The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_006840	Aliivibrio fischeri ES114 chromosome I, complete sequence	2897536	674577	681982	2897536		Faustovirus(16.67%)	9	NA	NA
WP_047863694.1|674577_675792_+	IscS subfamily cysteine desulfurase	NA	A0A1X7C038	Faustovirus	29.7	1.1e-30
WP_005417914.1|675826_676210_+	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	75.8	3.5e-52
WP_005417916.1|676334_676658_+	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	45.8	1.1e-22
WP_011261361.1|676673_677189_+	co-chaperone HscB	NA	NA	NA	NA	NA
WP_011261362.1|677227_679078_+	Fe-S protein assembly chaperone HscA	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	39.0	4.1e-106
WP_005417920.1|679080_679419_+	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
WP_005417922.1|679541_679742_+	Fe-S cluster assembly protein IscX	NA	NA	NA	NA	NA
WP_011261363.1|679972_681259_+	aminopeptidase PepB	NA	Q6GYZ8	Mycoplasma_phage	32.8	4.6e-32
WP_005417926.1|681547_681982_+	nucleoside-diphosphate kinase	NA	D2E8E1	Anguillid_herpesvirus	37.7	8.8e-20
>prophage 2
NC_006840	Aliivibrio fischeri ES114 chromosome I, complete sequence	2897536	2185129	2270868	2897536	plate,head,tail,tRNA,capsid,protease,integrase,portal,terminase	Vibrio_phage(28.12%)	97	2237773:2237800	2270967:2270994
WP_011262429.1|2185129_2186488_-|protease	sigma E protease regulator RseP	protease	NA	NA	NA	NA
WP_011262430.1|2186490_2187693_-	1-deoxy-D-xylulose-5-phosphate reductoisomerase	NA	NA	NA	NA	NA
WP_047863483.1|2187799_2188639_-	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_005420551.1|2188642_2189416_-	isoprenyl transferase	NA	R9W0U9	Flavobacterium_phage	42.9	3.1e-23
WP_011262432.1|2189537_2190095_-	ribosome recycling factor	NA	NA	NA	NA	NA
WP_011262433.1|2190130_2190862_-	UMP kinase	NA	NA	NA	NA	NA
WP_011262434.1|2191014_2191860_-	elongation factor Ts	NA	NA	NA	NA	NA
WP_005420558.1|2191993_2192722_-	30S ribosomal protein S2	NA	NA	NA	NA	NA
WP_005420560.1|2193081_2193909_+	type I methionyl aminopeptidase	NA	NA	NA	NA	NA
WP_011262435.1|2193967_2196589_+	bifunctional uridylyltransferase/uridylyl-removing protein GlnD	NA	NA	NA	NA	NA
WP_005420564.1|2196728_2197109_+	DUF3461 family protein	NA	NA	NA	NA	NA
WP_011262436.1|2197177_2198128_-	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	46.8	4.6e-53
WP_011262437.1|2198140_2199997_-	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_011262438.1|2200050_2200386_-	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	40.2	2.2e-10
WP_005420569.1|2200480_2201608_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	47.2	1.9e-90
WP_011262439.1|2201821_2202874_-|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_005420573.1|2203106_2203550_+	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_005420574.1|2203630_2204959_-	isocitrate lyase	NA	NA	NA	NA	NA
WP_011262440.1|2204973_2206578_-	malate synthase A	NA	NA	NA	NA	NA
WP_011262441.1|2207152_2208052_-	hydrogen peroxide-inducible genes activator	NA	NA	NA	NA	NA
WP_005420579.1|2208197_2208806_+	peroxiredoxin C	NA	NA	NA	NA	NA
WP_011262442.1|2209086_2209830_+	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_011262443.1|2209886_2210249_-	NirD/YgiW/YdeI family stress tolerance protein	NA	NA	NA	NA	NA
WP_011262444.1|2210305_2210941_-	porin family protein	NA	NA	NA	NA	NA
WP_011262445.1|2211248_2212178_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_047863481.1|2212711_2213206_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011262447.1|2213452_2214013_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011262448.1|2214201_2214900_-	phosphate signaling complex protein PhoU	NA	NA	NA	NA	NA
WP_005420610.1|2214939_2215758_-	phosphate ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	34.8	5.0e-16
WP_011262449.1|2215762_2217298_-	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_011262450.1|2217308_2219516_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_193332949.1|2219625_2220606_-	phosphate ABC transporter substrate-binding protein PstS family protein	NA	NA	NA	NA	NA
WP_011262452.1|2220629_2221925_-	phosphate regulon sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	28.0	3.4e-27
WP_005420619.1|2221951_2222644_-	phosphate regulon transcriptional regulator PhoB	NA	W8CYM9	Bacillus_phage	36.6	1.1e-35
WP_026029289.1|2222858_2223770_+	recombination-associated protein RdgC	NA	A0A2I7RNT5	Vibrio_phage	59.8	6.7e-102
WP_011262453.1|2223924_2225313_+|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	74.1	4.1e-159
WP_005420626.1|2225316_2225571_+	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	52.8	1.5e-19
WP_011262454.1|2225652_2226747_-	DUF3541 domain-containing protein	NA	NA	NA	NA	NA
WP_011262455.1|2226924_2228064_-	molecular chaperone DnaJ	NA	A0A1V0SBY2	Catovirus	25.4	9.8e-18
WP_011262456.1|2228444_2230349_-	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	49.3	1.4e-141
WP_047863480.1|2230569_2231517_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011262458.1|2231757_2232342_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_026029291.1|2232519_2233404_+	NAD(+) kinase	NA	NA	NA	NA	NA
WP_005420633.1|2233521_2235189_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_011262460.1|2235404_2235761_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_011262461.1|2235841_2236153_-	RnfH family protein	NA	NA	NA	NA	NA
WP_005420637.1|2236139_2236577_-	ubiquinone-binding protein	NA	NA	NA	NA	NA
WP_011262462.1|2236873_2237359_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	43.0	3.9e-24
2237773:2237800	attL	GGGGTTCAAATCCCCCCAGCTCCACCAA	NA	NA	NA	NA
WP_011262463.1|2237985_2238534_-	Bro-N domain-containing protein	NA	Q8HA44	Vibrio_phage	57.3	8.5e-28
WP_011262464.1|2239093_2240980_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155403963.1|2241015_2241117_-|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_011262465.1|2241155_2241425_-|tail	phage tail assembly protein	tail	A0A219YA51	Aeromonas_phage	36.1	2.4e-07
WP_011262466.1|2241417_2242125_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011262467.1|2242141_2242507_-|tail	phage tail tube protein	tail	NA	NA	NA	NA
WP_011262468.1|2242532_2243666_-|tail	phage tail sheath subtilisin-like domain-containing protein	tail	Q8W623	Enterobacteria_phage	29.8	1.2e-44
WP_011262469.1|2243665_2243833_-	DUF2635 domain-containing protein	NA	NA	NA	NA	NA
WP_011262470.1|2243833_2244355_-	phage virion morphogenesis protein	NA	NA	NA	NA	NA
WP_011262471.1|2244345_2244819_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_011262472.1|2244818_2245268_-|head	head completion/stabilization protein	head	NA	NA	NA	NA
WP_011262473.1|2245379_2246414_-|capsid	phage major capsid protein, P2 family	capsid	A0A0U4K5I9	Pseudomonas_phage	41.2	3.9e-66
WP_011262474.1|2246476_2247289_-|capsid	GPO family capsid scaffolding protein	capsid	Q94MZ5	Haemophilus_virus	42.0	1.4e-21
WP_193332950.1|2247429_2249187_+|terminase	terminase	terminase	A0A077K8Q7	Ralstonia_phage	39.8	1.2e-110
WP_011262476.1|2249228_2250170_+|portal	phage portal protein	portal	Q19UT6	Mannheimia_phage	40.9	5.0e-60
WP_011262477.1|2250316_2250667_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047863515.1|2250668_2250827_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011262479.1|2250874_2251264_-	peptidase	NA	A0A1B1IPM8	uncultured_Mediterranean_phage	60.2	3.7e-41
WP_011262480.1|2251265_2251499_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011262481.1|2251634_2252090_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011262482.1|2252089_2253436_-|tail	tail fiber protein	tail	A0A2I7QXA3	Vibrio_phage	32.6	1.1e-07
WP_011262485.1|2253886_2254939_-|plate	baseplate J/gp47 family protein	plate	J9QE72	Clostridium_phage	31.8	9.7e-12
WP_011262486.1|2254935_2255322_-	phage GP46 family protein	NA	NA	NA	NA	NA
WP_011262487.1|2255318_2255516_-	hypothetical protein	NA	A0A2I7RNJ8	Vibrio_phage	67.7	3.6e-13
WP_011262488.1|2255518_2256028_-|plate	phage baseplate assembly protein	plate	NA	NA	NA	NA
WP_011262489.1|2256020_2256965_-|tail	tail protein	tail	A0A2P9JZK3	Alteromonadaceae_phage	24.9	1.6e-05
WP_011262490.1|2256961_2258197_-	DNA circularization N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_047863478.1|2258548_2258791_-	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_011262491.1|2258759_2259173_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011262492.1|2259174_2260089_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011262493.1|2260174_2260729_-	3'-5' exoribonuclease	NA	A0A2I7RDR9	Vibrio_phage	57.8	9.5e-59
WP_011262494.1|2260739_2260946_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011262495.1|2260955_2263076_-	hypothetical protein	NA	A0A2I7RNF8	Vibrio_phage	50.4	5.0e-185
WP_011262496.1|2263104_2263440_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047863477.1|2263542_2263755_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011262497.1|2263751_2263982_-	hypothetical protein	NA	A0A2I7RNG5	Vibrio_phage	53.9	2.6e-18
WP_011262498.1|2263985_2264213_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011262500.1|2264343_2264745_-	hypothetical protein	NA	R9TRR4	Vibrio_phage	53.4	2.4e-35
WP_011262501.1|2264741_2265212_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011262502.1|2265222_2265756_-	phage regulatory CII family protein	NA	A0A2I7RNI1	Vibrio_phage	42.5	9.2e-35
WP_047863476.1|2265783_2265993_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011262504.1|2266002_2266188_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_011262505.1|2266339_2266987_+	helix-turn-helix domain-containing protein	NA	A5VW98	Enterobacteria_phage	41.1	3.1e-37
WP_011262506.1|2267021_2267303_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011262507.1|2267314_2267656_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011262508.1|2267702_2268884_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011262509.1|2268870_2269221_+	STAS-like domain-containing protein	NA	NA	NA	NA	NA
WP_011262510.1|2269217_2269823_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011262511.1|2269890_2270868_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	51.5	2.8e-90
2270967:2270994	attR	GGGGTTCAAATCCCCCCAGCTCCACCAA	NA	NA	NA	NA
>prophage 3
NC_006840	Aliivibrio fischeri ES114 chromosome I, complete sequence	2897536	2303270	2312438	2897536	tRNA	uncultured_Mediterranean_phage(28.57%)	10	NA	NA
WP_011262534.1|2303270_2304236_-	RNA polymerase sigma factor RpoS	NA	F4YCU2	Synechococcus_phage	34.9	2.6e-35
WP_047863473.1|2304290_2305280_-	peptidoglycan DD-metalloendopeptidase family protein	NA	D7RWE0	Brochothrix_phage	34.7	2.2e-05
WP_011262536.1|2305293_2305920_-	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	50.3	3.7e-35
WP_011262537.1|2305919_2306693_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	51.6	1.9e-65
WP_011262538.1|2306700_2307756_-|tRNA	tRNA pseudouridine(13) synthase TruD	tRNA	NA	NA	NA	NA
WP_011262539.1|2307767_2308244_-	2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase	NA	NA	NA	NA	NA
WP_011262540.1|2308243_2308960_-	2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase	NA	A0A2H4UTB4	Bodo_saltans_virus	24.2	3.2e-06
WP_005420699.1|2308963_2309248_-	cell division protein FtsB	NA	NA	NA	NA	NA
WP_011262541.1|2309420_2310719_-	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	59.9	8.5e-135
WP_011262542.1|2310797_2312438_-	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	51.5	1.4e-153
>prophage 1
NC_006841	Aliivibrio fischeri ES114 chromosome II, complete sequence	1330333	196617	205008	1330333		Bacillus_phage(66.67%)	10	NA	NA
WP_011263071.1|196617_197499_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	32.2	3.6e-28
WP_011263072.1|197649_198174_-	DUF3087 domain-containing protein	NA	NA	NA	NA	NA
WP_011263073.1|198390_199311_-	permease	NA	NA	NA	NA	NA
WP_011263074.1|199418_199730_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_011263075.1|199753_200227_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	48.7	3.2e-31
WP_011263076.1|200244_201585_-	heavy metal sensor histidine kinase	NA	W8CYF6	Bacillus_phage	27.0	2.7e-19
WP_011263077.1|201589_202270_-	heavy metal response regulator transcription factor	NA	W8CYM9	Bacillus_phage	32.7	5.6e-29
WP_047863641.1|202373_202754_-	DUF3316 domain-containing protein	NA	NA	NA	NA	NA
WP_005421996.1|202948_203614_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	33.3	2.9e-22
WP_011263079.1|203619_205008_+	sensor histidine kinase	NA	W8CYF6	Bacillus_phage	26.2	7.5e-20
>prophage 2
NC_006841	Aliivibrio fischeri ES114 chromosome II, complete sequence	1330333	656428	665022	1330333	integrase	Vibrio_phage(71.43%)	10	648028:648044	661568:661584
648028:648044	attL	TTAAAAATGAAATTGAA	NA	NA	NA	NA
WP_011263422.1|656428_657343_-|integrase	tyrosine-type recombinase/integrase	integrase	Q5XLQ5	Enterobacteria_phage	25.7	8.4e-12
WP_011263423.1|657486_657837_+	DUF3319 domain-containing protein	NA	NA	NA	NA	NA
WP_005422748.1|657876_658188_+	stress response translation initiation inhibitor YciH	NA	NA	NA	NA	NA
WP_011263425.1|659900_661085_-	zona occludens toxin	NA	A0A0F6SIJ2	Vibrio_phage	63.4	2.6e-146
WP_011263426.1|661081_661366_-	DUF2523 domain-containing protein	NA	A0A0F6YNQ7	Vibrio_phage	57.4	1.6e-25
WP_011263427.1|661372_662578_-	hypothetical protein	NA	A0A0F6WBG7	Vibrio_phage	47.9	1.3e-15
661568:661584	attR	TTCAATTTCATTTTTAA	NA	NA	NA	NA
WP_011263428.1|662693_662939_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_011263429.1|663081_663408_-	RstB2 protein	NA	A0A0N9HE73	Vibrio_phage	46.2	1.2e-21
WP_011263430.1|663410_664565_-	replication initiation factor domain-containing protein	NA	U5TQR3	Satellite_phage	59.4	1.4e-128
WP_011263431.1|664686_665022_+	helix-turn-helix transcriptional regulator	NA	A0A0N9HJE7	Vibrio_phage	44.4	1.4e-20
