phage	52.4	9.4e-69
WP_000157586.1|3396422_3396659_-	[Fe-S]-dependent transcriptional repressor FeoC	NA	NA	NA	NA	NA
WP_000737013.1|3396658_3398980_-	Fe(2+) transporter permease subunit FeoB	NA	NA	NA	NA	NA
WP_001200455.1|3398996_3399224_-	ferrous iron transporter A	NA	NA	NA	NA	NA
WP_000980741.1|3399680_3402002_-	RNA-binding transcriptional accessory protein	NA	NA	NA	NA	NA
WP_000856744.1|3402098_3402575_-	transcription elongation factor GreB	NA	NA	NA	NA	NA
WP_001157751.1|3402802_3403522_+	two-component system response regulator OmpR	NA	W8CYM9	Bacillus_phage	34.7	3.5e-29
WP_001253696.1|3403518_3404871_+	two-component system sensor histidine kinase EnvZ	NA	W8CYF6	Bacillus_phage	23.8	3.6e-11
WP_001265675.1|3404946_3406569_-	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	52.3	4.5e-141
WP_000370792.1|3406948_3408673_+	DUF4153 domain-containing protein	NA	NA	NA	NA	NA
WP_001135574.1|3409508_3410387_-	Hsp33 family molecular chaperone HslO	NA	NA	NA	NA	NA
WP_000660483.1|3410411_3410813_-	ribosome-associated heat shock protein Hsp15	NA	NA	NA	NA	NA
WP_001295168.1|3410823_3411492_-	GMP/IMP nucleotidase	NA	NA	NA	NA	NA
WP_000104529.1|3411556_3413692_-	intracellular growth attenuator protein IgaA	NA	NA	NA	NA	NA
WP_000045740.1|3414011_3414572_+	ADP compounds hydrolase NudE	NA	NA	NA	NA	NA
WP_011378896.1|3414736_3417289_-	peptidoglycan glycosyltransferase/peptidoglycan DD-transpeptidase MrcA	NA	NA	NA	NA	NA
WP_001069301.1|3418187_3418727_+	DNA utilization protein HofN	NA	NA	NA	NA	NA
WP_001264141.1|3419139_3419544_+	DNA utilization protein HofP	NA	NA	NA	NA	NA
WP_000818618.1|3421094_3421616_+	shikimate kinase AroK	NA	NA	NA	NA	NA
WP_000439843.1|3421672_3422761_+	3-dehydroquinate synthase	NA	NA	NA	NA	NA
WP_000343165.1|3422852_3424130_+	cell division protein DamX	NA	NA	NA	NA	NA
WP_000742144.1|3424236_3425073_+	adenine-specific DNA-methyltransferase	NA	A0A1S6L1V5	Vibrio_phage	49.1	8.4e-67
WP_000816270.1|3425090_3425768_+	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_001031704.1|3425760_3426519_+	phosphoglycolate phosphatase	NA	NA	NA	NA	NA
WP_000165543.1|3426511_3427516_+|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_001254833.1|3427783_3428689_+	hypothetical protein	NA	NA	NA	NA	NA
WP_165442258.1|3428846_3430074_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.0	6.5e-177
WP_000016359.1|3430059_3430404_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000090626.1|3431651_3432878_+	phosphopentomutase	NA	NA	NA	NA	NA
WP_000006973.1|3432874_3433753_+	phosphotriesterase-related protein	NA	NA	NA	NA	NA
WP_000366839.1|3434127_3434295_+	hypothetical protein	NA	NA	NA	NA	NA
WP_134801567.1|3434304_3434999_-|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
>prophage 27
NC_007606	Shigella dysenteriae Sd197, complete sequence	4369232	3535058	3579346	4369232	protease,transposase	Escherichia_phage(36.36%)	39	NA	NA
WP_134801584.1|3535058_3535752_+|transposase	IS1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	94.8	2.9e-129
WP_000014997.1|3535727_3539369_-	RHS domain-containing protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	31.9	5.3e-25
WP_000710769.1|3539528_3539741_-	50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_005015808.1|3539943_3542142_+	primosomal protein N'	NA	NA	NA	NA	NA
WP_000644910.1|3542297_3543323_+	DNA-binding transcriptional regulator CytR	NA	NA	NA	NA	NA
WP_000068837.1|3543414_3544374_+	cell division protein FtsN	NA	NA	NA	NA	NA
WP_000208242.1|3544466_3544997_+|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_001293350.1|3545006_3546338_+	HslU--HslV peptidase ATPase subunit	NA	A0A191ZC11	Erwinia_phage	29.7	1.1e-44
WP_005015798.1|3546404_3547331_+	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_000872906.1|3547423_3547909_+	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_087786203.1|3547965_3548660_-|transposase	IS1-like element IS1N family transposase	transposase	A0A0U2RK18	Escherichia_phage	95.2	4.4e-130
WP_171554046.1|3550321_3551477_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.7	8.9e-67
WP_001296623.1|3551840_3552086_-	septal ring assembly protein ZapB	NA	NA	NA	NA	NA
WP_000084263.1|3552511_3553357_+	glycerol uptake facilitator protein GlpF	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.0	3.4e-15
WP_000136815.1|3553379_3554888_+	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_001250644.1|3555117_3556128_+	class II fructose-bisphosphatase	NA	NA	NA	NA	NA
WP_000796320.1|3556224_3556971_+	ferredoxin--NADP(+) reductase	NA	NA	NA	NA	NA
WP_000323555.1|3556975_3557404_-	universal stress protein UspD	NA	NA	NA	NA	NA
WP_000655985.1|3557406_3557730_-	DUF406 domain-containing protein	NA	NA	NA	NA	NA
WP_087786203.1|3557990_3558685_-|transposase	IS1-like element IS1N family transposase	transposase	A0A0U2RK18	Escherichia_phage	95.2	4.4e-130
WP_000155256.1|3558724_3559156_-	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_000765796.1|3559256_3559856_+	YiiQ family protein	NA	NA	NA	NA	NA
WP_001216325.1|3559963_3560731_+	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_001045704.1|3562424_3563414_-	sulfate/thiosulfate ABC transporter substrate-binding protein Sbp	NA	NA	NA	NA	NA
WP_000591795.1|3563732_3564695_-	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_001076742.1|3564875_3565778_-	CDF family cation-efflux transporter FieF	NA	NA	NA	NA	NA
WP_001223800.1|3565925_3566426_-	cell-envelope stress modulator CpxP	NA	NA	NA	NA	NA
WP_001033722.1|3566575_3567274_+	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	5.3e-06
WP_000580430.1|3567270_3568644_+	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	26.2	3.8e-16
WP_001270267.1|3568711_3569386_-	6-N-hydroxylaminopurine resistance protein	NA	NA	NA	NA	NA
WP_001166052.1|3569534_3570521_-	2-keto-3-deoxygluconate transporter	NA	NA	NA	NA	NA
WP_005015733.1|3570780_3571401_-	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	59.3	1.4e-63
WP_000063521.1|3571685_3572720_+	L-rhamnose/proton symporter RhaT	NA	NA	NA	NA	NA
WP_011378912.1|3572716_3573655_-	HTH-type transcriptional activator RhaR	NA	NA	NA	NA	NA
WP_000217372.1|3573638_3574475_-	HTH-type transcriptional activator RhaS	NA	NA	NA	NA	NA
WP_000144061.1|3574762_3575926_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001179718.1|3577180_3578005_+	rhamnulose-1-phosphate aldolase	NA	NA	NA	NA	NA
WP_000619496.1|3578014_3578329_+	L-rhamnose mutarotase	NA	NA	NA	NA	NA
WP_134801612.1|3578708_3579346_-|transposase	IS1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	95.3	5.5e-119
>prophage 28
NC_007606	Shigella dysenteriae Sd197, complete sequence	4369232	3869066	4012035	4369232	tRNA,protease,transposase	Escherichia_phage(29.41%)	115	NA	NA
WP_164925033.1|3869066_3869761_-|transposase	IS1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	94.8	9.8e-130
WP_128636704.1|3869813_3870653_-	Ig-like domain-containing protein	NA	NA	NA	NA	NA
WP_005016589.1|3870706_3872221_-	inverse autotransporter beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_001288543.1|3873879_3875064_-	purine ribonucleoside efflux pump NepI	NA	NA	NA	NA	NA
WP_001521686.1|3875297_3875651_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000125645.1|3875634_3875958_+	DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_001295241.1|3876072_3876525_-	DUF1198 domain-containing protein	NA	NA	NA	NA	NA
WP_001065727.1|3878057_3879812_+	adenine deaminase	NA	NA	NA	NA	NA
WP_000879203.1|3879855_3881247_-	hexose-6-phosphate:phosphate antiporter	NA	NA	NA	NA	NA
WP_005016534.1|3881384_3882704_-	MFS transporter family glucose-6-phosphate receptor UhpC	NA	NA	NA	NA	NA
WP_023602230.1|3882713_3884216_-	signal transduction histidine-protein kinase/phosphatase UhpB	NA	NA	NA	NA	NA
WP_005016525.1|3884215_3884806_-	transcriptional regulator UhpA	NA	NA	NA	NA	NA
WP_164925034.1|3886742_3887437_-|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
WP_001181707.1|3888602_3888893_-	acetolactate synthase small subunit	NA	NA	NA	NA	NA
WP_000168506.1|3888896_3890585_-	acetolactate synthase large subunit	NA	E5EQ70	Micromonas_sp._RCC1109_virus	29.6	1.6e-56
WP_001312198.1|3890690_3890789_-	ilvB operon leader peptide IvbL	NA	NA	NA	NA	NA
WP_000060506.1|3891353_3891443_+	type I toxin-antitoxin system toxin TisB	NA	NA	NA	NA	NA
WP_024259386.1|3891722_3892907_+	multidrug efflux MFS transporter EmrD	NA	S4TR35	Salmonella_phage	23.5	8.9e-14
WP_000148047.1|3892914_3893412_-	radical SAM protein	NA	NA	NA	NA	NA
WP_001113428.1|3893408_3893771_-	DUF202 domain-containing protein	NA	NA	NA	NA	NA
WP_000703959.1|3893760_3894108_-	YidH family protein	NA	NA	NA	NA	NA
WP_000511303.1|3894217_3894667_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000828469.1|3894713_3896207_-	sulfatase-like hydrolase/transferase	NA	A0A2K9L1A5	Tupanvirus	25.2	8.6e-30
WP_087786203.1|3899434_3900128_+|transposase	IS1-like element IS1N family transposase	transposase	A0A0U2RK18	Escherichia_phage	95.2	4.4e-130
WP_000160093.1|3900526_3901849_-	6-phospho-alpha-glucosidase	NA	NA	NA	NA	NA
WP_001300779.1|3903760_3904477_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001279745.1|3904473_3906135_-	putative transporter	NA	NA	NA	NA	NA
WP_001243431.1|3906330_3906759_-	heat shock chaperone IbpB	NA	A0A1D8KPX5	Synechococcus_phage	36.4	2.1e-13
WP_001243437.1|3906870_3907284_-	heat shock chaperone IbpA	NA	A0A1D7SU06	Cyanophage	36.2	1.0e-17
WP_011378939.1|3907589_3907922_+	YceK/YidQ family lipoprotein	NA	NA	NA	NA	NA
WP_078164559.1|3907923_3909165_-	DUF3748 domain-containing protein	NA	NA	NA	NA	NA
WP_000399738.1|3909232_3910297_+	colicin M resistance protein	NA	NA	NA	NA	NA
WP_005016479.1|3911811_3911973_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000985557.1|3912018_3912831_-	sugar-phosphatase	NA	NA	NA	NA	NA
WP_000522209.1|3912945_3913344_-	YidB family protein	NA	NA	NA	NA	NA
WP_000072072.1|3913583_3915998_-	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	34.6	3.7e-115
WP_000060093.1|3916026_3917100_-	DNA replication/repair protein RecF	NA	NA	NA	NA	NA
WP_000673464.1|3917099_3918200_-	DNA polymerase III subunit beta	NA	B4UTW9	Rhizobium_phage	35.0	4.1e-53
WP_000059101.1|3918204_3919608_-	chromosomal replication initiator protein DnaA	NA	NA	NA	NA	NA
WP_122134670.1|3919904_3919985_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000831330.1|3920214_3920355_+	50S ribosomal protein L34	NA	NA	NA	NA	NA
WP_000239730.1|3920371_3920731_+	ribonuclease P protein component	NA	NA	NA	NA	NA
WP_001307474.1|3920694_3920952_+	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	56.7	5.4e-17
WP_000378254.1|3920954_3922601_+	membrane protein insertase YidC	NA	NA	NA	NA	NA
WP_001282344.1|3922706_3924071_+|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE	tRNA	NA	NA	NA	NA
WP_134801557.1|3924316_3925011_-|transposase	IS1-like element IS1N family transposase	transposase	A0A0U2RK18	Escherichia_phage	95.7	2.6e-130
WP_000446946.1|3925046_3925478_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005016452.1|3925478_3925625_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094096554.1|3926449_3927606_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.7	1.4e-67
WP_000078076.1|3928580_3929246_-	6-phosphogluconate phosphatase	NA	NA	NA	NA	NA
WP_000082692.1|3929412_3930750_+	adenine permease AdeP	NA	A0A0R6PHV4	Moraxella_phage	35.7	3.4e-62
WP_001296581.1|3931391_3932141_-	4'-phosphopantetheinyl transferase	NA	NA	NA	NA	NA
WP_005016439.1|3932297_3933257_-	HTH-type transcriptional regulator YidZ	NA	NA	NA	NA	NA
WP_000085995.1|3933231_3934407_-	multidrug efflux MFS transporter MdtL	NA	NA	NA	NA	NA
WP_165442263.1|3935700_3936929_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	98.7	5.0e-177
WP_134801567.1|3937189_3937883_+|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
WP_000014997.1|3937858_3941500_-	RHS domain-containing protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	31.9	5.3e-25
WP_000779791.1|3941728_3942337_+	glutathione S-transferase	NA	NA	NA	NA	NA
WP_000206268.1|3942434_3943826_+|tRNA	L-seryl-tRNA(Sec) selenium transferase	tRNA	NA	NA	NA	NA
WP_000582419.1|3943822_3945667_+	selenocysteine-specific translation elongation factor	NA	A0A2K9KZ60	Tupanvirus	26.7	1.3e-14
WP_000202902.1|3950182_3950593_-	phosphate-starvation-inducible protein PsiE	NA	NA	NA	NA	NA
WP_023637013.1|3950861_3951140_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000595562.1|3953183_3953921_-	capsule biosynthesis GfcC family protein	NA	NA	NA	NA	NA
WP_005016356.1|3953917_3954556_-	YjbF family lipoprotein	NA	NA	NA	NA	NA
WP_000757333.1|3954669_3954912_-	polysaccharide production threonine-rich protein	NA	NA	NA	NA	NA
WP_087786203.1|3955295_3955990_-|transposase	IS1-like element IS1N family transposase	transposase	A0A0U2RK18	Escherichia_phage	95.2	4.4e-130
WP_000019161.1|3956050_3956323_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000198560.1|3956303_3957512_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000789986.1|3957905_3959555_-	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_001290339.1|3960079_3961429_+	lysine-sensitive aspartokinase 3	NA	NA	NA	NA	NA
WP_165442264.1|3961505_3962734_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.3e-177
WP_000561086.1|3962824_3963007_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000066681.1|3963867_3965514_-	class I fumarate hydratase	NA	NA	NA	NA	NA
WP_024259382.1|3965591_3966893_-	anaerobic C4-dicarboxylate transporter DcuB	NA	NA	NA	NA	NA
WP_134801590.1|3968232_3968927_-|transposase	IS1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	94.8	1.3e-129
WP_000611283.1|3969053_3969773_-	two-component system response regulator DcuR	NA	NA	NA	NA	NA
WP_001216477.1|3969769_3971401_-	two-component system sensor histidine kinase DcuS	NA	NA	NA	NA	NA
WP_000371712.1|3971581_3971812_+	(4Fe-4S)-binding protein	NA	NA	NA	NA	NA
WP_000405647.1|3971823_3972096_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_134801589.1|3972445_3973140_-|transposase	IS1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	94.8	1.7e-129
WP_032283524.1|3973210_3973393_+	type V toxin-antitoxin system endoribonuclease antitoxin GhoS	NA	NA	NA	NA	NA
WP_134801574.1|3974315_3975010_-|transposase	IS1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	94.4	3.7e-129
WP_171554048.1|3974989_3975130_+	hypothetical protein	NA	NA	NA	NA	NA
WP_078164525.1|3975853_3976114_+	sugar ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000205782.1|3976253_3977756_+	sugar ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	30.2	5.2e-11
WP_000596021.1|3978778_3979774_+	sugar ABC transporter permease YjfF	NA	NA	NA	NA	NA
WP_000853753.1|3979806_3980805_-	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	42.7	5.7e-70
WP_001219790.1|3980980_3982354_+	UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl- meso-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_000166263.1|3982436_3982982_-	ribosome-associated protein	NA	NA	NA	NA	NA
WP_001162174.1|3983075_3984428_+|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
WP_001232249.1|3984611_3984998_+	cytochrome b562	NA	NA	NA	NA	NA
WP_000212714.1|3985188_3985428_+	type II toxin-antitoxin system RelB/DinJ family antitoxin	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	49.4	4.0e-14
WP_001106233.1|3985428_3985893_-	anaerobic ribonucleoside-triphosphate reductase-activating protein	NA	K4F9T1	Cronobacter_phage	57.7	3.8e-53
WP_000187783.1|3986082_3988221_-	anaerobic ribonucleoside-triphosphate reductase	NA	A0A2I7QNQ7	Vibrio_phage	64.5	1.2e-266
WP_005016308.1|3988614_3990270_-	alpha,alpha-phosphotrehalase	NA	NA	NA	NA	NA
WP_011378955.1|3990319_3991741_-	PTS trehalose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_001181327.1|3991859_3992807_-	HTH-type transcriptional regulator TreR	NA	C6ZCU4	Enterobacteria_phage	21.8	6.0e-13
WP_001387276.1|3992991_3993045_+	mgtA regulatory leader peptide MgtL	NA	NA	NA	NA	NA
WP_000471887.1|3993185_3995882_+	magnesium-translocating P-type ATPase	NA	M1HLC0	Paramecium_bursaria_Chlorella_virus	27.4	9.0e-46
WP_000047539.1|3996087_3996474_-	2-iminobutanoate/2-iminopropanoate deaminase	NA	NA	NA	NA	NA
WP_000148580.1|3996546_3997008_-	aspartate carbamoyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_000013046.1|3997020_3997956_-	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	40.2	2.9e-52
WP_001296693.1|3997959_3998094_-	pyr operon leader peptide	NA	NA	NA	NA	NA
WP_000230271.1|3998373_3998769_-	RidA family protein	NA	NA	NA	NA	NA
WP_000500707.1|3998899_3999613_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_023602305.1|3999683_4000277_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001336307.1|4000421_4000874_+	toxin-antitoxin biofilm protein TabA	NA	NA	NA	NA	NA
WP_087786203.1|4001035_4001729_+|transposase	IS1-like element IS1N family transposase	transposase	A0A0U2RK18	Escherichia_phage	95.2	4.4e-130
WP_165442265.1|4002734_4003962_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	98.7	1.2e-175
WP_000012924.1|4004056_4005061_-	ornithine carbamoyltransferase	NA	NA	NA	NA	NA
WP_000002953.1|4005222_4005639_+	ribonuclease E inhibitor RraB	NA	NA	NA	NA	NA
WP_001059405.1|4005683_4006187_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_087786203.1|4006224_4006919_-|transposase	IS1-like element IS1N family transposase	transposase	A0A0U2RK18	Escherichia_phage	95.2	4.4e-130
WP_134801584.1|4007791_4008485_+|transposase	IS1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	94.8	2.9e-129
WP_000416361.1|4009179_4012035_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	36.8	2.7e-141
>prophage 29
NC_007606	Shigella dysenteriae Sd197, complete sequence	4369232	4020192	4083882	4369232	tRNA,protease,transposase	Escherichia_phage(33.33%)	43	NA	NA
WP_134801583.1|4020192_4021340_-|transposase	IS3-like element IS911 family transposase	transposase	Q716C2	Shigella_phage	99.7	8.5e-179
WP_000175449.1|4022299_4023067_-	Fe(3+) dicitrate ABC transporter ATP-binding protein FecE	NA	G3M9Y6	Bacillus_virus	24.8	8.3e-13
WP_000684858.1|4023067_4024024_-	Fe(3+) dicitrate ABC transporter permease subunit FecD	NA	A0A2H4IY97	uncultured_Caudovirales_phage	25.8	2.4e-17
WP_000125178.1|4024020_4025016_-	iron-dicitrate ABC transporter permease FecC	NA	NA	NA	NA	NA
WP_000188255.1|4025958_4028283_-	Fe(3+) dicitrate transport protein FecA	NA	NA	NA	NA	NA
WP_001283879.1|4029319_4029841_-	RNA polymerase sigma factor FecI	NA	NA	NA	NA	NA
WP_087786203.1|4029994_4030688_+|transposase	IS1-like element IS1N family transposase	transposase	A0A0U2RK18	Escherichia_phage	95.2	4.4e-130
WP_000555341.1|4032364_4032622_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000823237.1|4033372_4034731_+	esterase-like activity of phytase family protein	NA	NA	NA	NA	NA
WP_134801582.1|4034969_4035164_-|transposase	transposase domain-containing protein	transposase	A0A0P0ZBS5	Stx2-converting_phage	96.7	4.6e-29
WP_000612605.1|4035168_4035315_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	97.3	2.7e-13
WP_001171554.1|4035311_4035692_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_001221634.1|4036045_4036480_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000261569.1|4036467_4036707_-	hypothetical protein	NA	NA	NA	NA	NA
WP_165442266.1|4036963_4038192_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.0	8.5e-177
WP_001207638.1|4038475_4038748_+	DUF3811 domain-containing protein	NA	NA	NA	NA	NA
WP_000936357.1|4038748_4039621_-	23S rRNA pseudouridine(2604) synthase RluF	NA	NA	NA	NA	NA
WP_000431652.1|4039968_4040916_+	sugar-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_000406321.1|4042121_4042919_+	PTS mannose/fructose/sorbose transporter subunit IIC	NA	NA	NA	NA	NA
WP_000858547.1|4043804_4045034_+	zinc-binding dehydrogenase	NA	NA	NA	NA	NA
WP_000095944.1|4048806_4052505_-	methionine synthase	NA	A0A140XBC7	Dickeya_phage	86.9	5.4e-25
WP_000226408.1|4052704_4053529_+	glyoxylate bypass operon transcriptional repressor IclR	NA	NA	NA	NA	NA
WP_087786203.1|4055287_4055982_-|transposase	IS1-like element IS1N family transposase	transposase	A0A0U2RK18	Escherichia_phage	95.2	4.4e-130
WP_001137251.1|4056061_4057798_-	bifunctional isocitrate dehydrogenase kinase/phosphatase	NA	NA	NA	NA	NA
WP_000857856.1|4057981_4059286_-	isocitrate lyase	NA	NA	NA	NA	NA
WP_001122782.1|4061144_4062074_-	homoserine O-succinyltransferase	NA	NA	NA	NA	NA
WP_000236973.1|4063006_4063450_+	acetyltransferase	NA	NA	NA	NA	NA
WP_001326558.1|4063513_4063897_-	stress-induced protein	NA	NA	NA	NA	NA
WP_000483776.1|4064020_4065367_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_134810186.1|4065893_4066539_+|transposase	IS1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	94.7	3.7e-115
WP_001182641.1|4067281_4068280_-	O-acetyltransferase WecH	NA	A0A0F6TJ51	Escherichia_coli_O157_typing_phage	27.1	7.0e-12
WP_000980160.1|4069723_4070023_+	membrane protein	NA	NA	NA	NA	NA
WP_001168544.1|4070117_4071029_+|tRNA	glycine--tRNA ligase subunit alpha	tRNA	NA	NA	NA	NA
WP_001291760.1|4071038_4073108_+|tRNA	glycine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_001135729.1|4073430_4073583_+	type I toxin-antitoxin system toxin HokA	NA	NA	NA	NA	NA
WP_000014594.1|4073770_4073983_-	RNA chaperone/antiterminator CspA	NA	A0A1W6JNX5	Morganella_phage	72.9	2.7e-22
WP_000455798.1|4074263_4074554_-	HTH-type transcriptional regulator	NA	NA	NA	NA	NA
WP_000190516.1|4074931_4075642_+	DUF3053 domain-containing protein	NA	NA	NA	NA	NA
WP_000805012.1|4075691_4076666_-	glyoxylate/hydroxypyruvate reductase GhrB	NA	NA	NA	NA	NA
WP_000959819.1|4077222_4079502_+	biotin sulfoxide reductase	NA	A0A077SK27	Escherichia_phage	29.1	5.8e-70
WP_000438949.1|4079907_4080471_-	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
WP_134801557.1|4082830_4083524_+|transposase	IS1-like element IS1N family transposase	transposase	A0A0U2RK18	Escherichia_phage	95.7	2.6e-130
WP_001517630.1|4083606_4083882_-|protease	protease activator YjfN	protease	NA	NA	NA	NA
>prophage 30
NC_007606	Shigella dysenteriae Sd197, complete sequence	4369232	4095002	4160717	4369232	tRNA,protease,transposase	Escherichia_phage(47.06%)	57	NA	NA
WP_134802034.1|4095002_4095697_-|transposase	IS1-like element IS1N family transposase	transposase	A0A0U2RK18	Escherichia_phage	95.2	1.3e-129
WP_001119478.1|4096640_4097279_-	cell division protein YtfB	NA	NA	NA	NA	NA
WP_000188764.1|4097496_4098117_+	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_000228346.1|4098425_4099838_+	D-serine/D-alanine/glycine transporter	NA	NA	NA	NA	NA
WP_000331456.1|4099882_4100545_-	iron-sulfur cluster repair protein YtfE	NA	NA	NA	NA	NA
WP_024259483.1|4100647_4101613_-	DMT family transporter	NA	NA	NA	NA	NA
WP_000560556.1|4101720_4102581_-	NAD(P)H:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_001317588.1|4102669_4103050_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000388338.1|4103166_4105116_-	2',3'-cyclic-nucleotide 2'-phosphodiesterase	NA	NA	NA	NA	NA
WP_134802131.1|4105116_4105811_-|transposase	IS1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	94.8	1.7e-129
WP_000886909.1|4106073_4106814_+	3'(2'),5'-bisphosphate nucleotidase CysQ	NA	NA	NA	NA	NA
WP_134801574.1|4107768_4108463_-|transposase	IS1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	94.4	3.7e-129
WP_000940510.1|4108568_4109597_-	EF-P beta-lysylation protein EpmB	NA	NA	NA	NA	NA
WP_000257278.1|4109638_4110205_+	elongation factor P	NA	NA	NA	NA	NA
WP_000977757.1|4110256_4110382_+	lipoprotein antitoxin entericidin A	NA	NA	NA	NA	NA
WP_000239596.1|4110492_4110639_+	lipoprotein toxin entericidin B	NA	NA	NA	NA	NA
WP_000118486.1|4110814_4111132_+	quaternary ammonium compound efflux SMR transporter SugE	NA	NA	NA	NA	NA
WP_001238386.1|4111128_4111662_-	lipocalin Blc	NA	A0A1W6JNX6	Morganella_phage	55.0	2.1e-47
WP_011378950.1|4111750_4112884_-	BlaEC family class C beta-lactamase	NA	NA	NA	NA	NA
WP_000609663.1|4112946_4113306_-	fumarate reductase subunit FrdD	NA	NA	NA	NA	NA
WP_000208755.1|4113316_4113712_-	fumarate reductase subunit FrdC	NA	NA	NA	NA	NA
WP_000829501.1|4113722_4114457_-	fumarate reductase iron-sulfur protein	NA	NA	NA	NA	NA
WP_001192973.1|4114449_4116258_-	fumarate reductase (quinol) flavoprotein subunit	NA	NA	NA	NA	NA
WP_000004771.1|4116582_4117560_+	elongation factor P--(R)-beta-lysine ligase	NA	A0A2K9KZX5	Tupanvirus	28.2	6.8e-28
WP_000101670.1|4118638_4119277_+	DUF1190 domain-containing protein	NA	NA	NA	NA	NA
WP_000943974.1|4119279_4120443_+	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.5	2.7e-79
WP_005021426.1|4120526_4122140_+	isovaleryl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_134801573.1|4122254_4122948_+|transposase	IS1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	94.4	1.4e-128
WP_001293280.1|4123831_4124563_-	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_000076342.1|4124743_4127173_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	32.9	4.4e-68
WP_001177639.1|4127211_4127637_-	nitric oxide-sensing transcriptional repressor NsrR	NA	NA	NA	NA	NA
WP_000527955.1|4127841_4129140_-	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	35.9	2.2e-66
WP_001089295.1|4129243_4129441_-	DUF2065 domain-containing protein	NA	NA	NA	NA	NA
WP_001232406.1|4129522_4130527_-|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_000312478.1|4130529_4131789_-|protease	FtsH protease activity modulator HflK	protease	A0A1L2CVV0	Pectobacterium_phage	24.5	6.2e-05
WP_000460358.1|4131874_4133155_-	GTPase HflX	NA	NA	NA	NA	NA
WP_001051884.1|4133230_4133539_-	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_001280343.1|4133624_4134575_-|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_001122465.1|4134567_4136415_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	41.3	9.8e-60
WP_000990295.1|4136424_4137762_-	N-acetylmuramoyl-L-alanine amidase AmiB	NA	A0A067ZJB6	Vibrio_phage	31.0	8.8e-18
WP_000981977.1|4137780_4138242_-|tRNA	tRNA (N6-adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase TsaE	tRNA	NA	NA	NA	NA
WP_134801571.1|4139418_4140113_-|transposase	IS1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	94.8	2.9e-129
WP_134802011.1|4140192_4140887_-|transposase	IS1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	94.8	6.4e-129
WP_001294194.1|4141307_4142447_+|tRNA	tRNA epoxyqueuosine(34) reductase QueG	tRNA	NA	NA	NA	NA
WP_010723271.1|4142429_4142483_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001295188.1|4143224_4143770_-	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	40.4	2.2e-28
WP_000041965.1|4143864_4144917_+	small ribosomal subunit biogenesis GTPase RsgA	NA	NA	NA	NA	NA
WP_000934923.1|4145013_4145982_+	phosphatidylserine decarboxylase	NA	NA	NA	NA	NA
WP_001236783.1|4146003_4149327_+	miniconductance mechanosensitive channel MscM	NA	NA	NA	NA	NA
WP_011378953.1|4149477_4150959_-	glutamate/gamma-aminobutyrate family transporter YjeM	NA	NA	NA	NA	NA
WP_087786203.1|4150979_4151674_-|transposase	IS1-like element IS1N family transposase	transposase	A0A0U2RK18	Escherichia_phage	95.2	4.4e-130
WP_000068970.1|4154159_4155857_-	protein-disulfide reductase DsbD	NA	NA	NA	NA	NA
WP_000883400.1|4155832_4156171_-	divalent cation tolerance protein CutA	NA	NA	NA	NA	NA
WP_000961953.1|4156286_4157588_-	anaerobic C4-dicarboxylate transporter DcuA	NA	NA	NA	NA	NA
WP_000069437.1|4157705_4159142_-	aspartate ammonia-lyase	NA	NA	NA	NA	NA
WP_001267440.1|4159477_4159954_+	membrane protein FxsA	NA	NA	NA	NA	NA
WP_134801571.1|4160022_4160717_-|transposase	IS1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	94.8	2.9e-129
>prophage 31
NC_007606	Shigella dysenteriae Sd197, complete sequence	4369232	4165173	4246897	4369232	integrase,tRNA,transposase	Escherichia_phage(38.1%)	58	4160009:4160068	4235028:4235388
4160009:4160068	attL	GGTGATGCTTCCAATTAGTAGAACATGTGTTTTTCAATAAACGTCCCGATGACTTTTTCG	NA	NA	NA	NA
WP_134801565.1|4165173_4165867_+|transposase	IS1-like element IS1N family transposase	transposase	A0A0U2RK18	Escherichia_phage	95.2	5.8e-130
WP_000175272.1|4166303_4166858_-	YtfJ family protein	NA	NA	NA	NA	NA
WP_000689228.1|4167182_4167389_+	DUF1107 domain-containing protein	NA	NA	NA	NA	NA
WP_000935042.1|4167467_4168811_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_005021358.1|4169133_4169772_-	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_001269318.1|4169977_4171711_+	autotransporter assembly complex protein TamA	NA	NA	NA	NA	NA
WP_000060952.1|4171707_4175487_+	autotransporter assembly complex protein TamB	NA	NA	NA	NA	NA
WP_001219160.1|4175489_4175831_+	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
WP_001223211.1|4176042_4176294_+	type II toxin-antitoxin system antitoxin ChpS	NA	NA	NA	NA	NA
WP_000239577.1|4176287_4176638_+	endoribonuclease toxin ChpB	NA	NA	NA	NA	NA
WP_000055075.1|4176714_4177245_-	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	63.3	1.2e-55
WP_087786203.1|4178068_4178763_-|transposase	IS1-like element IS1N family transposase	transposase	A0A0U2RK18	Escherichia_phage	95.2	4.4e-130
WP_000856800.1|4182187_4183645_+	dipeptide/tripeptide permease DtpC	NA	NA	NA	NA	NA
WP_078164603.1|4186472_4186682_+	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
WP_134801557.1|4188023_4188717_+|transposase	IS1-like element IS1N family transposase	transposase	A0A0U2RK18	Escherichia_phage	95.7	2.6e-130
WP_119164649.1|4189466_4189568_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_134801631.1|4190219_4190913_+|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
WP_164925037.1|4191075_4191192_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000991370.1|4191565_4192180_+	acid-sensing system DNA-binding response regulator EvgA	NA	NA	NA	NA	NA
WP_011378966.1|4192184_4195778_+	acid-sensing system histidine kinase EvgS	NA	A0A1V0SGX0	Hokovirus	31.8	6.6e-36
WP_000998102.1|4195937_4197476_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	99.2	4.2e-298
WP_000612546.1|4197525_4197873_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	97.4	1.6e-59
WP_158249626.1|4197869_4198214_-|transposase	transposase	transposase	A0A0P0ZBP6	Stx2-converting_phage	96.0	2.3e-47
WP_024263008.1|4198248_4198923_+|transposase	transposase	transposase	A0A0P0ZCV4	Stx2-converting_phage	30.1	5.8e-10
WP_000631696.1|4198919_4199255_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	71.0	4.5e-40
WP_134801567.1|4202173_4202867_+|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
WP_000999849.1|4202979_4204023_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087786203.1|4204173_4204868_-|transposase	IS1-like element IS1N family transposase	transposase	A0A0U2RK18	Escherichia_phage	95.2	4.4e-130
WP_119164646.1|4205207_4205366_-|integrase	integrase	integrase	Q7M297	Enterobacteria_phage	79.4	1.9e-09
WP_164925039.1|4208254_4208948_+|transposase	IS1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	94.8	6.4e-129
WP_000535937.1|4210360_4211284_+	DMT family transporter	NA	NA	NA	NA	NA
WP_000779403.1|4211287_4212106_-	lipoprotein NlpA	NA	NA	NA	NA	NA
WP_000402207.1|4213118_4214768_-	Na+/H+ antiporter	NA	NA	NA	NA	NA
WP_000106882.1|4214918_4216268_-	guanine/hypoxanthine transporter GhxP	NA	A0A0R6PHV4	Moraxella_phage	71.6	1.8e-159
WP_000412428.1|4216814_4217279_-	redox-sensitive transcriptional activator SoxR	NA	NA	NA	NA	NA
WP_000019351.1|4217364_4217688_+	superoxide response transcriptional regulator SoxS	NA	NA	NA	NA	NA
WP_134801565.1|4217956_4218650_+|transposase	IS1-like element IS1N family transposase	transposase	A0A0U2RK18	Escherichia_phage	95.2	5.8e-130
WP_005021204.1|4219012_4219294_+	YjcB family protein	NA	NA	NA	NA	NA
WP_000168299.1|4219392_4219929_-	single-stranded DNA-binding protein SSB1	NA	A0A0A0P1Q9	Enterobacteria_phage	82.0	3.3e-56
WP_000357751.1|4220182_4223005_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	56.1	0.0e+00
WP_000155657.1|4223039_4223396_-	MmcQ/YjbR family DNA-binding protein	NA	NA	NA	NA	NA
WP_000270375.1|4223399_4223816_-	YjbQ family protein	NA	NA	NA	NA	NA
WP_000486959.1|4228094_4229288_-	aromatic amino acid transaminase	NA	NA	NA	NA	NA
WP_001147331.1|4229530_4230610_-	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	28.2	4.0e-29
WP_000918354.1|4230662_4232078_-	replicative DNA helicase	NA	O80281	Escherichia_phage	78.1	2.4e-199
WP_000235509.1|4232160_4233144_+	quinone oxidoreductase	NA	NA	NA	NA	NA
WP_000891404.1|4233309_4233552_-	envelope stress response protein PspG	NA	NA	NA	NA	NA
WP_011378970.1|4233685_4234723_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_000912598.1|4235568_4235859_-	hypothetical protein	NA	NA	NA	NA	NA
4235028:4235388	attR	GGTGATGCTTCCAATTAGTAGAACATGTGTTTTTCAATAAACGTCCCGATGACTTTTTCGTGGATCTCTACTGAACGCGAGAAGCAGATTGTTTTACGAGCCAAGCGCTTAATGCGGGTGCGCAGCGTCAGGTTATTGCGCTCAATCCGTTGGGTGAATATTTTTCCGGTCAGATGCTTATCCTTCGGCACCTCCCGGCCATAGCTGCCCCAGTCGTCGCTGGTGATCATGCCGATGTTGAATGGCGTAAGCAGTGCCAGTAGTTCCCGGCAGGTTTCATCGGTACGGGGACCAAAAGTGTAGGCCAGTACCCCCCCTGTTTTGGTGTTATACGCGTACCAGAGCCAGTGTTGCCGGGCTT	NA	NA	NA	NA
WP_000416263.1|4236177_4236693_+	zinc uptake transcriptional repressor Zur	NA	NA	NA	NA	NA
WP_001030593.1|4236734_4236944_-	CsbD family protein	NA	NA	NA	NA	NA
WP_011378972.1|4237059_4238385_-	MATE family efflux transporter DinF	NA	NA	NA	NA	NA
WP_000646078.1|4238457_4239066_-	repressor LexA	NA	Q9G0C2	Lactococcus_phage	38.0	1.0e-13
WP_000002907.1|4239175_4239544_-	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_000017354.1|4239714_4242138_+	glycerol-3-phosphate 1-O-acyltransferase PlsB	NA	NA	NA	NA	NA
WP_000455227.1|4242292_4243165_-	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
WP_001297295.1|4243177_4243675_-	chorismate lyase	NA	NA	NA	NA	NA
WP_134801564.1|4246203_4246897_+|transposase	IS1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	94.8	3.7e-129
>prophage 32
NC_007606	Shigella dysenteriae Sd197, complete sequence	4369232	4272463	4339177	4369232	transposase	Escherichia_phage(26.67%)	47	NA	NA
WP_134802161.1|4272463_4273158_-|transposase	IS1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	93.9	5.4e-128
WP_000988315.1|4274300_4274492_+	cellulose biosynthesis protein BcsF	NA	NA	NA	NA	NA
WP_001295224.1|4276253_4276361_-	type I toxin-antitoxin system toxin Ldr family protein	NA	NA	NA	NA	NA
WP_011378975.1|4276836_4278108_+	transporter	NA	NA	NA	NA	NA
WP_000107011.1|4278137_4279142_-	dipeptide ABC transporter ATP binding subunit DppF	NA	G9BWD6	Planktothrix_phage	33.2	2.4e-20
WP_001196499.1|4279138_4280122_-	dipeptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.3	7.4e-14
WP_000084679.1|4280132_4281035_-	dipeptide ABC transporter permease DppC	NA	NA	NA	NA	NA
WP_000938855.1|4281044_4282064_-	dipeptide ABC transporter permease DppB	NA	NA	NA	NA	NA
WP_001222888.1|4282214_4283822_-	dipeptide ABC transporter substrate-binding protein DppA	NA	NA	NA	NA	NA
WP_032196364.1|4284172_4284409_-	hypothetical protein	NA	NA	NA	NA	NA
WP_165442267.1|4286801_4288030_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.0	8.5e-177
WP_164925041.1|4292075_4292770_-|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
WP_165442258.1|4294973_4296201_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.0	6.5e-177
WP_001323397.1|4298653_4298812_+	DUF905 family protein	NA	NA	NA	NA	NA
WP_000855065.1|4300127_4300601_+	antirestriction protein	NA	A0A2D0W9W4	Bordetella_phage	33.8	2.5e-12
WP_005021075.1|4300616_4301093_+	RadC family protein	NA	NA	NA	NA	NA
WP_000692345.1|4301161_4301383_+	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.9e-10
WP_023602479.1|4301545_4301914_+	type IV toxin-antitoxin system YeeU family antitoxin	NA	NA	NA	NA	NA
WP_000976841.1|4302374_4302866_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000839288.1|4302882_4303059_+	DUF957 domain-containing protein	NA	NA	NA	NA	NA
WP_000666413.1|4304804_4305062_-	DUF3343 domain-containing protein	NA	NA	NA	NA	NA
WP_001317602.1|4305058_4305826_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001137027.1|4308423_4309656_-	multidrug efflux MFS transporter MdtM	NA	NA	NA	NA	NA
WP_000181149.1|4310122_4311067_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	50.4	1.9e-59
WP_000199325.1|4311309_4312722_-	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_000394281.1|4312898_4313063_+	DUF1127 domain-containing protein	NA	NA	NA	NA	NA
WP_134801551.1|4313364_4314059_-|transposase	IS1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	94.4	4.9e-129
WP_005021058.1|4314121_4315078_-	GTPase	NA	NA	NA	NA	NA
WP_000467859.1|4315088_4315292_-	YbdD/YjiX family protein	NA	NA	NA	NA	NA
WP_024259476.1|4315422_4317573_-	pyruvate/proton symporter BtsT	NA	NA	NA	NA	NA
WP_171554049.1|4320059_4321215_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.7	1.4e-67
WP_001292626.1|4322254_4324546_-	phosphatidylglycerol--membrane-oligosaccharide glycerophosphotransferase	NA	NA	NA	NA	NA
WP_001520419.1|4324799_4325294_-	DUF2501 domain-containing protein	NA	NA	NA	NA	NA
WP_000799912.1|4325342_4326080_-	DNA replication protein DnaC	NA	V5UQI5	Shigella_phage	50.8	7.6e-64
WP_011378979.1|4326082_4326622_-	primosomal protein DnaT	NA	T1SA92	Salmonella_phage	62.8	2.9e-28
WP_000538187.1|4326728_4327202_-	threonine/serine exporter	NA	NA	NA	NA	NA
WP_119164600.1|4327192_4327924_-	threonine/serine exporter ThrE family protein	NA	NA	NA	NA	NA
WP_134801577.1|4329067_4329762_-|transposase	IS1-like element IS1N family transposase	transposase	NA	NA	NA	NA
WP_164925042.1|4330438_4331131_+|transposase	IS1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	94.8	2.9e-129
WP_000331586.1|4332303_4333092_-	siderophore-iron reductase FhuF	NA	NA	NA	NA	NA
WP_001577669.1|4333232_4333469_+	DUF1435 domain-containing protein	NA	NA	NA	NA	NA
WP_001272330.1|4334030_4335062_-	16S rRNA (guanine(1207)-N(2))-methyltransferase RsmC	NA	NA	NA	NA	NA
WP_000204018.1|4335164_4335578_+	DNA polymerase III subunit psi	NA	NA	NA	NA	NA
WP_001092460.1|4335546_4335993_+	ribosomal protein S18-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_000870720.1|4336007_4336685_+	pyrimidine 5'-nucleotidase	NA	NA	NA	NA	NA
WP_000175940.1|4336775_4338365_+	peptide chain release factor 3	NA	D0R0F5	Streptococcus_phage	25.2	2.4e-30
WP_134801664.1|4338483_4339177_+|transposase	IS1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	93.9	1.6e-127
>prophage 1
NC_007607	Shigella dysenteriae Sd197 plasmid pSD1_197, complete sequence	182726	4363	95781	182726	transposase,tRNA	Escherichia_phage(50.0%)	53	NA	NA
WP_134801664.1|4363_5057_+|transposase	IS1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	93.9	1.6e-127
WP_024263012.1|7423_9133_-	ShET2/EspL2 family type III secretion system effector toxin	NA	NA	NA	NA	NA
WP_164833015.1|9497_10726_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	98.7	3.2e-176
WP_001121864.1|10900_11620_-	type III secretion system effector phosphothreonine lyase	NA	NA	NA	NA	NA
WP_000868555.1|12739_13318_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001082153.1|14674_14962_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000622997.1|15639_15987_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	74.8	2.2e-45
WP_011379050.1|18876_19554_+	type 3 secretion system effector OspD1	NA	NA	NA	NA	NA
WP_011114726.1|20065_20380_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024263014.1|20661_21228_+	type III secretion effector IpgB2	NA	NA	NA	NA	NA
WP_134801821.1|21799_22964_+|transposase	IS3-like element IS3H family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.4	4.8e-52
WP_000200286.1|26267_27467_+	AAA family ATPase	NA	Q71TL9	Escherichia_phage	74.9	3.0e-174
WP_000431558.1|27466_28447_+	ParB/RepB/Spo0J family partition protein	NA	Q38420	Escherichia_phage	58.2	5.0e-95
WP_128876770.1|29476_30709_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	32.0	1.5e-27
WP_011379044.1|32656_34381_-	T3SS effector E3 ubiquitin-protein ligase IpaH4.5	NA	NA	NA	NA	NA
WP_011379043.1|34808_36506_-	T3SS effector E3 ubiquitin-protein ligase IpaH7.8	NA	NA	NA	NA	NA
WP_094096542.1|39245_40089_+|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	50.0	4.4e-23
WP_024263018.1|40413_42141_-	E3 ubiquitin--protein ligase	NA	NA	NA	NA	NA
WP_000957712.1|42528_42795_-	type 3 secretion system effector OspE2	NA	NA	NA	NA	NA
WP_011114782.1|43441_43594_-	hypothetical protein	NA	NA	NA	NA	NA
WP_134802015.1|44083_44778_-|transposase	IS1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	94.4	3.2e-128
WP_011379035.1|47796_49209_+	type 3 secretion system effector OspC1	NA	NA	NA	NA	NA
WP_005015229.1|49517_51215_+	type III secretion system effector OspD3	NA	NA	NA	NA	NA
WP_087786203.1|51511_52206_-|transposase	IS1-like element IS1N family transposase	transposase	A0A0U2RK18	Escherichia_phage	95.2	4.4e-130
WP_000612524.1|55274_56927_+	bifunctional UDP-sugar hydrolase/5'-nucleotidase	NA	NA	NA	NA	NA
WP_134801584.1|56995_57689_+|transposase	IS1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	94.8	2.9e-129
WP_000828660.1|58104_58854_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_000701102.1|60292_61747_+	type 3 secretion system effector OspC2	NA	NA	NA	NA	NA
WP_134802192.1|61896_62741_-|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	50.0	4.4e-23
WP_005015412.1|62786_63167_-	type II toxin-antitoxin system RelB/DinJ family antitoxin	NA	NA	NA	NA	NA
WP_000445931.1|63346_63742_-	plasmid partitioning/stability family protein	NA	NA	NA	NA	NA
WP_000921950.1|63741_64701_-	plasmid segregation protein ParM	NA	A0A222YXF2	Escherichia_phage	45.0	1.2e-72
WP_000607008.1|68348_68987_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001178088.1|71196_71481_+	ribbon-helix-helix protein, CopG family	NA	NA	NA	NA	NA
WP_000421263.1|71480_71756_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000766699.1|71887_72025_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000361391.1|72116_72482_-	plasmid partitioning/stability family protein	NA	NA	NA	NA	NA
WP_000813626.1|75459_75678_+	type II toxin-antitoxin system antitoxin CcdA	NA	NA	NA	NA	NA
WP_001159860.1|75679_75985_+	type II toxin-antitoxin system toxin CcdB	NA	NA	NA	NA	NA
WP_164925049.1|76243_76937_+|transposase	IS1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	94.8	2.9e-129
WP_000936809.1|77151_78789_+	T3SS effector E3 ubiquitin-protein ligase IpaH9.8	NA	NA	NA	NA	NA
WP_000079957.1|78996_79266_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000705601.1|79517_80108_+	type III secretion system effector protein kinase OspG	NA	NA	NA	NA	NA
WP_011379024.1|80793_82140_+|transposase	IS4-like element IS4 family transposase	transposase	NA	NA	NA	NA
WP_164925050.1|82696_85609_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004996477.1|85611_85728_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000931198.1|86091_86934_+	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_005015483.1|86936_88025_+	putative hexosyltransferase CapU	NA	NA	NA	NA	NA
WP_004970430.1|88029_88980_+	virulence factor VirK	NA	NA	NA	NA	NA
WP_004996485.1|89044_89989_+	lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase	NA	NA	NA	NA	NA
WP_134801823.1|90186_90831_+|transposase	transposase	transposase	A0A0P0ZCV4	Stx2-converting_phage	48.9	1.3e-14
WP_134802193.1|92369_93526_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.4	3.4e-66
WP_000911312.1|95382_95781_-|tRNA	tRNA(fMet)-specific endonuclease VapC	tRNA	NA	NA	NA	NA
>prophage 2
NC_007607	Shigella dysenteriae Sd197 plasmid pSD1_197, complete sequence	182726	104959	175119	182726	transposase,protease	Escherichia_phage(44.44%)	60	NA	NA
WP_134801812.1|104959_105654_-|transposase	IS1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	93.9	9.2e-128
WP_000083819.1|106453_106714_+	replication regulatory protein RepA	NA	NA	NA	NA	NA
WP_001365705.1|106937_107012_+	RepA leader peptide Tap	NA	NA	NA	NA	NA
WP_000130974.1|107004_107862_+	incFII family plasmid replication initiator RepA	NA	NA	NA	NA	NA
WP_000198558.1|108971_110180_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000019161.1|110160_110433_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011379009.1|110426_111971_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	97.4	9.9e-122
WP_000405248.1|112604_113087_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_162147618.1|113077_113380_-	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_072056208.1|113793_114492_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.1	7.3e-125
WP_000019161.1|115783_116056_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011379008.1|116799_116973_-|transposase	transposase	transposase	Q6H9S5	Enterobacteria_phage	61.1	8.4e-06
WP_011379007.1|117313_118768_+	T3SS effector OspC family protein	NA	NA	NA	NA	NA
WP_171554051.1|119106_120262_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.4	6.1e-68
WP_162147615.1|121669_122101_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162147616.1|122076_122343_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011379003.1|122431_123628_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_024263024.1|126164_126944_+|protease	type III secretion system effector cysteine protease IpaJ	protease	NA	NA	NA	NA
WP_000227976.1|127893_128823_-	ParB/RepB/Spo0J family partition protein	NA	Q1MVJ4	Enterobacteria_phage	42.6	1.4e-51
WP_000588956.1|129029_129266_-	acyl carrier protein	NA	NA	NA	NA	NA
WP_011379000.1|129269_131171_-	T3SS effector invasin IpaA	NA	NA	NA	NA	NA
WP_001028028.1|131179_132178_-	type III secretion system needle tip complex protein IpaD	NA	NA	NA	NA	NA
WP_000405469.1|132228_133320_-	T3SS translocon subunit IpaC	NA	NA	NA	NA	NA
WP_000552051.1|133339_135082_-	type III secretion system translocon subunit IpaB	NA	NA	NA	NA	NA
WP_000055835.1|135087_135555_-	SycD/LcrH family type III secretion system chaperone IpgC	NA	NA	NA	NA	NA
WP_001166524.1|135612_136239_-	type III secretion effector IpgB1	NA	NA	NA	NA	NA
WP_010921664.1|136254_136644_-	type III secretion system chaperone IpgA	NA	NA	NA	NA	NA
WP_000601046.1|136656_138141_-	type III secretion system effector IcsB	NA	NA	NA	NA	NA
WP_000548332.1|138454_140071_+	type III secretion system effector inositol phosphate phosphatase	NA	NA	NA	NA	NA
WP_000389733.1|140080_140443_+	type III secretion system chaperone IpgE	NA	NA	NA	NA	NA
WP_000086107.1|140442_140901_+	type III secretion system lytic transglycosylase IpgF	NA	NA	NA	NA	NA
WP_001287355.1|140909_142025_+	type III secretion system protein MxiG	NA	NA	NA	NA	NA
WP_011378999.1|142032_142284_+	type III secretion system needle complex protein	NA	NA	NA	NA	NA
WP_001106824.1|142296_142590_+	type III secretion system inner rod protein MxiI	NA	NA	NA	NA	NA
WP_000621939.1|142595_143321_+	SctJ family type III secretion inner membrane ring lipoprotein Mxi	NA	NA	NA	NA	NA
WP_000620626.1|143317_143845_+	type III secretion apparatus protein OrgA/MxiK	NA	NA	NA	NA	NA
WP_011378997.1|143786_144482_+	Mxi-Spa type III secretion system linker protein MxiN	NA	NA	NA	NA	NA
WP_000609864.1|144474_144882_+	Mxi-Spa secretion machinery protein MxiL	NA	NA	NA	NA	NA
WP_011378996.1|144865_145294_+	type III secretion system transcriptional activator MxiE	NA	NA	NA	NA	NA
WP_000398257.1|145423_146056_+	type III secretion system transcriptional activator MxiE	NA	NA	NA	NA	NA
WP_000714402.1|146042_147743_+	type III secretion system secretin MxiD	NA	NA	NA	NA	NA
WP_000887827.1|147761_148829_+	type III secretion system gatekeeper subunit MxiC	NA	NA	NA	NA	NA
WP_024263027.1|148841_150902_+	type III secretion system export apparatus protein MxiA	NA	NA	NA	NA	NA
WP_011378994.1|150914_151316_+	type III secretion system chaperone Spa15/SpaK	NA	NA	NA	NA	NA
WP_000122614.1|151319_152612_+	type III secretion system ATPase SpaL	NA	NA	NA	NA	NA
WP_024263028.1|152704_153043_+	type III secretion system protein Spa13	NA	NA	NA	NA	NA
WP_001162452.1|153029_153908_+	type III secretion system needle length regulator Spa32	NA	NA	NA	NA	NA
WP_000944986.1|153901_154783_+	SctQ family type III secretion system ring protein Spa33	NA	NA	NA	NA	NA
WP_000947538.1|154787_155438_+	type III secretion system export apparatus protein Spa24/SpaP	NA	NA	NA	NA	NA
WP_001280546.1|155452_155713_+	type III secretion system export apparatus protein SpaQ	NA	NA	NA	NA	NA
WP_000355395.1|155712_156483_+	type III secretion system export apparatus protein Spa29/SpaR	NA	NA	NA	NA	NA
WP_001284685.1|156489_157518_+	type III secretion system export apparatus switch protein Spa40/SpaS	NA	NA	NA	NA	NA
WP_010921676.1|157530_157773_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038815643.1|159859_160264_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005059327.1|160814_161531_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000124081.1|165210_165468_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_001195011.1|167851_169054_-|protease	alpha-tubulin-specific protease	protease	NA	NA	NA	NA
WP_087786203.1|169388_170083_-|transposase	IS1-like element IS1N family transposase	transposase	A0A0U2RK18	Escherichia_phage	95.2	4.4e-130
WP_001071790.1|170356_173665_+	outer membrane autotransporter IcsA	NA	A0A2L1IV18	Escherichia_phage	29.0	3.9e-75
WP_088895425.1|173890_175119_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.3e-177
