The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_002952	Staphylococcus aureus subsp. aureus MRSA252, complete genome	2902619	36402	90642	2902619	integrase,transposase	Streptococcus_phage(30.0%)	43	37639:37654	78591:78606
WP_001106057.1|36402_37077_-|transposase	IS6-like element IS257 family transposase	transposase	A0A0N9RU54	Staphylococcus_phage	99.1	2.6e-127
WP_001817892.1|37167_37365_-	protein rep	NA	A0A286QS97	Streptococcus_phage	62.0	1.2e-08
WP_000336290.1|37377_38151_-	protein rep	NA	NA	NA	NA	NA
37639:37654	attL	ATTATCTTTATTATTT	NA	NA	NA	NA
WP_000119405.1|38395_39658_-	plasmid recombination protein	NA	NA	NA	NA	NA
WP_001242578.1|40164_40569_-	bleomycin binding protein	NA	NA	NA	NA	NA
WP_001795128.1|40785_41556_-	aminoglycoside O-nucleotidyltransferase ANT(4')-Ia	NA	NA	NA	NA	NA
WP_001106057.1|41748_42423_-|transposase	IS6-like element IS257 family transposase	transposase	A0A0N9RU54	Staphylococcus_phage	99.1	2.6e-127
WP_000958858.1|43604_44348_+	glycerophosphoryl diester phosphodiesterase	NA	NA	NA	NA	NA
WP_000872606.1|44444_44873_+	MaoC family dehydratase	NA	NA	NA	NA	NA
WP_001801873.1|44918_46928_-	PBP2a family beta-lactam-resistant peptidoglycan transpeptidase MecA	NA	NA	NA	NA	NA
WP_000952923.1|47024_48782_+	beta-lactam sensor/signal transducer MecR1	NA	NA	NA	NA	NA
WP_000369213.1|48781_49126_+	mecA-type methicillin resistance repressor MecI	NA	NA	NA	NA	NA
WP_014532405.1|49237_49306_-	phenol-soluble modulin PSM-mec	NA	NA	NA	NA	NA
WP_111764890.1|49639_50770_+	ROK family transcriptional regulator	NA	NA	NA	NA	NA
WP_000438836.1|52250_53315_-	DsrE/DsrF/DrsH-like family protein	NA	NA	NA	NA	NA
WP_000220507.1|53450_53711_+	persulfide-sensing transcriptional repressor CstR	NA	NA	NA	NA	NA
WP_000350222.1|53710_54355_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_001092058.1|54693_55356_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_001072201.1|55889_56621_+	23S rRNA (adenine(2058)-N(6))-methyltransferase Erm(A)	NA	E4ZFQ0	Streptococcus_phage	47.5	1.9e-51
WP_000067268.1|56746_57529_-	aminoglycoside nucleotidyltransferase ANT(9)-Ia	NA	NA	NA	NA	NA
WP_000361059.1|57679_58057_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_001557544.1|58063_59956_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_000868132.1|59952_61038_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0A8WIF9	Clostridium_phage	28.3	4.5e-12
WP_000659050.1|61156_61474_-	RadC family protein	NA	NA	NA	NA	NA
WP_001092169.1|61494_62001_-	DUF1643 domain-containing protein	NA	NA	NA	NA	NA
WP_000700853.1|62018_62330_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000859155.1|62416_62767_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001186599.1|63284_64913_-	recombinase family protein	NA	A0A0S2SXR4	Bacillus_phage	31.4	4.2e-46
WP_000815654.1|64934_66284_-	recombinase family protein	NA	A0A2H4J388	uncultured_Caudovirales_phage	25.2	6.8e-18
WP_000195103.1|66517_68311_-	DUF927 domain-containing protein	NA	NA	NA	NA	NA
WP_000273824.1|68310_68607_-	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_001060127.1|68799_69846_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000858967.1|73396_74092_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_000446429.1|74066_76736_-	sensor histidine kinase KdpD	NA	A0A2K9L0Z8	Tupanvirus	21.5	6.0e-10
WP_000631574.1|76902_76983_+	K(+)-transporting ATPase subunit F	NA	NA	NA	NA	NA
WP_000029430.1|77003_78680_+	potassium-transporting ATPase subunit A	NA	NA	NA	NA	NA
78591:78606	attR	ATTATCTTTATTATTT	NA	NA	NA	NA
WP_000852430.1|78698_80720_+	K(+)-transporting ATPase subunit B	NA	E4ZFI9	Streptococcus_phage	29.0	6.6e-41
WP_000626133.1|81836_82706_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000411461.1|82715_83612_-	DUF927 domain-containing protein	NA	NA	NA	NA	NA
WP_001176969.1|84730_85357_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001001347.1|85471_86980_+	protein kinase	NA	NA	NA	NA	NA
WP_000891228.1|87144_89265_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_088356251.1|89513_90642_+|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	54.0	6.4e-78
>prophage 2
NC_002952	Staphylococcus aureus subsp. aureus MRSA252, complete genome	2902619	407562	423491	2902619	coat,integrase,terminase	Staphylococcus_phage(89.47%)	24	409098:409115	424197:424214
WP_001052483.1|407562_407754_-	hypothetical protein	NA	U3PCX8	Staphylococcus_phage	80.0	4.9e-23
WP_001261460.1|407997_408294_+	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_000934799.1|408314_408818_+	single-stranded DNA-binding protein	NA	A0A1W6JPL9	Staphylococcus_phage	74.7	1.2e-60
WP_000897044.1|408869_409112_+	30S ribosomal protein S18	NA	NA	NA	NA	NA
409098:409115	attL	AAAGAAGAACAATAATAT	NA	NA	NA	NA
WP_001800370.1|409343_410138_-	type II toxin-antitoxin system PemK/MazF family toxin	NA	Q4ZE81	Staphylococcus_phage	30.0	5.6e-28
WP_000270135.1|410175_411390_-|integrase	site-specific integrase	integrase	Q4ZE80	Staphylococcus_phage	97.3	3.3e-221
WP_000230361.1|411550_412174_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001611932.1|412322_412487_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001138305.1|412487_412760_+	winged helix-turn-helix domain-containing protein	NA	Q4ZE77	Staphylococcus_phage	94.4	1.2e-43
WP_000784892.1|412771_412945_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000403837.1|413115_413499_+	hypothetical protein	NA	A0A1W6JQI7	Staphylococcus_phage	96.1	4.8e-62
WP_001103967.1|413499_413826_+	DUF1474 family protein	NA	Q4ZE75	Staphylococcus_phage	96.3	3.5e-53
WP_001002709.1|413890_414760_+	primase C-terminal domain-containing protein	NA	Q4ZE74	Staphylococcus_phage	96.2	5.3e-165
WP_000447468.1|414773_416483_+	DUF927 domain-containing protein	NA	Q4ZE73	Staphylococcus_phage	92.8	8.2e-303
WP_000356942.1|416792_417173_+	hypothetical protein	NA	Q4ZE71	Staphylococcus_phage	96.8	1.7e-67
WP_001019762.1|417169_417811_+	hypothetical protein	NA	Q4ZE67	Staphylococcus_phage	92.5	4.7e-110
WP_001288442.1|418518_418863_+	hypothetical protein	NA	Q4ZE66	Staphylococcus_phage	91.7	1.3e-50
WP_000214170.1|418893_419547_+	hypothetical protein	NA	Q4ZE82	Staphylococcus_phage	99.5	7.6e-116
WP_000771361.1|419599_420127_+|coat	spore coat protein	coat	Q4ZE87	Staphylococcus_phage	100.0	6.8e-91
WP_001656917.1|420258_420471_+	hypothetical protein	NA	Q4ZE86	Staphylococcus_phage	97.1	5.4e-31
WP_001293071.1|420467_421037_+|terminase	terminase small subunit	terminase	Q4ZE85	Staphylococcus_phage	98.4	4.6e-101
WP_000801980.1|421313_422282_+	Abi family protein	NA	A0A0H4U080	Erysipelothrix_phage	27.3	2.7e-24
WP_073392942.1|422423_422861_+	DUF3102 domain-containing protein	NA	A0A2H4JAH5	uncultured_Caudovirales_phage	58.2	9.8e-27
WP_000813311.1|422978_423491_+	hypothetical protein	NA	Q4ZE83	Staphylococcus_phage	100.0	1.4e-69
424197:424214	attR	AAAGAAGAACAATAATAT	NA	NA	NA	NA
>prophage 3
NC_002952	Staphylococcus aureus subsp. aureus MRSA252, complete genome	2902619	734447	764374	2902619	bacteriocin,transposase	Staphylococcus_phage(41.67%)	31	NA	NA
WP_001105942.1|734447_735122_+|transposase	IS6-like element ISSau6 family transposase	transposase	A0A0N9RU54	Staphylococcus_phage	88.4	1.3e-113
WP_001035802.1|735156_735369_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000633163.1|735688_736024_+	recombinase family protein	NA	NA	NA	NA	NA
WP_000120605.1|736084_736399_+	As(III)-sensing metalloregulatory transcriptional repressor ArsR	NA	A0A2H4PQT4	Staphylococcus_phage	73.1	4.7e-39
WP_073392969.1|736395_737688_+	arsenite efflux transporter membrane subunit ArsB	NA	A0A2H4PQU3	Staphylococcus_phage	81.2	2.5e-187
WP_000358995.1|737705_738101_+	thioredoxin-dependent arsenate reductase	NA	A0A2H4PQT9	Staphylococcus_phage	86.3	8.5e-62
WP_000726502.1|738480_738774_+|bacteriocin	lactococcin 972 family bacteriocin	bacteriocin	NA	NA	NA	NA
WP_000713732.1|738848_740783_+|bacteriocin	bacteriocin-associated integral membrane family protein	bacteriocin	NA	NA	NA	NA
WP_000831610.1|740786_741098_+	YxeA family protein	NA	NA	NA	NA	NA
WP_000593106.1|741109_741736_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	33.7	6.1e-22
WP_000277743.1|742097_743744_+|transposase	IS1182-like element ISSau3 family transposase	transposase	A0ZS58	Staphylococcus_virus	99.8	6.1e-295
WP_001643491.1|743898_744276_+	plasmid recombination protein	NA	NA	NA	NA	NA
WP_001582045.1|744215_744542_+	plasmid recombination protein	NA	NA	NA	NA	NA
WP_000273007.1|744608_745109_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000145511.1|745473_746334_+	replication initiation protein	NA	NA	NA	NA	NA
WP_000761344.1|746420_746762_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001002795.1|746976_747072_-	type I toxin-antitoxin system Fst family toxin	NA	NA	NA	NA	NA
WP_000998976.1|749176_749602_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000713115.1|750463_750637_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000397995.1|750818_751142_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001791613.1|751370_751463_+	type I toxin-antitoxin system Fst family toxin	NA	NA	NA	NA	NA
WP_000377738.1|751764_752586_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000838599.1|752710_753706_+	YeiH family protein	NA	NA	NA	NA	NA
WP_000690626.1|754040_754616_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	51.7	2.9e-42
WP_000069452.1|754882_756928_+	copper-translocating P-type ATPase CopB	NA	E4ZFI9	Streptococcus_phage	29.2	2.3e-65
WP_000277154.1|756942_758376_+	multi-copper oxidase Mco	NA	NA	NA	NA	NA
WP_000277738.1|758442_760089_-|transposase	IS1182 family transposase	transposase	A0ZS58	Staphylococcus_virus	98.4	1.0e-289
WP_000378396.1|760451_762632_-	cadmium-translocating P-type ATPase CadA	NA	E4ZFI9	Streptococcus_phage	63.7	9.3e-251
WP_000159128.1|762624_762990_-	winged helix-turn-helix transcriptional regulator	NA	E4ZFI8	Streptococcus_phage	47.8	8.5e-24
WP_000361064.1|763227_763605_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001105942.1|763699_764374_+|transposase	IS6-like element ISSau6 family transposase	transposase	A0A0N9RU54	Staphylococcus_phage	88.4	1.3e-113
>prophage 4
NC_002952	Staphylococcus aureus subsp. aureus MRSA252, complete genome	2902619	794173	801993	2902619		Hokovirus(16.67%)	10	NA	NA
WP_000244416.1|794173_795229_-	two-component system sensor histidine kinase SaeS	NA	A0A1V0SGX0	Hokovirus	29.8	3.6e-14
WP_000149344.1|795228_795915_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_001037807.1|795889_796363_-	DoxX family protein	NA	NA	NA	NA	NA
WP_001093552.1|796704_797145_-	DM13 domain-containing protein	NA	NA	NA	NA	NA
WP_000637686.1|797424_798009_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001062968.1|798107_798821_-	7-carboxy-7-deazaguanine synthase QueE	NA	A0A1U9WRB6	Streptococcus_virus	43.5	6.5e-52
WP_000941336.1|798824_799244_-	6-carboxytetrahydropterin synthase QueD	NA	S4U060	uncultured_phage	28.7	6.3e-07
WP_000446724.1|799245_799914_-	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	57.5	9.6e-66
WP_000604508.1|800264_800858_+	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	44.0	6.8e-39
WP_001217804.1|800841_801993_+	anthranilate synthase component I family protein	NA	S4VNU7	Pandoravirus	36.1	2.1e-23
>prophage 5
NC_002952	Staphylococcus aureus subsp. aureus MRSA252, complete genome	2902619	813965	828103	2902619		uncultured_Caudovirales_phage(50.0%)	13	NA	NA
WP_000663016.1|813965_815024_+	histidinol-phosphate transaminase	NA	A0A0H3TLT9	Faustovirus	26.5	5.7e-20
WP_000197262.1|815182_815725_+	5'-3'-deoxyribonucleotidase	NA	NA	NA	NA	NA
WP_000429002.1|816276_817194_-	diacylglycerol kinase family lipid kinase	NA	A0A1V0SBJ0	Catovirus	22.0	8.2e-07
WP_031788440.1|817284_817386_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000193750.1|817463_818969_-	peptide MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	32.2	2.0e-58
WP_000930016.1|819308_819809_-	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	E7DN65	Pneumococcus_phage	66.2	2.7e-52
WP_001068491.1|819828_820695_-	DMT family transporter	NA	NA	NA	NA	NA
WP_000692521.1|821496_821895_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A2H4J545	uncultured_Caudovirales_phage	72.0	1.2e-52
WP_000855505.1|821857_823963_+	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A0A2H4J2N6	uncultured_Caudovirales_phage	91.7	0.0e+00
WP_000562498.1|824082_825054_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	A0A2H4J4P3	uncultured_Caudovirales_phage	91.3	4.2e-171
WP_000876311.1|825430_826402_+	ABC transporter permease	NA	A0A2H4IY97	uncultured_Caudovirales_phage	80.2	7.8e-141
WP_001245566.1|826388_827345_+	iron chelate uptake ABC transporter family permease subunit	NA	A0A2H4J116	uncultured_Caudovirales_phage	60.0	5.5e-06
WP_000616865.1|827341_828103_+	ABC transporter ATP-binding protein	NA	Q9EMR9	Amsacta_moorei_entomopoxvirus	30.1	7.2e-17
>prophage 6
NC_002952	Staphylococcus aureus subsp. aureus MRSA252, complete genome	2902619	998072	1049825	2902619	bacteriocin,tRNA,holin,protease,transposase	Bacillus_virus(25.0%)	45	NA	NA
WP_000121211.1|998072_999020_-|transposase	IS30-like element ISSau1 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	100.0	1.1e-184
WP_001067041.1|1000654_1001641_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.0	1.8e-15
WP_000427776.1|1001643_1002624_+	dipeptide ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.1	2.7e-16
WP_001574526.1|1002616_1003267_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_001180271.1|1003278_1004160_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_001794171.1|1006110_1007757_+|transposase	IS1182 family transposase	transposase	A0ZS58	Staphylococcus_virus	98.4	1.7e-289
WP_000448933.1|1007783_1008773_-|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_000258003.1|1009067_1009463_+	transcriptional regulator Spx	NA	NA	NA	NA	NA
WP_001217728.1|1009833_1010553_+	adaptor protein MecA	NA	NA	NA	NA	NA
WP_000959276.1|1010673_1011660_+	competence protein CoiA	NA	NA	NA	NA	NA
WP_000082722.1|1011707_1013516_+	oligoendopeptidase F	NA	A0A1X9I5X5	Streptococcus_phage	24.5	9.3e-47
WP_000896692.1|1013975_1014782_-	DsbA family protein	NA	NA	NA	NA	NA
WP_000214067.1|1014804_1015170_-	truncated hemoglobin	NA	NA	NA	NA	NA
WP_000224620.1|1015273_1015867_-	CYTH domain-containing protein	NA	NA	NA	NA	NA
WP_001242102.1|1016052_1016400_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001077683.1|1016416_1017052_+	GTP pyrophosphokinase family protein	NA	NA	NA	NA	NA
WP_001270834.1|1017068_1017878_+	NAD kinase	NA	NA	NA	NA	NA
WP_000669938.1|1017874_1018729_+	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
WP_000062404.1|1018749_1020135_+	magnesium transporter	NA	NA	NA	NA	NA
WP_000395156.1|1020144_1021989_+	monovalent cation:proton antiporter family protein	NA	NA	NA	NA	NA
WP_000933195.1|1022266_1023037_+	enoyl-ACP reductase FabI	NA	NA	NA	NA	NA
WP_000933105.1|1023232_1024318_-	AI-2E family transporter	NA	NA	NA	NA	NA
WP_000570704.1|1024659_1026228_+	alanine:cation symporter family protein	NA	NA	NA	NA	NA
WP_000889176.1|1026370_1027129_+	esterase family protein	NA	NA	NA	NA	NA
WP_001060545.1|1027294_1028020_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000355331.1|1028021_1028873_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000600387.1|1029614_1030124_+	2'-5' RNA ligase family protein	NA	NA	NA	NA	NA
WP_001154224.1|1030236_1031427_-	MFS transporter	NA	NA	NA	NA	NA
WP_000258651.1|1031404_1032580_-	diglucosyl diacylglycerol synthase	NA	NA	NA	NA	NA
WP_000340133.1|1033011_1034496_+	UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--L- lysine ligase	NA	NA	NA	NA	NA
WP_001794242.1|1034476_1034737_+	YueH family protein	NA	NA	NA	NA	NA
WP_001049957.1|1034736_1036299_+	peptide chain release factor 3	NA	A0A1S5SF82	Streptococcus_phage	28.2	2.2e-36
WP_000928413.1|1036600_1037404_+	TerC family protein	NA	S5MAL1	Bacillus_phage	40.5	1.6e-30
WP_001794169.1|1037622_1039947_+	trypsin-like peptidase domain-containing protein	NA	W5SAB9	Pithovirus	26.8	4.0e-10
WP_000021872.1|1039963_1041322_+	TrkH family potassium uptake protein	NA	NA	NA	NA	NA
WP_000414169.1|1041460_1042972_+	bifunctional metallophosphatase/5'-nucleotidase	NA	NA	NA	NA	NA
WP_000287265.1|1043460_1044030_-	competence protein ComK	NA	NA	NA	NA	NA
WP_000876825.1|1044239_1044458_+	IDEAL domain-containing protein	NA	NA	NA	NA	NA
WP_000668820.1|1044538_1045525_-	lipoate--protein ligase	NA	NA	NA	NA	NA
WP_000214898.1|1045723_1045900_+	YkvS family protein	NA	NA	NA	NA	NA
WP_001033867.1|1045914_1046517_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_099119695.1|1046817_1046895_+|holin	putative holin-like toxin	holin	NA	NA	NA	NA
WP_001790623.1|1047433_1047535_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001794574.1|1047544_1047817_+|bacteriocin	lactococcin 972 family bacteriocin	bacteriocin	NA	NA	NA	NA
WP_000870819.1|1047860_1049825_+|bacteriocin	bacteriocin-associated integral membrane family protein	bacteriocin	NA	NA	NA	NA
>prophage 7
NC_002952	Staphylococcus aureus subsp. aureus MRSA252, complete genome	2902619	1083821	1092294	2902619		Synechococcus_phage(33.33%)	9	NA	NA
WP_000861576.1|1083821_1084304_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	44.7	8.0e-22
WP_001010391.1|1084290_1085415_+	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_000174051.1|1085418_1086123_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	M4R1E8	Synechococcus_phage	41.6	7.3e-48
WP_000848351.1|1086122_1086386_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_000666808.1|1086387_1087059_+	phosphoribosylformylglycinamidine synthase I	NA	NA	NA	NA	NA
WP_000032734.1|1087051_1089241_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	39.2	5.1e-140
WP_000483716.1|1089219_1090704_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	31.4	8.5e-46
WP_000030814.1|1090696_1091725_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	41.4	7.6e-62
WP_000238673.1|1091727_1092294_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	40.1	3.6e-29
>prophage 8
NC_002952	Staphylococcus aureus subsp. aureus MRSA252, complete genome	2902619	1556832	1637413	2902619	tRNA,portal,tail,terminase,head,holin,capsid,protease,integrase,plate	Staphylococcus_phage(76.92%)	103	1591597:1591625	1637497:1637525
WP_000858795.1|1556832_1558125_-|tRNA	asparagine--tRNA ligase	tRNA	A0A2P1EMB4	Moumouvirus	30.0	4.3e-54
WP_000525060.1|1558446_1561140_-	ATP-dependent helicase DinG	NA	A0A1X9I5C8	Streptococcus_phage	34.4	8.2e-47
WP_000049917.1|1561163_1562135_-	biotin--[acetyl-CoA-carboxylase] ligase	NA	NA	NA	NA	NA
WP_000361536.1|1562121_1563324_-|tRNA	CCA tRNA nucleotidyltransferase	tRNA	H7BUW3	unidentified_phage	42.5	1.4e-35
WP_000690024.1|1563328_1564471_-	N-acetyl-alpha-D-glucosaminyl L-malate synthase BshA	NA	NA	NA	NA	NA
WP_000839927.1|1564714_1565032_-	nucleotide pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_001827022.1|1565367_1566048_-	zinc metallopeptidase	NA	NA	NA	NA	NA
WP_000154479.1|1566119_1566707_-	DUF1405 domain-containing protein	NA	NA	NA	NA	NA
WP_000005208.1|1566696_1567272_-	YpiB family protein	NA	G3MAV7	Bacillus_virus	27.2	4.6e-08
WP_000389521.1|1567285_1568530_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000245891.1|1568536_1569835_-	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_000776318.1|1569844_1570909_-	3-dehydroquinate synthase	NA	NA	NA	NA	NA
WP_001269937.1|1570934_1572101_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	32.3	1.5e-34
WP_000442480.1|1572569_1573019_-	nucleoside-diphosphate kinase	NA	D2E8E1	Anguillid_herpesvirus	43.8	2.4e-28
WP_001096481.1|1573110_1574070_-	polyprenyl synthetase family protein	NA	A0A1V0SE37	Indivirus	24.4	1.3e-10
WP_000774679.1|1574071_1574797_-	demethylmenaquinone methyltransferase	NA	NA	NA	NA	NA
WP_000450555.1|1574799_1575372_-	heptaprenyl diphosphate synthase component 1	NA	NA	NA	NA	NA
WP_001043863.1|1575802_1576075_-	HU family DNA-binding protein	NA	A7KV42	Bacillus_phage	73.3	4.2e-28
WP_000161753.1|1576245_1577244_-	NAD(P)H-dependent glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_000165530.1|1577260_1578571_-	ribosome biogenesis GTPase Der	NA	NA	NA	NA	NA
WP_000133953.1|1578792_1579968_-	30S ribosomal protein S1	NA	NA	NA	NA	NA
WP_001791199.1|1580224_1580416_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001791200.1|1580532_1580649_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000644393.1|1580679_1581339_-	(d)CMP kinase	NA	NA	NA	NA	NA
WP_000681744.1|1581415_1582384_+	asparaginase	NA	NA	NA	NA	NA
WP_001174260.1|1582498_1583485_-	YpdA family putative bacillithiol disulfide reductase	NA	NA	NA	NA	NA
WP_016186859.1|1583645_1583732_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000069298.1|1583869_1585330_-	elastin-binding protein EbpS	NA	NA	NA	NA	NA
WP_000902107.1|1585482_1586862_-	ATP-dependent DNA helicase RecQ	NA	L7RCS0	Acanthamoeba_polyphaga_moumouvirus	33.3	2.9e-56
WP_001163814.1|1586851_1587805_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001151997.1|1587912_1588161_+	ferredoxin	NA	A0A127AYY7	Bacillus_phage	48.0	8.3e-15
WP_001186908.1|1588266_1588812_-	ECF transporter S component	NA	NA	NA	NA	NA
WP_001799520.1|1589090_1589255_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000476878.1|1589459_1590368_-	DUF1672 domain-containing protein	NA	NA	NA	NA	NA
WP_000913238.1|1590425_1591331_-	DUF1672 domain-containing protein	NA	NA	NA	NA	NA
WP_000126130.1|1591420_1591636_-	hypothetical protein	NA	A0ZS61	Staphylococcus_virus	100.0	2.0e-25
1591597:1591625	attL	AAATAAACATATCATCATAATGAGATGGT	NA	NA	NA	NA
WP_000930261.1|1592357_1593812_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A0N6WMR3	Staphylococcus_phage	99.8	2.0e-289
WP_000339142.1|1593823_1594126_-|holin	phage holin	holin	A0A2I6PF56	Staphylococcus_phage	99.0	1.2e-47
WP_000466784.1|1594261_1594561_-	DUF2951 domain-containing protein	NA	A0A2I6PER2	Staphylococcus_phage	100.0	2.0e-31
WP_000916020.1|1594606_1594771_-	XkdX family protein	NA	A0A2I6PES4	Staphylococcus_phage	100.0	4.9e-24
WP_001166599.1|1594763_1595153_-	DUF2977 domain-containing protein	NA	A0A2I6PER1	Staphylococcus_phage	100.0	2.2e-62
WP_000067145.1|1595152_1596619_-|plate	BppU family phage baseplate upper protein	plate	A7TWK6	Staphylococcus_phage	99.0	6.0e-254
WP_000429551.1|1596618_1598529_-	minor structural protein	NA	A0A2I6PF35	Staphylococcus_phage	100.0	0.0e+00
WP_000179864.1|1598544_1598835_-	hypothetical protein	NA	R4WEC3	Staphylococcus_phage	100.0	2.1e-49
WP_000384474.1|1598834_1600418_-|tail	phage tail protein	tail	A0A2I6PEQ5	Staphylococcus_phage	100.0	9.3e-309
WP_001190533.1|1600426_1601251_-|tail	phage tail family protein	tail	A0A2I6PER3	Staphylococcus_phage	100.0	4.1e-159
WP_001003436.1|1601250_1607451_-|tail	phage tail tape measure protein	tail	U5U762	Staphylococcus_phage	98.6	0.0e+00
WP_000438833.1|1607464_1607623_-	hypothetical protein	NA	A0A2I6PES8	Staphylococcus_phage	100.0	1.2e-19
WP_000589167.1|1607664_1608015_-	hypothetical protein	NA	A0A2I6PEQ2	Staphylococcus_phage	100.0	1.1e-55
WP_000169127.1|1608072_1608528_-	Ig domain-containing protein	NA	A0A2I6PER6	Staphylococcus_phage	100.0	5.7e-78
WP_000807536.1|1608619_1609261_-|tail	tail protein	tail	A0A2I6PEP6	Staphylococcus_phage	100.0	5.9e-121
WP_001023806.1|1609295_1609691_-	DUF3168 domain-containing protein	NA	A0A2I6PEQ4	Staphylococcus_phage	100.0	8.8e-67
WP_000110023.1|1609691_1610093_-	hypothetical protein	NA	A0A2I6PF54	Staphylococcus_phage	100.0	8.1e-68
WP_000395502.1|1610089_1610422_-	hypothetical protein	NA	A0A2I6PEA5	Staphylococcus_phage	100.0	3.1e-57
WP_000050973.1|1610433_1610712_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2I6PEQ1	Staphylococcus_phage	100.0	2.1e-46
WP_001142734.1|1610780_1611944_-|capsid	phage major capsid protein	capsid	A0A2I6PEQ3	Staphylococcus_phage	100.0	1.2e-217
WP_000061871.1|1611955_1612729_-|protease	Clp protease ClpP	protease	A0A2I6PEQ7	Staphylococcus_phage	99.6	7.1e-137
WP_001100670.1|1612712_1613951_-|portal	phage portal protein	portal	A0A2I6PEA6	Staphylococcus_phage	100.0	6.9e-235
WP_000153547.1|1613955_1615647_-|terminase	terminase large subunit	terminase	A0A2I6PDP8	Staphylococcus_phage	99.6	0.0e+00
WP_000778932.1|1615636_1615942_-|terminase	P27 family phage terminase small subunit	terminase	A0A2I6PE27	Staphylococcus_phage	100.0	2.9e-49
WP_000160688.1|1616067_1616382_-	HNH endonuclease	NA	A0A2I6PDR3	Staphylococcus_phage	89.4	1.6e-50
WP_000528514.1|1616538_1616976_-	transcriptional regulator	NA	B5WZN8	Staphylococcus_phage	100.0	2.7e-77
WP_001793488.1|1616988_1618356_-	DEAD/DEAH box helicase	NA	A0A2I6PE95	Staphylococcus_phage	100.0	1.7e-263
WP_000665205.1|1618336_1618627_-	VRR-NUC domain-containing protein	NA	U5U7A3	Staphylococcus_phage	100.0	4.9e-51
WP_015978074.1|1618760_1618865_+	hypothetical protein	NA	A0A2I6PDP6	Staphylococcus_phage	100.0	2.7e-12
WP_000884880.1|1618967_1621415_-	virulence-associated E family protein	NA	M1RZC5	Staphylococcus_phage	99.1	0.0e+00
WP_000265258.1|1621467_1621668_-	DUF1514 family protein	NA	A0A2I6PF41	Staphylococcus_phage	100.0	2.9e-26
WP_000595237.1|1621735_1621888_-	transcriptional activator RinB	NA	B5WZN3	Staphylococcus_phage	100.0	2.6e-19
WP_000483477.1|1621880_1622117_-	hypothetical protein	NA	A7TWB3	Staphylococcus_phage	100.0	1.9e-37
WP_000195761.1|1622141_1622378_-	DUF1381 domain-containing protein	NA	M1T303	Staphylococcus_phage	100.0	9.6e-37
WP_001209216.1|1622394_1622568_-	hypothetical protein	NA	A0A1W6JQ45	Staphylococcus_phage	100.0	4.7e-25
WP_000185684.1|1622604_1623141_-	dUTP diphosphatase	NA	S4V978	Staphylococcus_phage	98.9	2.7e-95
WP_001065239.1|1623133_1623382_-	DUF1024 family protein	NA	Q9B0F3	Staphylococcus_virus	96.3	5.9e-37
WP_000615884.1|1623374_1623806_-	hypothetical protein	NA	Q4ZBT4	Staphylococcus_virus	99.3	1.6e-74
WP_000983947.1|1623805_1623997_-	hypothetical protein	NA	Q4ZBT5	Staphylococcus_virus	100.0	1.5e-27
WP_001062709.1|1623993_1624386_-	hypothetical protein	NA	A0A2I6PE39	Staphylococcus_phage	100.0	1.6e-68
WP_000132195.1|1624400_1624643_-	hypothetical protein	NA	Q4ZBT7	Staphylococcus_virus	93.8	7.5e-37
WP_000235324.1|1624657_1624858_-	hypothetical protein	NA	A0A2I6PEM3	Staphylococcus_phage	100.0	2.5e-30
WP_000022728.1|1624860_1625118_-	DUF3310 domain-containing protein	NA	A0A2I6PEN5	Staphylococcus_phage	100.0	2.6e-43
WP_000113974.1|1625117_1625519_-	PVL family protein	NA	A0A2I6PEL5	Staphylococcus_phage	100.0	1.2e-68
WP_001164629.1|1625518_1625704_-	DUF3113 family protein	NA	A0A2I6PEM8	Staphylococcus_phage	100.0	7.0e-27
WP_001819907.1|1625716_1627669_-	DNA polymerase	NA	A0A2I6PE86	Staphylococcus_phage	99.7	0.0e+00
WP_000645048.1|1627736_1628294_-	DUF2815 family protein	NA	A0A2I6PEP8	Staphylococcus_phage	100.0	1.8e-97
WP_000762529.1|1628319_1629486_-	DUF2800 domain-containing protein	NA	B5WZM3	Staphylococcus_phage	99.7	3.1e-221
WP_000985973.1|1629482_1629845_-	hypothetical protein	NA	B5WZM2	Staphylococcus_phage	99.2	3.2e-55
WP_000174999.1|1629859_1630183_-	hypothetical protein	NA	A0A2I6PE70	Staphylococcus_phage	99.1	3.2e-51
WP_001285948.1|1630261_1630423_-	DUF1270 domain-containing protein	NA	A9CR58	Staphylococcus_phage	98.1	1.1e-20
WP_001124193.1|1630435_1630699_-	helix-turn-helix domain-containing protein	NA	M1SVD9	Staphylococcus_phage	98.9	9.7e-46
WP_001097552.1|1630725_1630941_-	hypothetical protein	NA	A0A2I6PF01	Staphylococcus_phage	100.0	1.9e-31
WP_001128433.1|1630995_1631361_+	hypothetical protein	NA	A0A2I6PF07	Staphylococcus_phage	100.0	2.4e-63
WP_001025401.1|1631329_1631575_-	DUF2829 domain-containing protein	NA	A0A2I6PF15	Staphylococcus_phage	100.0	5.1e-41
WP_000773059.1|1631641_1632022_+	DUF2513 domain-containing protein	NA	Q4ZCQ5	Staphylococcus_virus	100.0	5.8e-68
WP_001148860.1|1632008_1632206_-	hypothetical protein	NA	A7TWF5	Staphylococcus_phage	100.0	4.6e-24
WP_000362644.1|1632275_1632488_+	hypothetical protein	NA	D2JGJ1	Staphylococcus_phage	100.0	7.6e-33
WP_000771849.1|1632528_1632678_-	hypothetical protein	NA	D2JGJ0	Staphylococcus_phage	100.0	1.4e-20
WP_000435362.1|1632692_1633136_-	hypothetical protein	NA	A7TWF2	Staphylococcus_phage	99.3	3.4e-75
WP_000333485.1|1633153_1633378_-	DUF739 family protein	NA	A0A2I6PE94	Staphylococcus_phage	100.0	2.7e-36
WP_001089477.1|1633539_1633920_+	helix-turn-helix domain-containing protein	NA	A0A2I6PE55	Staphylococcus_phage	99.2	1.5e-63
WP_000521395.1|1633941_1634400_+	hypothetical protein	NA	B2ZYU2	Staphylococcus_phage	100.0	1.2e-83
WP_000755719.1|1634417_1634852_+	hypothetical protein	NA	A0A2D1G561	Staphylococcus_phage	100.0	2.8e-26
WP_000449656.1|1634880_1635276_+	hypothetical protein	NA	A0ZS06	Staphylococcus_virus	100.0	1.7e-70
WP_001166482.1|1635474_1636098_-	hypothetical protein	NA	B7T0F3	Staphylococcus_virus	99.5	9.8e-105
WP_000264191.1|1636207_1637413_+|integrase	site-specific integrase	integrase	M1RZA8	Staphylococcus_phage	100.0	1.0e-222
1637497:1637525	attR	AAATAAACATATCATCATAATGAGATGGT	NA	NA	NA	NA
>prophage 9
NC_002952	Staphylococcus aureus subsp. aureus MRSA252, complete genome	2902619	1700965	1709277	2902619	tRNA	Staphylococcus_phage(16.67%)	7	NA	NA
WP_001213908.1|1700965_1701751_-	metal ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.3	8.0e-19
WP_000924211.1|1701876_1702767_-	deoxyribonuclease IV	NA	A0A2H4UU70	Bodo_saltans_virus	33.1	2.0e-26
WP_001062173.1|1702776_1704123_-	DEAD/DEAH box helicase	NA	A0A1V0SIR5	Klosneuvirus	34.0	1.4e-55
WP_000683921.1|1704236_1705337_-	Nif3-like dinuclear metal center hexameric protein	NA	A0A1S5V250	Saudi_moumouvirus	30.6	3.0e-08
WP_000624581.1|1705339_1706017_-|tRNA	tRNA (adenine-N(1))-methyltransferase	tRNA	NA	NA	NA	NA
WP_001283055.1|1706147_1707254_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	38.1	1.1e-37
WP_001217253.1|1707477_1709277_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	36.0	3.5e-54
>prophage 10
NC_002952	Staphylococcus aureus subsp. aureus MRSA252, complete genome	2902619	1778712	1787755	2902619	tRNA	uncultured_Mediterranean_phage(50.0%)	7	NA	NA
WP_000364542.1|1778712_1779231_-	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	46.5	5.6e-29
WP_000595001.1|1779252_1781526_-	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	29.3	6.2e-64
WP_000749802.1|1781728_1784008_-	protein translocase subunit SecDF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	35.8	1.8e-31
WP_001160682.1|1784282_1784543_-	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	35.3	8.2e-05
WP_001112045.1|1784561_1785701_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	44.7	5.4e-85
WP_001019178.1|1785723_1786749_-|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_001005767.1|1786750_1787755_-	Holliday junction branch migration DNA helicase RuvB	NA	B3GAM6	uncultured_virus	29.1	1.7e-05
>prophage 11
NC_002952	Staphylococcus aureus subsp. aureus MRSA252, complete genome	2902619	1924194	1971600	2902619	protease,tRNA	Staphylococcus_phage(94.44%)	45	NA	NA
WP_001050520.1|1924194_1930764_-	LPXTG-anchored repetitive surface protein SasC	NA	A0A2H4PQU6	Staphylococcus_phage	88.7	1.7e-295
WP_000836472.1|1931087_1931399_-	rhodanese-like domain-containing protein	NA	A0A2H4PQR9	Staphylococcus_phage	96.1	4.5e-50
WP_001573995.1|1931420_1933838_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	98.8	0.0e+00
WP_001025064.1|1934126_1935308_-	MFS transporter	NA	A0A2H4PQR6	Staphylococcus_phage	99.7	9.6e-218
WP_000526541.1|1935418_1936372_+	TIGR01212 family radical SAM protein	NA	A0A2H4PQV5	Staphylococcus_phage	99.3	6.4e-79
WP_000764425.1|1936368_1936932_+	class I SAM-dependent methyltransferase	NA	A0A2H4PQV0	Staphylococcus_phage	95.7	1.1e-99
WP_000757543.1|1937050_1937452_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000266099.1|1938024_1938852_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_014937042.1|1938854_1938974_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001196351.1|1939085_1940087_+	proline dehydrogenase	NA	A0A2H4PQT6	Staphylococcus_phage	99.1	5.0e-183
WP_001008556.1|1940208_1940673_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	97.4	1.9e-68
WP_001159032.1|1940685_1941867_-	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	99.7	6.6e-227
WP_000493891.1|1941877_1942510_-	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	99.0	8.4e-112
WP_000077342.1|1942516_1943560_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	98.3	5.9e-195
WP_001261683.1|1944040_1945543_-	FAD/NAD(P)-binding protein	NA	A0A2H4PQX2	Staphylococcus_phage	98.6	5.0e-30
WP_000221181.1|1946185_1946500_+	winged helix-turn-helix transcriptional regulator	NA	A0A2H4PQT4	Staphylococcus_phage	97.1	1.7e-52
WP_000989104.1|1946499_1947792_+	arsenite efflux transporter membrane subunit ArsB	NA	A0A2H4PQU3	Staphylococcus_phage	95.1	2.6e-216
WP_001032833.1|1947878_1948733_-	glucosaminidase domain-containing protein	NA	Q4ZCC7	Staphylococcus_virus	38.6	9.8e-39
WP_000384171.1|1949008_1949233_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000671059.1|1949431_1949902_+	RNA polymerase sigma factor	NA	A0A2H4PQT5	Staphylococcus_phage	85.8	7.7e-70
WP_001152695.1|1950014_1950458_+	competence protein ComK	NA	NA	NA	NA	NA
WP_001030476.1|1950444_1950888_-	hypothetical protein	NA	A0A2H4PQT8	Staphylococcus_phage	77.4	2.4e-49
WP_001168914.1|1951185_1951821_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_000492901.1|1951987_1952608_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_001096494.1|1953065_1953779_-	transaldolase	NA	M1PR54	Cyanophage	35.3	5.5e-19
WP_000091444.1|1954037_1954340_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001200542.1|1954594_1954960_+	fluoride efflux transporter CrcB	NA	A0A2H4PQR0	Staphylococcus_phage	100.0	3.6e-59
WP_000623481.1|1954956_1955310_+	CrcB family protein	NA	A0A2H4PQQ7	Staphylococcus_phage	97.4	4.2e-20
WP_000453309.1|1955559_1956393_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	99.3	2.7e-158
WP_000366165.1|1956604_1957513_-	NERD domain-containing protein	NA	A0A2H4PQQ8	Staphylococcus_phage	99.7	9.8e-138
WP_000933819.1|1957637_1958831_-	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	99.5	4.3e-218
WP_000109909.1|1959202_1960795_+	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	99.8	0.0e+00
WP_001801476.1|1961087_1961834_-	S9 family peptidase	NA	A0A2H4PQM6	Staphylococcus_phage	97.2	3.3e-139
WP_000672010.1|1961838_1962312_-	nucleoside triphosphatase YtkD	NA	A0A2H4PQM4	Staphylococcus_phage	98.1	9.5e-84
WP_000718107.1|1962377_1962635_+	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	100.0	7.2e-46
WP_000778539.1|1962631_1963633_-	o-succinylbenzoate synthase	NA	A0A2H4PQM0	Staphylococcus_phage	96.7	8.5e-183
WP_000348372.1|1963637_1965116_-	o-succinylbenzoate--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	97.2	2.4e-282
WP_016186903.1|1965274_1965730_-	DUF4909 domain-containing protein	NA	A0A2H4PQN7	Staphylococcus_phage	94.5	3.5e-75
WP_001794016.1|1966031_1966682_+	excalibur calcium-binding domain-containing protein	NA	A0A2H4PQM8	Staphylococcus_phage	88.4	1.0e-51
WP_000070654.1|1966762_1967758_+	DUF4352 domain-containing protein	NA	A0A2H4PQN2	Staphylococcus_phage	97.2	3.8e-74
WP_000669038.1|1967833_1968460_+	hypothetical protein	NA	A0A2H4PQM7	Staphylococcus_phage	84.1	4.5e-81
WP_000627550.1|1968500_1968845_+	DUF3969 family protein	NA	A0A2H4PQN6	Staphylococcus_phage	94.7	5.1e-55
WP_000414222.1|1968942_1969515_+	hypothetical protein	NA	A0A2H4PQN4	Staphylococcus_phage	94.8	3.2e-25
WP_001093574.1|1969663_1971031_-	FRG domain-containing protein	NA	NA	NA	NA	NA
WP_000125075.1|1971030_1971600_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A2H4PQN8	Staphylococcus_phage	54.8	2.2e-39
>prophage 12
NC_002952	Staphylococcus aureus subsp. aureus MRSA252, complete genome	2902619	2079581	2179886	2902619	tRNA,portal,tail,terminase,holin,head,capsid,protease,integrase,transposase	Staphylococcus_phage(87.65%)	119	2078909:2078928	2173540:2173559
2078909:2078928	attL	TTGGGGCCCCACCCCAACTT	NA	NA	NA	NA
WP_000545373.1|2079581_2081009_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB	tRNA	NA	NA	NA	NA
WP_000027924.1|2081021_2082479_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA	tRNA	NA	NA	NA	NA
WP_000170162.1|2082480_2082783_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC	tRNA	NA	NA	NA	NA
WP_000957023.1|2083149_2084688_+	sodium/proline symporter PutP	NA	NA	NA	NA	NA
WP_000831691.1|2084776_2085976_-	CamS family sex pheromone protein	NA	NA	NA	NA	NA
WP_000774552.1|2085988_2087992_-	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	36.1	9.8e-114
WP_000992926.1|2087995_2090188_-	DNA helicase PcrA	NA	A7KV33	Bacillus_phage	42.1	2.9e-135
WP_000272063.1|2090184_2090877_-	heptaprenylglyceryl phosphate synthase	NA	NA	NA	NA	NA
WP_001165363.1|2091059_2091362_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000572878.1|2091470_2092766_-	adenylosuccinate lyase	NA	A0A1B3B081	Gordonia_phage	32.9	1.6e-16
WP_000827736.1|2093616_2094783_+|protease	cysteine protease staphopain A	protease	NA	NA	NA	NA
WP_000434532.1|2094813_2095137_+	staphostatin A	NA	NA	NA	NA	NA
WP_000669861.1|2095430_2095604_-	NETI motif-containing protein	NA	NA	NA	NA	NA
WP_000011542.1|2095584_2096187_-	DUF2179 domain-containing protein	NA	NA	NA	NA	NA
WP_000040861.1|2096456_2097278_-	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	52.7	2.3e-69
WP_000284438.1|2097270_2098740_-	nicotinate phosphoribosyltransferase	NA	G3MA18	Bacillus_virus	44.5	1.9e-106
WP_000897633.1|2098923_2100000_+	nitric oxide synthase oxygenase	NA	NA	NA	NA	NA
WP_001177832.1|2100019_2100814_+	prephenate dehydratase	NA	NA	NA	NA	NA
WP_031788442.1|2100885_2100993_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000323171.1|2101003_2102566_-	SLC13 family permease	NA	NA	NA	NA	NA
WP_000275719.1|2102770_2103868_-	pectate lyase	NA	U5PWM6	Bacillus_phage	34.6	8.7e-48
WP_000149686.1|2104240_2104801_+	cysteine hydrolase	NA	G3MA16	Bacillus_virus	41.2	2.0e-32
WP_001140871.1|2104853_2105783_+	manganese-dependent inorganic pyrophosphatase	NA	NA	NA	NA	NA
WP_001790680.1|2105974_2106148_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001021224.1|2106199_2107579_+	aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_000181322.1|2107698_2108727_-	lactonase family protein	NA	NA	NA	NA	NA
WP_000205106.1|2108997_2109399_+	YolD-like family protein	NA	U3PG23	Staphylococcus_phage	42.9	6.0e-23
WP_000267034.1|2109455_2109629_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001188074.1|2110079_2111120_+	linear amide C-N hydrolase	NA	NA	NA	NA	NA
WP_000713064.1|2111176_2112019_-	DUF4097 family beta strand repeat protein	NA	NA	NA	NA	NA
WP_001033968.1|2112015_2112573_-	DUF1700 domain-containing protein	NA	NA	NA	NA	NA
WP_000966288.1|2112632_2113157_-	membrane protein	NA	NA	NA	NA	NA
WP_000182842.1|2113277_2113841_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_001221650.1|2113904_2114645_-	phenol-soluble modulin export ABC transporter permease subunit PmtD	NA	NA	NA	NA	NA
WP_000763048.1|2114644_2115517_-	phenol-soluble modulin export ABC transporter ATP-binding protein PmtC	NA	A0A2H4PQG7	Staphylococcus_phage	35.2	6.1e-28
WP_000645732.1|2115513_2116194_-	phenol-soluble modulin export ABC transporter permease subunit PmtB	NA	NA	NA	NA	NA
WP_000991315.1|2116194_2117091_-	phenol-soluble modulin export ABC transporter ATP-binding protein PmtA	NA	A0A2H4PQG7	Staphylococcus_phage	30.2	1.1e-16
WP_000691584.1|2117087_2117468_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000681966.1|2117725_2117902_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000990056.1|2118143_2118242_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001068528.1|2118441_2119728_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_000277709.1|2119975_2121622_-|transposase	IS1182-like element ISSau3 family transposase	transposase	A0ZS58	Staphylococcus_virus	99.8	7.9e-295
WP_000669729.1|2121919_2123989_-	MAP domain-containing protein	NA	NA	NA	NA	NA
WP_000669789.1|2124946_2125126_+	hypothetical protein	NA	A0A1W6JQ29	Staphylococcus_phage	100.0	2.2e-25
WP_001791826.1|2125436_2125697_+	hypothetical protein	NA	M9NS66	Staphylococcus_phage	100.0	2.3e-23
WP_000702263.1|2125749_2126100_-	complement inhibitor SCIN-A	NA	A0A1P8L6B0	Staphylococcus_phage	100.0	7.5e-54
WP_000727649.1|2126785_2127235_+	chemotaxis-inhibiting protein CHIPS	NA	A0A1P8L6A8	Staphylococcus_phage	100.0	1.1e-78
WP_000919350.1|2128314_2128806_-	staphylokinase	NA	A0A1X9H028	Staphylococcus_phage	100.0	9.5e-87
WP_000861038.1|2128997_2129753_-	CHAP domain-containing protein	NA	D2JLG5	Staphylococcus_phage	100.0	3.4e-152
WP_000611512.1|2129764_2130019_-|holin	phage holin	holin	D2JLG4	Staphylococcus_phage	100.0	4.1e-41
WP_001791821.1|2130070_2130178_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011447039.1|2130230_2130407_-|holin	putative holin-like toxin	holin	D2JLG3	Staphylococcus_phage	98.3	2.2e-22
WP_000750406.1|2130515_2131289_-	staphylococcal enterotoxin type A	NA	A0EX09	Staphylococcus_phage	100.0	2.2e-146
WP_000340977.1|2131709_2132084_-	hypothetical protein	NA	G4KNR3	Staphylococcus_phage	100.0	3.3e-39
WP_001040259.1|2132139_2132427_-	hypothetical protein	NA	G4KNR2	Staphylococcus_phage	100.0	9.9e-44
WP_001153681.1|2132473_2132626_-	hypothetical protein	NA	D2JLG0	Staphylococcus_phage	100.0	5.2e-20
WP_000582190.1|2132615_2136401_-	hypothetical protein	NA	A0EX05	Staphylococcus_phage	100.0	0.0e+00
WP_000567413.1|2136416_2137901_-|tail	phage tail family protein	tail	A0EX04	Staphylococcus_phage	100.0	4.5e-297
WP_010956610.1|2137897_2142427_-|tail	phage tail tape measure protein	tail	A0EX03	Staphylococcus_phage	99.9	0.0e+00
WP_001549167.1|2142483_2142621_-	hypothetical protein	NA	A0A2I6PDX7	Staphylococcus_phage	100.0	3.4e-18
WP_001096355.1|2142671_2143022_-	hypothetical protein	NA	G4KNQ8	Staphylococcus_phage	100.0	7.8e-59
WP_071621395.1|2143071_2143296_-	Ig-like domain-containing protein	NA	A0A075LYE8	Staphylococcus_phage	100.0	3.0e-32
WP_000268735.1|2143337_2143982_-|tail	phage tail protein	tail	A0EWZ9	Staphylococcus_phage	100.0	3.8e-120
WP_000565498.1|2143982_2144390_-	hypothetical protein	NA	G4KNQ6	Staphylococcus_phage	100.0	7.1e-72
WP_000755150.1|2144786_2145149_-|head,tail	head-tail adaptor protein	head,tail	G4KNQ4	Staphylococcus_phage	100.0	4.4e-65
WP_000150936.1|2145132_2145417_-|head,tail	phage head-tail adapter protein	head,tail	A0A2I6PDJ5	Staphylococcus_phage	100.0	2.3e-45
WP_000238236.1|2145406_2145691_-	hypothetical protein	NA	A0A2I6PDJ3	Staphylococcus_phage	100.0	1.8e-45
WP_000154559.1|2145710_2146856_-|capsid	phage major capsid protein	capsid	G4KNQ3	Staphylococcus_phage	100.0	9.6e-215
WP_000642728.1|2146879_2147617_-|protease	Clp protease ClpP	protease	G4KNQ2	Staphylococcus_phage	100.0	1.8e-129
WP_000025279.1|2147600_2148788_-|portal	phage portal protein	portal	A0A2I6PDI1	Staphylococcus_phage	99.5	9.6e-218
WP_000625088.1|2148803_2150465_-|terminase	terminase large subunit	terminase	A0A2I6PDJ8	Staphylococcus_phage	100.0	0.0e+00
WP_000402904.1|2150461_2150806_-	hypothetical protein	NA	G4KNP9	Staphylococcus_phage	100.0	9.4e-57
WP_000988336.1|2150935_2151235_-	HNH endonuclease	NA	A0EWY8	Staphylococcus_phage	100.0	4.6e-52
WP_000590122.1|2151466_2151883_-	hypothetical protein	NA	G4KNP7	Staphylococcus_phage	100.0	1.3e-76
WP_000265043.1|2151910_2152111_-	DUF1514 family protein	NA	A0A2I6PDV9	Staphylococcus_phage	100.0	1.4e-28
WP_000595265.1|2152110_2152260_-	transcriptional activator RinB	NA	A0A1W6JPZ2	Staphylococcus_phage	100.0	4.8e-18
WP_000592207.1|2152256_2152643_-	hypothetical protein	NA	W5R986	Staphylococcus_phage	100.0	3.0e-64
WP_000195803.1|2152639_2152846_-	DUF1381 domain-containing protein	NA	A0A0H3U2R7	Staphylococcus_phage	100.0	1.3e-29
WP_000185659.1|2152882_2153425_-	dUTP pyrophosphatase	NA	A0EWY2	Staphylococcus_phage	100.0	1.1e-96
WP_000028422.1|2153417_2153600_-	hypothetical protein	NA	A0EWY1	Staphylococcus_phage	100.0	2.6e-26
WP_001065092.1|2153589_2153841_-	DUF1024 family protein	NA	A0EWY0	Staphylococcus_phage	98.8	9.2e-38
WP_001624242.1|2153833_2154001_-	hypothetical protein	NA	A0EWX9	Staphylococcus_phage	100.0	7.8e-25
WP_000131366.1|2154012_2154255_-	hypothetical protein	NA	A0EWX8	Staphylococcus_phage	100.0	3.9e-41
WP_000101274.1|2154258_2154627_-	hypothetical protein	NA	W5RAK8	Staphylococcus_phage	100.0	8.2e-51
WP_000338531.1|2154957_2155176_-	hypothetical protein	NA	A0A2I6PDG4	Staphylococcus_phage	98.6	1.2e-36
WP_000934764.1|2156085_2156556_-	single-stranded DNA-binding protein	NA	A0EWX3	Staphylococcus_phage	100.0	7.4e-81
WP_071621397.1|2156556_2157174_-	MBL fold metallo-hydrolase	NA	S4SWA4	Staphylococcus_phage	100.0	9.1e-87
WP_000138472.1|2157254_2158175_-	recombinase RecT	NA	S4SUN6	Staphylococcus_phage	100.0	2.3e-166
WP_000700577.1|2158176_2160120_-	AAA family ATPase	NA	A0EWX0	Staphylococcus_phage	100.0	0.0e+00
WP_001205732.1|2160128_2160392_-	hypothetical protein	NA	A0A2I6PDG2	Staphylococcus_phage	100.0	7.7e-43
WP_000291503.1|2160400_2160661_-	DUF1108 family protein	NA	A0EWW8	Staphylococcus_phage	100.0	8.9e-44
WP_000165375.1|2160641_2160968_-	DUF2482 family protein	NA	W5RAK4	Staphylococcus_phage	100.0	1.2e-53
WP_000066017.1|2161062_2161224_-	DUF1270 domain-containing protein	NA	D2JGJ6	Staphylococcus_phage	100.0	4.3e-20
WP_001120197.1|2161220_2161541_-	DUF771 domain-containing protein	NA	A0A2I6PDH6	Staphylococcus_phage	100.0	1.5e-56
WP_000275058.1|2161599_2162232_+	hypothetical protein	NA	A7TW95	Staphylococcus_phage	100.0	1.5e-113
WP_000939496.1|2162246_2162387_-	hypothetical protein	NA	A0A2I6PDG0	Staphylococcus_phage	100.0	1.9e-16
WP_001148855.1|2162417_2162615_-	hypothetical protein	NA	Q8SDM8	Staphylococcus_phage	100.0	7.0e-33
WP_001148605.1|2162630_2163383_-	phage antirepressor KilAC domain-containing protein	NA	M9NTH5	Staphylococcus_phage	100.0	1.1e-139
WP_000128907.1|2163433_2163763_+	hypothetical protein	NA	M9NS98	Staphylococcus_phage	100.0	2.7e-53
WP_001025874.1|2163751_2163967_-	DUF2829 domain-containing protein	NA	A0EWV9	Staphylococcus_phage	100.0	6.3e-35
WP_000854072.1|2163982_2164246_-	helix-turn-helix transcriptional regulator	NA	A0A2I6PF09	Staphylococcus_phage	100.0	7.2e-41
WP_001801500.1|2164242_2164416_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001031454.1|2164378_2165092_+	helix-turn-helix transcriptional regulator	NA	M9NUL0	Staphylococcus_phage	100.0	1.2e-130
WP_000759680.1|2165107_2166040_+	ATP-dependent helicase	NA	A0A2I6PEZ7	Staphylococcus_phage	99.7	1.6e-172
WP_000591749.1|2166045_2166387_+	hypothetical protein	NA	A0A2I6PF04	Staphylococcus_phage	100.0	4.6e-56
WP_000705248.1|2166590_2166773_+	hypothetical protein	NA	M9NSW6	Staphylococcus_phage	100.0	4.1e-27
WP_000825947.1|2166872_2167337_+	hypothetical protein	NA	A0EWV3	Staphylococcus_phage	100.0	1.1e-28
WP_000857191.1|2167395_2168433_+|integrase	site-specific integrase	integrase	A0EWV2	Staphylococcus_phage	100.0	9.1e-180
WP_102948857.1|2168463_2169315_+	sphingomyelin phosphodiesterase	NA	A0A1P8L6H7	Staphylococcus_phage	99.3	2.2e-155
WP_000595617.1|2169571_2170591_-	leukocidin/hemolysin toxin family protein	NA	A0A2I6PEU3	Staphylococcus_phage	39.6	3.4e-54
WP_000791402.1|2170612_2171668_-	succinyl-diaminopimelate desuccinylase	NA	A0A2I6PER8	Staphylococcus_phage	34.6	7.9e-38
WP_000206618.1|2172099_2173323_+	ArgE/DapE family deacylase	NA	NA	NA	NA	NA
WP_001045073.1|2173761_2175069_+	TrkH family potassium uptake protein	NA	NA	NA	NA	NA
2173540:2173559	attR	TTGGGGCCCCACCCCAACTT	NA	NA	NA	NA
WP_001573771.1|2175646_2175988_-	hypothetical protein	NA	C8CH40	Staphylococcus_phage	46.0	4.1e-20
WP_001573769.1|2175977_2176274_-	hypothetical protein	NA	C8CH40	Staphylococcus_phage	40.4	6.7e-11
WP_000201397.1|2176270_2176450_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000240651.1|2176991_2178608_-	chaperonin GroEL	NA	A0A240F779	uncultured_virus	54.7	2.6e-157
WP_000917289.1|2178683_2178968_-	co-chaperone GroES	NA	A0A221S386	uncultured_virus	46.2	4.7e-14
WP_000197638.1|2179142_2179886_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
