The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_013854	Azospirillum sp. B510, complete genome	3311395	910747	957332	3311395	portal,terminase,tail,transposase,protease,capsid	Azospirillum_phage(31.25%)	41	NA	NA
WP_173380468.1|910747_911499_-|transposase	IS5-like element ISAzs9 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	52.6	5.6e-30
WP_012973435.1|912174_912405_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012973436.1|912476_913208_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012973437.1|913271_915386_-	ParB/RepB/Spo0J family partition protein	NA	G8DH78	Emiliania_huxleyi_virus	31.7	1.9e-30
WP_042442500.1|915551_915779_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012973438.1|915841_916783_-	DUF1738 domain-containing protein	NA	A0A1V0EEV1	Caulobacter_phage	39.1	3.0e-49
WP_012973439.1|917138_918122_+	ATP-binding protein	NA	E5EQU5	Bathycoccus_sp._RCC1105_virus	27.7	1.9e-14
WP_042442503.1|920923_921205_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012973441.1|921188_921992_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_012973442.1|921978_922617_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042442506.1|922718_923051_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042442510.1|923509_923734_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052293660.1|924421_924670_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148219190.1|924794_925616_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_012973445.1|925712_926276_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012973447.1|926696_927449_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012973448.1|927488_928010_-	YgjV family protein	NA	NA	NA	NA	NA
WP_158305961.1|928033_928405_-	ribbon-helix-helix domain-containing protein	NA	NA	NA	NA	NA
WP_012973450.1|928567_928975_-	hypothetical protein	NA	A0A218MKV5	uncultured_virus	50.6	7.8e-18
WP_012973451.1|929101_929752_-	hypothetical protein	NA	V5Q8V7	Xylella_phage	41.9	2.5e-26
WP_148219360.1|930015_933348_-	LamG domain-containing protein	NA	Q5DN17	Alphaproteobacteria_virus	24.7	6.6e-22
WP_012973453.1|934067_934994_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012973454.1|934995_936585_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052293623.1|936596_945251_-|tail	phage tail length tape measure family protein	tail	A0A1P8CWQ1	Bacillus_phage	37.4	1.6e-11
WP_148219191.1|945373_945892_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012973456.1|945888_946644_-	hypothetical protein	NA	B0VK42	Azospirillum_phage	56.6	9.9e-67
WP_042442518.1|946647_946938_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162470990.1|946857_947019_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042442520.1|947027_947432_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042442522.1|947577_947814_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012973458.1|947824_949315_-	hypothetical protein	NA	B0VK40	Azospirillum_phage	44.4	1.3e-110
WP_042442524.1|949399_949624_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012973459.1|949629_950088_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148219192.1|950092_950434_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012973460.1|950441_951101_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012973461.1|951226_951409_-	hypothetical protein	NA	B0VK36	Azospirillum_phage	61.9	1.0e-06
WP_012973462.1|951459_951864_-	hypothetical protein	NA	B0VK34	Azospirillum_phage	43.8	6.3e-20
WP_012973463.1|951943_953173_-|capsid	phage major capsid protein	capsid	B0VK33	Azospirillum_phage	35.2	1.2e-40
WP_052293624.1|953184_954111_-|protease	Clp protease ClpP	protease	Q9EYD3	Enterobacteria_phage	51.9	5.7e-32
WP_012973465.1|954113_955532_-|portal	phage portal protein	portal	A0A1J0GUY8	Halomonas_phage	27.4	1.1e-29
WP_148219193.1|955541_957332_-|terminase	terminase large subunit	terminase	A0A1J0GUY5	Halomonas_phage	38.4	5.0e-101
>prophage 2
NC_013854	Azospirillum sp. B510, complete genome	3311395	966775	978511	3311395		Tupanvirus(11.11%)	19	NA	NA
WP_012973477.1|966775_967690_-	ATP-binding protein	NA	A0A2K9L1J2	Tupanvirus	33.1	2.7e-18
WP_012973478.1|967689_968448_-	DUF2312 domain-containing protein	NA	NA	NA	NA	NA
WP_052293625.1|968435_968927_-	DUF1064 domain-containing protein	NA	B0VK09	Azospirillum_phage	45.3	3.1e-21
WP_042442541.1|968926_969640_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042442543.1|969636_970098_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_158305962.1|970094_970490_-	hypothetical protein	NA	A0A076GD02	Sinorhizobium_phage	47.7	1.3e-17
WP_012973482.1|970634_971477_-	DUF4942 domain-containing protein	NA	A0A1J0GUW2	Halomonas_phage	28.1	4.4e-23
WP_012973483.1|971473_972151_-	hypothetical protein	NA	A0A0U2BXG7	Paracoccus_phage	40.2	7.5e-34
WP_012973484.1|972140_972728_-	Rieske 2Fe-2S domain-containing protein	NA	NA	NA	NA	NA
WP_042442545.1|972730_972910_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012973485.1|972909_973899_-	phage Gp37/Gp68 family protein	NA	A0A1B3B211	Gordonia_phage	40.4	6.9e-60
WP_042442546.1|973891_974176_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012973486.1|974181_976167_-	DNA cytosine methyltransferase	NA	Q9ZXI4	Pseudomonas_virus	57.1	1.2e-156
WP_042442547.1|976175_976358_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052293628.1|976362_976719_-	hypothetical protein	NA	J7I0Y4	Acinetobacter_phage	33.0	6.0e-06
WP_042442548.1|976736_977054_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012973488.1|977050_977395_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042442549.1|977397_978084_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086935385.1|978256_978511_-	helix-turn-helix domain-containing protein	NA	A0A0R6PJ81	Moraxella_phage	49.2	8.0e-05
>prophage 3
NC_013854	Azospirillum sp. B510, complete genome	3311395	1282319	1337234	3311395	transposase	Acidithiobacillus_phage(20.0%)	48	NA	NA
WP_012973655.1|1282319_1283612_+|transposase	IS701-like element ISAzs6 family transposase	transposase	NA	NA	NA	NA
WP_173380468.1|1283644_1284396_-|transposase	IS5-like element ISAzs9 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	52.6	5.6e-30
WP_148219224.1|1285039_1285567_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042442632.1|1286226_1286502_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162470991.1|1286498_1287323_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012973750.1|1287261_1287522_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012973751.1|1287518_1288550_+	fatty acid desaturase	NA	NA	NA	NA	NA
WP_012973752.1|1288863_1289430_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086935391.1|1289515_1289938_+	YsnF/AvaK domain-containing protein	NA	NA	NA	NA	NA
WP_012973754.1|1289972_1290713_+	YsnF/AvaK domain-containing protein	NA	NA	NA	NA	NA
WP_158305965.1|1291361_1295882_+	PAS domain-containing protein	NA	Q8QNA2	Ectocarpus_siliculosus_virus	27.5	3.3e-16
WP_042442636.1|1296601_1296898_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148219227.1|1297017_1297200_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012973756.1|1297362_1299198_+	Kef family K(+) transporter	NA	NA	NA	NA	NA
WP_148219228.1|1299398_1299806_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012973758.1|1299980_1300586_+	exopolysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_012973759.1|1300712_1302353_-|transposase	ISL3-like element ISAzs13 family transposase	transposase	NA	NA	NA	NA
WP_012973761.1|1302796_1304965_+	ParB/RepB/Spo0J family partition protein	NA	G8DH78	Emiliania_huxleyi_virus	33.0	7.0e-33
WP_012973762.1|1305031_1309405_+	strawberry notch family protein	NA	A0A076FMQ0	Aureococcus_anophage	24.8	2.3e-38
WP_012973763.1|1309417_1310446_+	toprim domain-containing protein	NA	K4HZY1	Acidithiobacillus_phage	41.5	6.1e-11
WP_012973764.1|1310758_1311697_+	DUF2493 domain-containing protein	NA	A0A291L9X7	Bordetella_phage	42.7	1.1e-17
WP_148219229.1|1312004_1312946_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012976163.1|1313092_1313914_-|transposase	IS5-like element ISAli1 family transposase	transposase	NA	NA	NA	NA
WP_012973766.1|1314267_1315344_-|transposase	IS5-like element ISAzs10 family transposase	transposase	NA	NA	NA	NA
WP_012973767.1|1315752_1316004_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_012973768.1|1316013_1316889_+	replication initiator protein A	NA	A0A0K1Y6J9	Rhodobacter_phage	32.8	8.8e-27
WP_012973769.1|1317108_1317747_+	AAA family ATPase	NA	K7R2R7	Vibrio_phage	40.5	1.9e-34
WP_012973770.1|1317743_1317983_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012973771.1|1317979_1318633_+	chromosome partitioning protein	NA	A0A222YXS3	Escherichia_phage	27.8	3.0e-11
WP_042442640.1|1318948_1319692_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042442642.1|1319688_1320048_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042442644.1|1320044_1321529_+	type IV secretory system conjugative DNA transfer family protein	NA	NA	NA	NA	NA
WP_042442646.1|1321525_1321897_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012973774.1|1321893_1322931_+	CpaF family protein	NA	NA	NA	NA	NA
WP_086935341.1|1322914_1323205_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042442651.1|1323208_1323541_+	VirB3 family type IV secretion system protein	NA	NA	NA	NA	NA
WP_012973776.1|1323544_1326016_+	conjugal transfer protein TrbE-like	NA	NA	NA	NA	NA
WP_012973777.1|1326012_1326918_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042442653.1|1326921_1327116_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012973778.1|1327122_1328418_+	type IV secretion system protein	NA	NA	NA	NA	NA
WP_012973779.1|1328414_1329185_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012973780.1|1329181_1330138_+	TrbG/VirB9 family P-type conjugative transfer protein	NA	NA	NA	NA	NA
WP_012973781.1|1330134_1331142_+	TrbI/VirB10 family protein	NA	NA	NA	NA	NA
WP_012973782.1|1331441_1333553_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_012973783.1|1333549_1334362_-	SIR2 family protein	NA	NA	NA	NA	NA
WP_148219230.1|1334390_1334747_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012972684.1|1334953_1335709_-	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	47.9	2.7e-56
WP_012973785.1|1335719_1337234_-|transposase	IS21-like element ISAzs2 family transposase	transposase	NA	NA	NA	NA
>prophage 4
NC_013854	Azospirillum sp. B510, complete genome	3311395	2028330	2068386	3311395	holin,plate	Ralstonia_phage(20.0%)	31	NA	NA
WP_012974390.1|2028330_2029665_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_012974391.1|2029709_2030876_-	FHA domain-containing protein	NA	NA	NA	NA	NA
WP_012974392.1|2030880_2031465_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012974393.1|2031525_2033646_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	30.6	2.3e-44
WP_012974394.1|2033768_2034245_-	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_012974395.1|2034415_2037103_-	type VI secretion system ATPase TssH	NA	H6X3M6	Enterobacteria_phage	31.0	1.0e-81
WP_012974396.1|2037293_2038361_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_012974397.1|2038365_2038749_-	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_042442883.1|2038768_2038984_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012974399.1|2039316_2040450_+	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_012974400.1|2040494_2041001_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_012974401.1|2041005_2042499_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_012974402.1|2042520_2044077_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_012974403.1|2044114_2044912_+	SciE type virulence protein	NA	NA	NA	NA	NA
WP_012974404.1|2044999_2045476_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_012974405.1|2045468_2047301_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_012974406.1|2047264_2048350_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_012974407.1|2048391_2049933_+	methyltransferase regulatory domain-containing protein	NA	NA	NA	NA	NA
WP_042442885.1|2049970_2050711_-	SEL1-like repeat protein	NA	NA	NA	NA	NA
WP_148219271.1|2050966_2051614_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_012974410.1|2051610_2053119_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_012974411.1|2053122_2056809_+	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_012974412.1|2056790_2058836_+	serine/threonine protein kinase	NA	S4VYW6	Pandoravirus	31.4	4.5e-21
WP_158305971.1|2058879_2059311_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_042442889.1|2059695_2059881_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148219394.1|2059966_2061811_-	response regulator	NA	NA	NA	NA	NA
WP_012974416.1|2061909_2064120_-	response regulator	NA	NA	NA	NA	NA
WP_012974417.1|2064245_2064758_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012974418.1|2064930_2065353_-	nucleoside-diphosphate kinase	NA	M1PH31	Moumouvirus	34.8	6.0e-13
WP_042443701.1|2065592_2066525_-|holin	choline ABC transporter substrate-binding protein	holin	NA	NA	NA	NA
WP_012974420.1|2066673_2068386_-|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	29.2	7.7e-51
>prophage 5
NC_013854	Azospirillum sp. B510, complete genome	3311395	2110371	2166309	3311395	tRNA,transposase,protease	Bacillus_virus(21.43%)	56	NA	NA
WP_012974462.1|2110371_2111073_-|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_012974463.1|2111294_2112092_+	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_042442905.1|2112141_2113620_-	PAS domain-containing methyl-accepting chemotaxis protein	NA	NA	NA	NA	NA
WP_012974465.1|2113986_2115123_+	DNA-protecting protein DprA	NA	S6BFL3	Thermus_phage	40.2	1.9e-29
WP_012974466.1|2115169_2117968_+	type I DNA topoisomerase	NA	A0A0G2Y787	Acanthamoeba_polyphaga_mimivirus	30.3	3.2e-94
WP_012974467.1|2118219_2119038_+	enoyl-CoA hydratase	NA	NA	NA	NA	NA
WP_012974468.1|2119034_2119565_+	CoA-binding protein	NA	NA	NA	NA	NA
WP_012974469.1|2119586_2120882_+	O-acetylhomoserine aminocarboxypropyltransferase	NA	NA	NA	NA	NA
WP_012974470.1|2120904_2122146_-	MFS transporter	NA	NA	NA	NA	NA
WP_012974471.1|2122412_2123189_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_012974472.1|2123196_2123619_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_012974473.1|2123615_2124491_-	16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))- dimethyltransferase RsmA	NA	NA	NA	NA	NA
WP_012974474.1|2124608_2124917_-	AzlD domain-containing protein	NA	NA	NA	NA	NA
WP_148219396.1|2124909_2125638_-	AzlC family ABC transporter permease	NA	NA	NA	NA	NA
WP_012974476.1|2125654_2126551_-	AraC family transcriptional regulator	NA	A0A291LAM3	Bordetella_phage	37.5	2.9e-09
WP_012974477.1|2126745_2127300_+	DUF4405 domain-containing protein	NA	NA	NA	NA	NA
WP_148219276.1|2127454_2128135_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012974478.1|2128131_2128686_-	zeta toxin family protein	NA	NA	NA	NA	NA
WP_012974479.1|2129099_2132582_-	DEAD/DEAH box helicase	NA	A0A0P0CJA9	Ostreococcus_lucimarinus_virus	33.0	8.1e-47
WP_148219277.1|2132771_2133437_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_012974481.1|2133537_2134932_-	PleD family two-component system response regulator	NA	G3MA91	Bacillus_virus	38.3	1.2e-22
WP_012974482.1|2134973_2135381_-	response regulator	NA	Q6XM27	Feldmannia_irregularis_virus	27.4	3.1e-06
WP_012974483.1|2135645_2136362_-	GGDEF domain-containing protein	NA	G3MA91	Bacillus_virus	29.8	9.5e-11
WP_148219278.1|2136576_2137593_-	D-glycerate dehydrogenase	NA	M1HUT5	Acanthocystis_turfacea_Chlorella_virus	26.5	4.9e-21
WP_148219279.1|2137702_2138575_+	DUF1849 family protein	NA	NA	NA	NA	NA
WP_042442910.1|2138766_2138994_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012974486.1|2139039_2140359_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.2	1.4e-76
WP_042442912.1|2140366_2140735_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042442914.1|2140860_2141121_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012974487.1|2141131_2141710_-	DedA family protein	NA	NA	NA	NA	NA
WP_012974488.1|2141866_2142289_-	50S ribosomal protein L17	NA	NA	NA	NA	NA
WP_012974489.1|2142451_2143468_-	DNA-directed RNA polymerase subunit alpha	NA	NA	NA	NA	NA
WP_012974490.1|2143604_2144003_-	30S ribosomal protein S11	NA	NA	NA	NA	NA
WP_012974491.1|2144018_2144387_-	30S ribosomal protein S13	NA	NA	NA	NA	NA
WP_012974492.1|2144597_2145155_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_012974493.1|2145398_2147540_-	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	28.0	4.5e-56
WP_012974494.1|2147769_2148117_-	RidA family protein	NA	NA	NA	NA	NA
WP_042443718.1|2148214_2148967_-|protease	trypsin-like serine protease	protease	NA	NA	NA	NA
WP_012974496.1|2149042_2151325_+	DNA topoisomerase III	NA	A0A1V0SCS0	Indivirus	22.5	8.8e-18
WP_042442917.1|2152189_2152444_+	cyclic nucleotide-binding domain-containing protein	NA	NA	NA	NA	NA
WP_012974499.1|2152418_2152676_+	winged helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_086935355.1|2152614_2153274_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_148219280.1|2153370_2153823_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012974500.1|2153840_2154905_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012974501.1|2155133_2156024_-	DMT family transporter	NA	B0VK01	Azospirillum_phage	31.0	4.2e-24
WP_012974502.1|2156016_2156262_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_042442921.1|2156704_2157577_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_042442923.1|2159384_2159708_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_012974505.1|2159704_2160127_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012974506.1|2160130_2160820_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148219281.1|2160998_2161430_+	hypothetical protein	NA	NA	NA	NA	NA
WP_173380477.1|2161572_2162324_-|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	52.6	5.6e-30
WP_042442929.1|2162413_2162632_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012974508.1|2162889_2164230_+|transposase	IS1380-like element ISAzs3 family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	28.7	1.3e-37
WP_012974509.1|2164468_2164954_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148219284.1|2165213_2166309_+|transposase	IS630-like element ISAzs14 family transposase	transposase	NA	NA	NA	NA
>prophage 6
NC_013854	Azospirillum sp. B510, complete genome	3311395	2295216	2340983	3311395	portal,terminase,tail,protease,tRNA,capsid	Azospirillum_phage(28.57%)	54	NA	NA
WP_012974621.1|2295216_2296392_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_012973490.1|2296592_2298230_-	recombinase family protein	NA	R9TP69	Rhizobium_phage	37.8	7.6e-88
WP_158305963.1|2298232_2298388_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086935334.1|2298498_2298984_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_086935385.1|2299068_2299323_+	helix-turn-helix domain-containing protein	NA	A0A0R6PJ81	Moraxella_phage	49.2	8.0e-05
WP_042442549.1|2299495_2300182_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012973488.1|2300184_2300529_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042442548.1|2300525_2300843_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052293628.1|2300860_2301217_+	hypothetical protein	NA	J7I0Y4	Acinetobacter_phage	33.0	6.0e-06
WP_042442547.1|2301221_2301404_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012973486.1|2301412_2303398_+	DNA cytosine methyltransferase	NA	Q9ZXI4	Pseudomonas_virus	57.1	1.2e-156
WP_042442546.1|2303403_2303688_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012973485.1|2303680_2304670_+	phage Gp37/Gp68 family protein	NA	A0A1B3B211	Gordonia_phage	40.4	6.9e-60
WP_042442545.1|2304669_2304849_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012973484.1|2304851_2305439_+	Rieske 2Fe-2S domain-containing protein	NA	NA	NA	NA	NA
WP_012973483.1|2305428_2306106_+	hypothetical protein	NA	A0A0U2BXG7	Paracoccus_phage	40.2	7.5e-34
WP_012973482.1|2306102_2306945_+	DUF4942 domain-containing protein	NA	A0A1J0GUW2	Halomonas_phage	28.1	4.4e-23
WP_158305962.1|2307089_2307485_+	hypothetical protein	NA	A0A076GD02	Sinorhizobium_phage	47.7	1.3e-17
WP_042442543.1|2307481_2307943_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_042442541.1|2307939_2308653_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052293625.1|2308652_2309144_+	DUF1064 domain-containing protein	NA	B0VK09	Azospirillum_phage	45.3	3.1e-21
WP_012973478.1|2309131_2309890_+	DUF2312 domain-containing protein	NA	NA	NA	NA	NA
WP_012973477.1|2309889_2310804_+	ATP-binding protein	NA	A0A2K9L1J2	Tupanvirus	33.1	2.7e-18
WP_042442539.1|2310808_2311063_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012973476.1|2311063_2311768_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012973475.1|2311798_2312866_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012973474.1|2312918_2313890_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012973473.1|2314244_2315654_+	ParB N-terminal domain-containing protein	NA	A0A0E3U266	Fusobacterium_phage	34.4	5.0e-64
WP_012973472.1|2315625_2316120_+	hypothetical protein	NA	D9ZNH6	Clostridium_phage	44.0	7.0e-29
WP_148219197.1|2316222_2316456_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148219196.1|2316565_2317027_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042442533.1|2317052_2317322_-	DUF4160 domain-containing protein	NA	NA	NA	NA	NA
WP_012973469.1|2317467_2318166_-	DUF3489 domain-containing protein	NA	NA	NA	NA	NA
WP_042442532.1|2318482_2318806_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148219194.1|2319080_2319434_+|terminase	P27 family phage terminase small subunit	terminase	NA	NA	NA	NA
WP_042442528.1|2319886_2320303_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148219193.1|2320247_2322038_+|terminase	terminase large subunit	terminase	A0A1J0GUY5	Halomonas_phage	38.4	5.0e-101
WP_012973465.1|2322047_2323466_+|portal	phage portal protein	portal	A0A1J0GUY8	Halomonas_phage	27.4	1.1e-29
WP_052293624.1|2323468_2324395_+|protease	Clp protease ClpP	protease	Q9EYD3	Enterobacteria_phage	51.9	5.7e-32
WP_012973463.1|2324406_2325636_+|capsid	phage major capsid protein	capsid	B0VK33	Azospirillum_phage	35.2	1.2e-40
WP_012973462.1|2325715_2326120_+	hypothetical protein	NA	B0VK34	Azospirillum_phage	43.8	6.3e-20
WP_012973461.1|2326170_2326353_+	hypothetical protein	NA	B0VK36	Azospirillum_phage	61.9	1.0e-06
WP_012973460.1|2326478_2327138_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148219192.1|2327145_2327487_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012973459.1|2327491_2327950_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042442524.1|2327955_2328180_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012973458.1|2328264_2329755_+	hypothetical protein	NA	B0VK40	Azospirillum_phage	44.4	1.3e-110
WP_042442522.1|2329765_2330002_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042442520.1|2330147_2330552_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162470990.1|2330560_2330722_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042442518.1|2330641_2330932_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012973456.1|2330935_2331691_+	hypothetical protein	NA	B0VK42	Azospirillum_phage	56.6	9.9e-67
WP_148219191.1|2331687_2332206_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052293623.1|2332328_2340983_+|tail	phage tail length tape measure family protein	tail	A0A1P8CWQ1	Bacillus_phage	37.4	1.6e-11
>prophage 7
NC_013854	Azospirillum sp. B510, complete genome	3311395	3087016	3138138	3311395	tRNA,integrase,transposase	Bacillus_virus(16.67%)	38	3078958:3078977	3105381:3105400
3078958:3078977	attL	CCGCCGTCAGGTCGCGGCGC	NA	NA	NA	NA
WP_012974691.1|3087016_3088246_+|transposase	ISAs1-like element ISAzs5 family transposase	transposase	NA	NA	NA	NA
WP_012975253.1|3088697_3089663_+|integrase	phage integrase SAM-like domain-containing protein	integrase	A0A059XK29	uncultured_phage	29.9	9.2e-17
WP_148219284.1|3089709_3090805_+|transposase	IS630-like element ISAzs14 family transposase	transposase	NA	NA	NA	NA
WP_012975254.1|3090830_3091361_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_012975255.1|3091370_3092297_-	restriction endonuclease	NA	NA	NA	NA	NA
WP_012975256.1|3092406_3092862_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042443233.1|3092898_3093774_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012975258.1|3093805_3094852_-	EamA family transporter	NA	NA	NA	NA	NA
WP_012975259.1|3095061_3096384_-	bifunctional folylpolyglutamate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_012975260.1|3096419_3097394_-	acetyl-CoA carboxylase carboxyltransferase subunit beta	NA	NA	NA	NA	NA
WP_042443889.1|3097549_3098398_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_012975262.1|3098406_3099624_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_012975263.1|3099850_3100702_+	response regulator	NA	Q6XM27	Feldmannia_irregularis_virus	29.6	6.8e-08
WP_012975264.1|3100754_3100964_-	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	51.6	4.0e-10
WP_012975265.1|3101267_3102689_-	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_012975266.1|3102912_3104136_+	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	32.9	1.5e-32
WP_012975267.1|3104178_3104634_+	dUTP diphosphatase	NA	K4JSC8	Caulobacter_phage	60.0	8.6e-42
WP_042443891.1|3104730_3108579_+	response regulator	NA	A0A1V0SGX0	Hokovirus	39.1	5.1e-42
3105381:3105400	attR	GCGCCGCGACCTGACGGCGG	NA	NA	NA	NA
WP_042443239.1|3108695_3111065_+	PAS-domain containing protein	NA	Q8QKV7	Ectocarpus_siliculosus_virus	27.8	4.0e-13
WP_012975270.1|3111211_3112249_-	NAD(P)/FAD-dependent oxidoreductase	NA	A0A2K9L4X0	Tupanvirus	25.1	6.8e-10
WP_042443241.1|3112489_3112936_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012975271.1|3112991_3113474_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
WP_042443243.1|3113473_3114502_+	phosphotransferase	NA	NA	NA	NA	NA
WP_042443245.1|3114503_3115244_+	nucleotidyltransferase family protein	NA	NA	NA	NA	NA
WP_012975274.1|3115304_3118271_+	double-strand break repair protein AddB	NA	NA	NA	NA	NA
WP_042443247.1|3118273_3121804_+	double-strand break repair helicase AddA	NA	G3MA40	Bacillus_virus	26.7	3.1e-06
WP_012975276.1|3121953_3122277_+	thioredoxin TrxA	NA	A0A1J0GW78	Streptomyces_phage	46.9	2.5e-19
WP_148219329.1|3122399_3123296_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_012975278.1|3123404_3124280_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_042443250.1|3124449_3126201_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012975280.1|3126384_3127515_+	DNA polymerase III subunit beta	NA	R9TRR6	Rhizobium_phage	43.1	9.9e-71
WP_012975281.1|3127579_3128764_+	DNA replication/repair protein RecF	NA	NA	NA	NA	NA
WP_012975282.1|3128854_3131338_+	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	34.1	8.2e-110
WP_012975283.1|3131807_3132653_+|transposase	IS5-like element ISAzs16 family transposase	transposase	NA	NA	NA	NA
WP_042443253.1|3132728_3133766_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_042443893.1|3134604_3136074_+	amidase	NA	NA	NA	NA	NA
WP_012975286.1|3136352_3137351_+	transporter	NA	NA	NA	NA	NA
WP_086935406.1|3137703_3138138_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 8
NC_013854	Azospirillum sp. B510, complete genome	3311395	3164025	3207168	3311395	transposase	Stx2-converting_phage(33.33%)	32	NA	NA
WP_042443257.1|3164025_3164442_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_086935370.1|3165071_3165341_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012972684.1|3165337_3166093_-	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	47.9	2.7e-56
WP_012972683.1|3166103_3167618_-|transposase	IS21-like element ISAzs2 family transposase	transposase	NA	NA	NA	NA
WP_148219332.1|3167841_3169779_+	recombinase family protein	NA	NA	NA	NA	NA
WP_042443260.1|3169787_3170006_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	54.2	1.1e-13
WP_012975304.1|3170085_3171729_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	46.5	3.0e-100
WP_012975307.1|3173357_3176330_-|transposase	Tn3-like element ISAzs17 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	44.8	1.3e-239
WP_012975308.1|3176500_3176857_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_012975309.1|3176907_3177426_+	arsenate reductase ArsC	NA	A0A2H4J8A6	uncultured_Caudovirales_phage	44.5	2.1e-28
WP_012975310.1|3177422_3177857_+	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	65.7	3.0e-44
WP_012975311.1|3177869_3178943_+	ACR3 family arsenite efflux transporter	NA	NA	NA	NA	NA
WP_012975312.1|3178935_3179697_+	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	72.2	1.5e-91
WP_086935407.1|3179761_3179965_-	Hin recombinase	NA	NA	NA	NA	NA
WP_148219284.1|3180035_3181132_-|transposase	IS630-like element ISAzs14 family transposase	transposase	NA	NA	NA	NA
WP_012975314.1|3181141_3181519_-	recombinase family protein	NA	M1T2R9	Escherichia_phage	47.6	1.6e-17
WP_042443261.1|3182515_3183208_-	plasmid pRiA4b ORF-3 family protein	NA	NA	NA	NA	NA
WP_042443257.1|3183387_3183804_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_012973088.1|3184624_3185965_+|transposase	IS1380-like element ISAzs3 family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	28.7	1.7e-37
WP_148219333.1|3187653_3188028_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052293677.1|3188433_3189114_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_012975321.1|3189237_3190023_-	FkbM family methyltransferase	NA	C7U048	Ostreococcus_tauri_virus	27.9	9.1e-07
WP_012973766.1|3190923_3192000_+|transposase	IS5-like element ISAzs10 family transposase	transposase	NA	NA	NA	NA
WP_012975326.1|3194119_3194530_+	IS66 family insertion sequence hypothetical protein	NA	A0A1B0YZU7	Pseudomonas_phage	40.6	4.4e-05
WP_012975327.1|3194526_3194685_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	56.9	2.3e-10
WP_012975328.1|3195159_3197250_+	recombinase family protein	NA	NA	NA	NA	NA
WP_052293678.1|3197258_3197477_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	62.7	2.5e-15
WP_012975330.1|3197563_3199177_+|transposase	IS66-like element ISAzs18 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	45.5	1.1e-120
WP_148219284.1|3201886_3202982_+|transposase	IS630-like element ISAzs14 family transposase	transposase	NA	NA	NA	NA
WP_012973785.1|3203447_3204962_+|transposase	IS21-like element ISAzs2 family transposase	transposase	NA	NA	NA	NA
WP_012972684.1|3204972_3205728_+	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	47.9	2.7e-56
WP_042443270.1|3206751_3207168_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 1
NC_013855	Azospirillum sp. B510 plasmid pAB510a, complete sequence	1455109	59857	77293	1455109	integrase,transposase	Paenibacillus_phage(66.67%)	18	53493:53507	68080:68094
53493:53507	attL	TGCCGCTGCCCGGCC	NA	NA	NA	NA
WP_173380468.1|59857_60608_+|transposase	IS5-like element ISAzs9 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	52.6	5.6e-30
WP_012975478.1|60703_61996_+|transposase	IS701-like element ISAzs6 family transposase	transposase	NA	NA	NA	NA
WP_173380500.1|62095_62846_+|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	52.6	5.6e-30
WP_042444440.1|63323_65315_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_128083366.1|65434_65665_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083916229.1|65721_66075_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012975482.1|66093_66588_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012973088.1|66769_68110_-|transposase	IS1380-like element ISAzs3 family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	28.7	1.7e-37
68080:68094	attR	GGCCGGGCAGCGGCA	NA	NA	NA	NA
WP_086935410.1|68716_69016_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042444034.1|69712_70189_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086935411.1|70259_70586_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012975483.1|70582_71146_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012975486.1|72077_72434_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_012975487.1|72567_73269_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012975488.1|73295_74579_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012975489.1|74625_75213_+	sulfurtransferase	NA	NA	NA	NA	NA
WP_148219530.1|75263_75611_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086935412.1|75619_77293_-|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NC_013855	Azospirillum sp. B510 plasmid pAB510a, complete sequence	1455109	161774	202233	1455109	plate,transposase	Paenibacillus_phage(33.33%)	34	NA	NA
WP_173380478.1|161774_162524_+|transposase	IS5-like element ISAzs9 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	51.8	1.3e-29
WP_012975569.1|162605_163616_+|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	24.3	3.4e-06
WP_148219533.1|165443_166292_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148219441.1|167648_168509_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158305985.1|168779_168920_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012975576.1|169431_170673_-	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_052293698.1|170669_171446_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012975578.1|171447_172515_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_012975579.1|172511_174515_-	MFS transporter	NA	NA	NA	NA	NA
WP_148219442.1|174514_175285_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148219534.1|175830_176841_+	response regulator	NA	NA	NA	NA	NA
WP_012975582.1|176973_178041_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012975583.1|178262_178847_-	TIGR00645 family protein	NA	K4K6D8	Caulobacter_phage	26.8	8.0e-16
WP_012975584.1|178843_179437_-	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_012975585.1|179444_180575_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_012975586.1|180605_184820_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148219535.1|184842_185760_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_012975588.1|185767_187111_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_012975589.1|187138_187576_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042444056.1|187575_188349_-	SPOR domain-containing protein	NA	NA	NA	NA	NA
WP_042444059.1|188635_189178_-	SPOR domain-containing protein	NA	NA	NA	NA	NA
WP_012975592.1|189174_189774_-	lytic transglycosylase domain-containing protein	NA	NA	NA	NA	NA
WP_158305986.1|189770_191783_-	SpoIIE family protein phosphatase	NA	NA	NA	NA	NA
WP_148219536.1|191794_192094_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042444063.1|193717_194494_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042444065.1|194769_194994_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083916183.1|194990_195302_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042444069.1|195420_195984_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012975597.1|196188_196731_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_042444071.1|196789_198247_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_148219537.1|198300_198804_+	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_042444073.1|198948_199434_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_012975601.1|199435_201232_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_012975602.1|201195_202233_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
>prophage 3
NC_013855	Azospirillum sp. B510 plasmid pAB510a, complete sequence	1455109	550571	558394	1455109	tRNA,protease	uncultured_Mediterranean_phage(83.33%)	8	NA	NA
WP_086935437.1|550571_551615_+	beta-N-acetylhexosaminidase	NA	A0A1B1IVS3	uncultured_Mediterranean_phage	38.6	1.4e-18
WP_012975877.1|551631_552309_+|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_012975878.1|552319_553150_+	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	34.5	1.4e-37
WP_012975879.1|553142_553760_+	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	44.8	2.9e-40
WP_012975880.1|553917_554172_+	twin-arginine translocase TatA/TatE family subunit	NA	A0A1B1IVR9	uncultured_Mediterranean_phage	52.3	3.6e-05
WP_012975881.1|554247_554778_+	twin-arginine translocase subunit TatB	NA	NA	NA	NA	NA
WP_012975882.1|554792_555581_+	twin-arginine translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	46.7	7.2e-52
WP_012975883.1|555724_558394_+|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	37.6	1.1e-75
>prophage 4
NC_013855	Azospirillum sp. B510 plasmid pAB510a, complete sequence	1455109	734382	792441	1455109	integrase,transposase,tRNA	Burkholderia_virus(20.0%)	30	731602:731619	753852:753869
731602:731619	attL	GGCCATGTCGAATCCGCG	NA	NA	NA	NA
WP_012976010.1|734382_734844_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_148219284.1|734826_735923_-|transposase	IS630-like element ISAzs14 family transposase	transposase	NA	NA	NA	NA
WP_012976012.1|736523_737534_+|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	23.8	1.7e-05
WP_012976013.1|738212_738929_+	acyl-homoserine-lactone synthase	NA	NA	NA	NA	NA
WP_012976014.1|738972_739767_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012976015.1|739771_740872_+	branched-chain amino acid aminotransferase	NA	NA	NA	NA	NA
WP_012976016.1|740878_741100_+	MbtH family NRPS accessory protein	NA	NA	NA	NA	NA
WP_012976017.1|741102_741834_+	thioesterase	NA	NA	NA	NA	NA
WP_042444220.1|741848_748097_+	non-ribosomal peptide synthetase	NA	A0A2K9L3I8	Tupanvirus	24.4	2.8e-98
WP_012976019.1|748105_752131_+	polyketide synthase	NA	NA	NA	NA	NA
WP_012976020.1|752130_753507_+	serine hydroxymethyltransferase	NA	G9I092	Helicoverpa_zea_nudivirus	39.8	1.5e-68
WP_148219481.1|753521_757469_+	amino acid adenylation domain-containing protein	NA	A0A2K9KZV5	Tupanvirus	23.6	4.1e-79
753852:753869	attR	CGCGGATTCGACATGGCC	NA	NA	NA	NA
WP_042444222.1|757465_758317_+	homoserine O-succinyltransferase	NA	NA	NA	NA	NA
WP_042444224.1|758313_764544_+	AMP-binding protein	NA	NA	NA	NA	NA
WP_012976024.1|764652_765687_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2I2L4E3	Orpheovirus	31.3	4.7e-27
WP_012976025.1|765717_768072_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_012976026.1|768143_768854_+|tRNA	methionyl-tRNA formyltransferase	tRNA	A4JWM2	Burkholderia_virus	45.1	9.3e-43
WP_158305993.1|768920_769616_-	autoinducer binding domain-containing protein	NA	NA	NA	NA	NA
WP_086935439.1|770266_770767_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	58.6	1.0e-40
WP_148219482.1|771173_776222_+	calcium-binding protein	NA	NA	NA	NA	NA
WP_158305994.1|776950_777346_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_012976033.1|777770_780746_+|transposase	Tn3-like element ISAzs29 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	43.9	5.0e-239
WP_012973088.1|781480_782821_-|transposase	IS1380-like element ISAzs3 family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	28.7	1.7e-37
WP_012976035.1|783349_784561_+	benzoate/H(+) symporter BenE family transporter	NA	NA	NA	NA	NA
WP_012976037.1|786700_787525_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_148219484.1|787540_788728_+	branched-chain amino acid aminotransferase	NA	NA	NA	NA	NA
WP_012976039.1|788732_789281_+	DNA integrity scanning protein DisA nucleotide-binding domain protein	NA	NA	NA	NA	NA
WP_012976040.1|789277_790648_+	nucleotide sugar dehydrogenase	NA	M1HNJ7	Paramecium_bursaria_Chlorella_virus	31.0	4.9e-32
WP_012976041.1|790644_791709_+	malate/lactate/ureidoglycolate dehydrogenase	NA	NA	NA	NA	NA
WP_042443257.1|792024_792441_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 5
NC_013855	Azospirillum sp. B510 plasmid pAB510a, complete sequence	1455109	922102	962895	1455109	transposase	Streptococcus_phage(18.18%)	32	NA	NA
WP_012973088.1|922102_923443_+|transposase	IS1380-like element ISAzs3 family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	28.7	1.7e-37
WP_012976137.1|923897_925253_-	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_012976138.1|925249_926974_-	type I secretion system permease/ATPase	NA	W8CYL7	Bacillus_phage	35.2	8.1e-32
WP_148219559.1|927569_928592_+	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	36.1	2.9e-53
WP_012976140.1|928634_929204_+	winged helix DNA-binding protein	NA	NA	NA	NA	NA
WP_148219560.1|929236_930463_+	DUF2336 domain-containing protein	NA	NA	NA	NA	NA
WP_012976142.1|930466_931366_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_042444261.1|931490_932867_+	aspartate aminotransferase family protein	NA	B5LM99	Mycobacterium_phage	27.6	8.8e-05
WP_012976144.1|932984_934484_+	CoA-acylating methylmalonate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_042444264.1|934536_935883_-	nitrate- and nitrite sensing domain-containing protein	NA	NA	NA	NA	NA
WP_158305996.1|936121_936292_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012976146.1|936921_938274_+	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A0G2Y8M0	Acanthamoeba_polyphaga_mimivirus	29.8	1.4e-23
WP_012976147.1|938326_940153_+	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	A7IW18	Paramecium_bursaria_Chlorella_virus	40.1	4.2e-111
WP_148219284.1|940900_941996_+|transposase	IS630-like element ISAzs14 family transposase	transposase	NA	NA	NA	NA
WP_012976150.1|942007_942331_+	TnsA endonuclease C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_012976151.1|942424_943339_-	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	28.3	1.1e-16
WP_042444266.1|943598_944957_+	benzoate 1,2-dioxygenase large subunit	NA	NA	NA	NA	NA
WP_012976153.1|944971_945463_+	benzoate 1,2-dioxygenase small subunit	NA	NA	NA	NA	NA
WP_042444269.1|945578_946604_+	ring-hydroxylating dioxygenase ferredoxin reductase family protein	NA	NA	NA	NA	NA
WP_012976155.1|946600_947386_+	1,6-dihydroxycyclohexa-2,4-diene-1-carboxylate dehydrogenase	NA	Q06VL0	Trichoplusia_ni_ascovirus	27.5	1.6e-11
WP_086935425.1|947449_948925_+	aromatic acid/H+ symport family MFS transporter	NA	NA	NA	NA	NA
WP_012973766.1|950414_951491_+|transposase	IS5-like element ISAzs10 family transposase	transposase	NA	NA	NA	NA
WP_148219333.1|953146_953521_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052293677.1|953926_954607_-	class I SAM-dependent methyltransferase	NA	A0A1X9I6N4	Streptococcus_phage	31.7	5.1e-06
WP_012975321.1|954730_955516_-	FkbM family methyltransferase	NA	NA	NA	NA	NA
WP_012973766.1|956416_957493_+|transposase	IS5-like element ISAzs10 family transposase	transposase	NA	NA	NA	NA
WP_173380499.1|957642_957807_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012976161.1|958007_958520_-	winged helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_148219497.1|958636_958867_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012976163.1|958969_959791_-|transposase	IS5-like element ISAli1 family transposase	transposase	A0A0M5M147	Mycobacterium_phage	28.4	2.7e-09
WP_042444273.1|960249_960537_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012973785.1|961380_962895_+|transposase	IS21-like element ISAzs2 family transposase	transposase	K4I413	Acidithiobacillus_phage	36.5	1.0e-75
>prophage 1
NC_013856	Azospirillum sp. B510 plasmid pAB510b, complete sequence	723779	71464	184829	723779	transposase	Acidithiobacillus_phage(15.38%)	75	NA	NA
WP_012973088.1|71464_72805_-|transposase	IS1380-like element ISAzs3 family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	28.7	1.7e-37
WP_158306006.1|72894_73308_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012976598.1|74052_76518_-	DUF2309 domain-containing protein	NA	NA	NA	NA	NA
WP_042445256.1|76537_78121_-	oxidoreductase	NA	NA	NA	NA	NA
WP_012976600.1|78228_79119_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012976601.1|79129_79723_-	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_148219579.1|80235_81000_-	2-oxo acid dehydrogenase subunit E2	NA	NA	NA	NA	NA
WP_012976603.1|81046_81277_-	dihydrolipoamide acyltransferase	NA	NA	NA	NA	NA
WP_012975213.1|81537_82668_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_012976606.1|83645_84854_-|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	45.4	5.4e-91
WP_012976611.1|88031_89036_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	25.0	3.5e-11
WP_012973088.1|91062_92403_-|transposase	IS1380-like element ISAzs3 family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	28.7	1.7e-37
WP_012976615.1|92476_92959_-	HD domain-containing protein	NA	A0A141E1X8	Streptococcus_phage	37.2	2.2e-11
WP_012976616.1|93678_94644_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012972684.1|96348_97104_-	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	47.9	2.7e-56
WP_012973785.1|97114_98629_-|transposase	IS21-like element ISAzs2 family transposase	transposase	K4I413	Acidithiobacillus_phage	36.5	1.0e-75
WP_012975478.1|99662_100955_+|transposase	IS701-like element ISAzs6 family transposase	transposase	NA	NA	NA	NA
WP_173380468.1|101054_101805_+|transposase	IS5-like element ISAzs9 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	52.6	5.6e-30
WP_012976622.1|101939_103247_-|transposase	IS701-like element ISAzs1 family transposase	transposase	NA	NA	NA	NA
WP_012976623.1|103401_104205_-	5-deoxy-glucuronate isomerase	NA	NA	NA	NA	NA
WP_012976624.1|104275_105118_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012976625.1|105259_107290_-	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	70.0	5.6e-08
WP_012976626.1|107446_108454_-	inositol 2-dehydrogenase	NA	NA	NA	NA	NA
WP_012976627.1|108526_109669_-	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_012976628.1|109700_110723_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_042444992.1|110739_112341_-	sugar ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.3	1.9e-11
WP_012976630.1|112426_113383_-	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_012976631.1|113442_114945_-	CoA-acylating methylmalonate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_012976632.1|114982_115873_-	myo-inosose-2 dehydratase	NA	NA	NA	NA	NA
WP_042444995.1|115924_117766_-	3D-(3,5/4)-trihydroxycyclohexane-1,2-dione acylhydrolase (decyclizing)	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	22.8	2.4e-13
WP_012976634.1|117832_119758_-	5-dehydro-2-deoxygluconokinase	NA	NA	NA	NA	NA
WP_052293740.1|120026_120548_-	histidine-type phosphatase	NA	NA	NA	NA	NA
WP_173380516.1|120648_120846_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012976636.1|121724_123074_-	TolC family protein	NA	NA	NA	NA	NA
WP_158306007.1|123078_124404_-	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_042444997.1|124406_126116_-	ATP-binding cassette domain-containing protein	NA	W5SAS9	Pithovirus	32.8	7.5e-14
WP_012976639.1|126112_129181_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_148219582.1|129323_136379_+	tandem-95 repeat protein	NA	NA	NA	NA	NA
WP_012975478.1|138422_139715_+|transposase	IS701-like element ISAzs6 family transposase	transposase	NA	NA	NA	NA
WP_173380468.1|139747_140499_-|transposase	IS5-like element ISAzs9 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	52.6	5.6e-30
WP_012976647.1|142765_143575_-	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_076611334.1|143794_144932_-|transposase	ISAs1-like element ISAzs22 family transposase	transposase	NA	NA	NA	NA
WP_012976650.1|145067_146198_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_012972684.1|146734_147490_-	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	47.9	2.7e-56
WP_012973785.1|147500_149015_-|transposase	IS21-like element ISAzs2 family transposase	transposase	K4I413	Acidithiobacillus_phage	36.5	1.0e-75
WP_042445004.1|149130_149346_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012973092.1|151079_151427_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	54.2	2.9e-29
WP_012976652.1|151423_151816_-|transposase	transposase	transposase	A0A1B0YZU7	Pseudomonas_phage	46.0	2.5e-05
WP_012976611.1|153345_154350_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	25.0	3.5e-11
WP_012976658.1|155633_156206_-	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_042445008.1|156205_157069_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	29.6	1.4e-16
WP_012976660.1|157082_157868_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_012976661.1|157864_158590_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_012976662.1|158633_159794_-	NADH:flavin oxidoreductase	NA	NA	NA	NA	NA
WP_012976663.1|159871_161584_-	FAD-dependent oxidoreductase	NA	A0A2P0ZL82	Lactobacillus_phage	30.5	1.2e-27
WP_012976664.1|161709_163248_-	AMP-binding protein	NA	Q75ZG1	Hepacivirus	28.3	1.5e-45
WP_012976665.1|163401_163632_-	dihydrolipoamide acyltransferase	NA	NA	NA	NA	NA
WP_148219583.1|163738_164713_-	alpha-ketoacid dehydrogenase subunit beta	NA	NA	NA	NA	NA
WP_148219615.1|164733_165666_-	thiamine pyrophosphate-dependent dehydrogenase E1 component subunit alpha	NA	NA	NA	NA	NA
WP_012976668.1|165981_167331_-	aromatic ring-hydroxylating dioxygenase subunit alpha	NA	NA	NA	NA	NA
WP_148219584.1|167747_168413_-	TetR/AcrR family transcriptional regulator C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_173380519.1|168512_168668_+	rubredoxin	NA	NA	NA	NA	NA
WP_012976671.1|168774_169935_+	EstA family serine hydrolase	NA	NA	NA	NA	NA
WP_012976672.1|169973_171227_+	cytochrome P450	NA	A0A2I2L481	Orpheovirus	21.7	2.0e-08
WP_012976673.1|171248_172868_+	GMC family oxidoreductase N-terminal domain-containing protein	NA	A0A1V0S9J5	Catovirus	30.2	6.0e-53
WP_012976674.1|172937_173741_+	SDR family oxidoreductase	NA	A0A0M4JSW6	Mollivirus	27.5	4.0e-10
WP_086935452.1|175221_175551_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_012976677.1|176261_177272_+|transposase	IS3 family transposase	transposase	Q6J1X2	Lactobacillus_phage	26.6	1.1e-07
WP_012976678.1|177377_178439_-	nitronate monooxygenase	NA	NA	NA	NA	NA
WP_012976679.1|178658_179558_-	crotonase/enoyl-CoA hydratase family protein	NA	NA	NA	NA	NA
WP_012976680.1|179684_180503_-	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_012976681.1|180520_181420_-	crotonase/enoyl-CoA hydratase family protein	NA	NA	NA	NA	NA
WP_148219586.1|181656_181878_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012976682.1|182175_183384_+|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	45.8	4.9e-92
WP_012976683.1|183797_184829_+|transposase	IS110-like element ISAzs32 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NC_013856	Azospirillum sp. B510 plasmid pAB510b, complete sequence	723779	593231	618308	723779	transposase,tail	Rhizobium_phage(27.27%)	15	NA	NA
WP_173380468.1|593231_593983_-|transposase	IS5-like element ISAzs9 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	52.6	5.6e-30
WP_076611334.1|595047_596185_-|transposase	ISAs1-like element ISAzs22 family transposase	transposase	NA	NA	NA	NA
WP_012977036.1|596849_598190_-|transposase	IS1380-like element ISAzs3 family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	28.7	2.9e-37
WP_012977037.1|598467_599808_-|transposase	IS1380-like element ISAzs25 family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	28.0	1.6e-35
WP_012973785.1|600329_601844_+|transposase	IS21-like element ISAzs2 family transposase	transposase	K4I413	Acidithiobacillus_phage	36.5	1.0e-75
WP_012972684.1|601854_602610_+	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	47.9	2.7e-56
WP_042445183.1|608839_609214_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042445187.1|609230_609752_+	hypothetical protein	NA	J9Q7Y4	Salmonella_phage	34.9	2.2e-17
WP_042445190.1|609835_610210_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012977041.1|610296_610530_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012977042.1|610545_611757_+	hypothetical protein	NA	L7TND1	Rhizobium_phage	40.0	7.2e-11
WP_012977043.1|611760_612150_+|tail	phage tail protein	tail	H6WRV8	Salmonella_phage	34.9	8.8e-11
WP_012977044.1|612183_612927_+|tail	phage minor tail protein L	tail	A0A2I6PHT9	Pseudomonas_phage	42.2	1.8e-49
WP_042445193.1|612970_613678_+	C40 family peptidase	NA	L7TLZ5	Rhizobium_phage	45.5	1.9e-51
WP_042445196.1|613670_618308_+	DUF1983 domain-containing protein	NA	L7TND7	Rhizobium_phage	40.6	4.4e-157
>prophage 1
NC_013857	Azospirillum sp. B510 plasmid pAB510c, complete sequence	681723	431421	478032	681723	transposase	Stx2-converting_phage(23.08%)	36	NA	NA
WP_012977036.1|431421_432762_+|transposase	IS1380-like element ISAzs3 family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	28.7	2.9e-37
WP_076611334.1|433449_434586_+|transposase	ISAs1-like element ISAzs22 family transposase	transposase	NA	NA	NA	NA
WP_148219653.1|435402_435858_-	glycoside hydrolase	NA	NA	NA	NA	NA
WP_042445704.1|435997_437341_-	cell envelope integrity protein CreD	NA	NA	NA	NA	NA
WP_012977479.1|437478_438171_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	38.9	1.8e-35
WP_012977480.1|438167_439778_+	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_012977481.1|439851_440778_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	33.2	1.1e-22
WP_012977482.1|440774_441536_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_012973655.1|442274_443567_-|transposase	IS701-like element ISAzs6 family transposase	transposase	NA	NA	NA	NA
WP_052293785.1|443700_444525_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	29.4	2.6e-20
WP_148219654.1|444542_446750_-	two-component sensor histidine kinase	NA	NA	NA	NA	NA
WP_052293786.1|447123_448899_+	sulfatase-like hydrolase/transferase	NA	A0A2K9L1A5	Tupanvirus	24.9	1.1e-23
WP_012977487.1|449122_450835_-	HAMP domain-containing protein	NA	NA	NA	NA	NA
WP_012977488.1|450918_451872_-	NAD-dependent epimerase/dehydratase family protein	NA	NA	NA	NA	NA
WP_012977489.1|451879_452836_-	oxidoreductase	NA	NA	NA	NA	NA
WP_012977490.1|452832_453906_-	aromatic ring-hydroxylating dioxygenase subunit alpha	NA	A0A076FFT9	Aureococcus_anophage	32.6	1.2e-12
WP_012977491.1|453942_456393_-	RND family transporter	NA	NA	NA	NA	NA
WP_042445707.1|456434_457520_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012977493.1|457572_458574_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_012977494.1|458578_459382_-	cyclase family protein	NA	NA	NA	NA	NA
WP_012977495.1|459394_460429_-	SMP-30/gluconolactonase/LRE family protein	NA	NA	NA	NA	NA
WP_012977496.1|460487_461618_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_042445708.1|461614_462001_-	Rieske (2Fe-2S) protein	NA	NA	NA	NA	NA
WP_012977498.1|462009_462957_-	VOC family protein	NA	NA	NA	NA	NA
WP_012977499.1|462973_464134_-	prolyl oligopeptidase family serine peptidase	NA	NA	NA	NA	NA
WP_148219679.1|464197_465541_-	DUF1329 domain-containing protein	NA	NA	NA	NA	NA
WP_086935477.1|465567_467214_-	DUF1302 domain-containing protein	NA	NA	NA	NA	NA
WP_012977502.1|467664_468576_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_042443257.1|470268_470685_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_012976042.1|470681_471029_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	57.0	1.1e-31
WP_012973785.1|471458_472973_+|transposase	IS21-like element ISAzs2 family transposase	transposase	K4I413	Acidithiobacillus_phage	36.5	1.0e-75
WP_012972684.1|472983_473739_+	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	47.9	2.7e-56
WP_012973093.1|474692_475085_+|transposase	transposase	transposase	A0A1B0YZU7	Pseudomonas_phage	46.0	2.5e-05
WP_012977096.1|475081_475240_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	56.9	1.3e-10
WP_012977507.1|475714_477805_+	recombinase family protein	NA	R9TP69	Rhizobium_phage	24.4	7.1e-06
WP_158306013.1|477840_478032_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	53.7	4.7e-10
>prophage 1
NC_013860	Azospirillum sp. B510 plasmid pAB510f, complete sequence	261596	19367	75262	261596	transposase	Synechococcus_phage(15.38%)	47	NA	NA
WP_012974334.1|19367_20462_-|transposase	ISAs1-like element ISAzs12 family transposase	transposase	NA	NA	NA	NA
WP_042447050.1|20716_21742_+	flippase-like domain-containing protein	NA	NA	NA	NA	NA
WP_012978565.1|21738_23232_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_012978566.1|23236_23458_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042446938.1|23496_23730_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148219819.1|24003_25932_-	DUF839 domain-containing protein	NA	NA	NA	NA	NA
WP_012978568.1|26101_26374_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012978569.1|26384_26993_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_012978570.1|27021_27405_-	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_012978571.1|27412_27646_-	type II toxin-antitoxin system prevent-host-death family antitoxin	NA	NA	NA	NA	NA
WP_042446941.1|27757_28753_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042446943.1|28951_29164_+	antitoxin MazE family protein	NA	NA	NA	NA	NA
WP_012978574.1|29160_29484_+	type II toxin-antitoxin system PemK/MazF family toxin	NA	NA	NA	NA	NA
WP_012978575.1|29525_30674_+	exo-alpha-sialidase	NA	NA	NA	NA	NA
WP_012978576.1|30740_31859_+	Rieske 2Fe-2S domain-containing protein	NA	NA	NA	NA	NA
WP_012978577.1|31964_33599_+	DUF1800 domain-containing protein	NA	NA	NA	NA	NA
WP_012978578.1|33613_34903_+	DUF1501 domain-containing protein	NA	NA	NA	NA	NA
WP_012978579.1|34941_35505_-	acetyltransferase	NA	NA	NA	NA	NA
WP_012978580.1|35551_36331_-	SDR family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.0	6.5e-05
WP_012978581.1|36569_37940_+	type II toxin-antitoxin system HipA family toxin	NA	NA	NA	NA	NA
WP_012978582.1|37926_38223_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_012978583.1|38350_39445_+	ketoacyl-ACP synthase III	NA	NA	NA	NA	NA
WP_148219845.1|39526_40042_+	dTDP-4-dehydrorhamnose 3,5-epimerase family protein	NA	A0A1D7XFA9	Escherichia_phage	35.4	8.3e-25
WP_012978585.1|40197_41439_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_158306032.1|41660_42725_+	SPASM domain-containing protein	NA	NA	NA	NA	NA
WP_042446950.1|42783_45714_+	glycosyltransferase family 41 protein	NA	NA	NA	NA	NA
WP_012976012.1|45903_46914_-|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	23.8	1.7e-05
WP_012978588.1|47736_50577_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_148219820.1|50629_51496_-	class I SAM-dependent methyltransferase	NA	E3T537	Cafeteria_roenbergensis_virus	29.5	2.6e-18
WP_148219821.1|51393_52377_-	aldo/keto reductase	NA	NA	NA	NA	NA
WP_012978591.1|52382_53348_-	NAD-dependent epimerase/dehydratase family protein	NA	M1HRM8	Acanthocystis_turfacea_Chlorella_virus	31.8	8.5e-39
WP_052293830.1|53397_54363_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012978593.1|54359_55193_-	transketolase	NA	A0A2K9L6P9	Tupanvirus	32.7	1.8e-29
WP_012978594.1|55430_56468_+	kinase	NA	A0A222YW25	Synechococcus_phage	27.6	1.5e-25
WP_042446956.1|56527_57112_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_012978596.1|57372_58317_+	NAD(P)-dependent oxidoreductase	NA	A0A0F7LC08	uncultured_marine_virus	44.7	2.2e-71
WP_012978597.1|58376_58868_-	glycine zipper 2TM domain-containing protein	NA	NA	NA	NA	NA
WP_012973766.1|59265_60342_+|transposase	IS5-like element ISAzs10 family transposase	transposase	NA	NA	NA	NA
WP_012973088.1|61703_63044_+|transposase	IS1380-like element ISAzs3 family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	28.7	1.7e-37
WP_012973785.1|63409_64924_+|transposase	IS21-like element ISAzs2 family transposase	transposase	K4I413	Acidithiobacillus_phage	36.5	1.0e-75
WP_012972684.1|64934_65690_+	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	47.9	2.7e-56
WP_148219822.1|67206_67704_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_012978604.1|68120_69344_-	HAD-IIIA family hydrolase	NA	A0A222YXG2	Synechococcus_phage	32.0	2.3e-12
WP_148219823.1|69652_69940_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012973766.1|71415_72492_+|transposase	IS5-like element ISAzs10 family transposase	transposase	NA	NA	NA	NA
WP_012978607.1|72641_73613_-	ExeA family protein	NA	Q6QIE1	Burkholderia_phage	27.7	1.6e-08
WP_012978608.1|73606_75262_-|transposase	IS481-like element ISAzs36 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NC_013860	Azospirillum sp. B510 plasmid pAB510f, complete sequence	261596	103226	176755	261596	transposase,integrase,tail	Acidithiobacillus_phage(13.33%)	46	83159:83175	128225:128241
83159:83175	attL	GCAGGCGCACCCGTTCG	NA	NA	NA	NA
WP_148219284.1|103226_104323_-|transposase	IS630-like element ISAzs14 family transposase	transposase	NA	NA	NA	NA
WP_012978628.1|107762_108734_-	ExeA family protein	NA	Q6QIE1	Burkholderia_phage	28.5	2.4e-09
WP_086935531.1|108727_110362_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_012978630.1|110372_110933_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	55.9	6.0e-45
WP_012978631.1|111150_111378_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_076611132.1|111593_112535_+|transposase	IS630-like element ISAzs37 family transposase	transposase	NA	NA	NA	NA
WP_086935528.1|112542_112818_+	type II toxin-antitoxin system death-on-curing family toxin	NA	NA	NA	NA	NA
WP_012978635.1|113251_114766_+|transposase	IS21-like element ISAzs2 family transposase	transposase	K4I413	Acidithiobacillus_phage	36.3	5.2e-75
WP_012972684.1|114776_115532_+	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	47.9	2.7e-56
WP_012978637.1|116831_118382_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042446986.1|118463_120242_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_012978639.1|120264_122193_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_012978640.1|122639_124325_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012978642.1|125614_126388_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.5	2.7e-11
WP_148219828.1|126393_127245_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_012978644.1|127406_128399_-	GDP-mannose 4,6-dehydratase	NA	M4QRT5	Synechococcus_phage	44.8	1.4e-73
128225:128241	attR	GCAGGCGCACCCGTTCG	NA	NA	NA	NA
WP_148219846.1|128395_129487_-	GDP-mannose 4,6-dehydratase	NA	M4QRT5	Synechococcus_phage	68.3	1.1e-132
WP_012978646.1|129775_130639_-	formylglycine-generating enzyme family protein	NA	A0A7H6	Microcystis_virus	43.0	1.6e-41
WP_012978647.1|130643_132557_-	DUF2142 domain-containing protein	NA	NA	NA	NA	NA
WP_148219829.1|133094_133886_+	methyltransferase	NA	NA	NA	NA	NA
WP_042447092.1|133922_135110_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_086935532.1|135204_136212_-	glycosyltransferase family 2 protein	NA	A8CG95	Salmonella_phage	41.8	4.2e-57
WP_148219830.1|136587_138207_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042446999.1|138296_139283_+	flippase-like domain-containing protein	NA	NA	NA	NA	NA
WP_012978653.1|139455_140640_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012978654.1|140636_142232_+	GMC family oxidoreductase	NA	NA	NA	NA	NA
WP_012978655.1|142272_143238_-	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_148219831.1|143249_144968_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148219832.1|145997_146171_-	type II toxin-antitoxin system PemK/MazF family toxin	NA	NA	NA	NA	NA
WP_042447006.1|146167_146344_-	DUF3018 family protein	NA	NA	NA	NA	NA
WP_012978659.1|146449_148684_+	peptidase	NA	NA	NA	NA	NA
WP_086935529.1|148836_149775_+	sulfate adenylyltransferase subunit CysD	NA	A0A109Z8C1	Bacillus_phage	27.2	1.9e-06
WP_042447103.1|149855_151721_+	sulfate adenylyltransferase subunit CysN	NA	A0A2K9L4R9	Tupanvirus	42.0	8.8e-24
WP_042447009.1|152103_152772_+	DUF2076 domain-containing protein	NA	NA	NA	NA	NA
WP_052293843.1|152833_154165_-	nucleotide sugar dehydrogenase	NA	M1HKZ1	Paramecium_bursaria_Chlorella_virus	29.2	9.9e-38
WP_012978664.1|154434_155307_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042447012.1|155663_155858_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086935533.1|155914_156448_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	38.5	7.3e-16
WP_012978666.1|156505_157063_-	HAD family hydrolase	NA	NA	NA	NA	NA
WP_042447015.1|157332_158241_-|tail	tail fiber protein	tail	A0A2R3ZZT3	Microbacterium_phage	42.3	2.7e-10
WP_158306037.1|158509_158656_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052293836.1|158876_171305_+	DUF4347 domain-containing protein	NA	NA	NA	NA	NA
WP_042447109.1|171429_173463_+	TolC family protein	NA	NA	NA	NA	NA
WP_148219848.1|173534_174296_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_012978671.1|174292_175753_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_012978672.1|175945_176755_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	51.2	1.4e-39
>prophage 3
NC_013860	Azospirillum sp. B510 plasmid pAB510f, complete sequence	261596	181175	188677	261596	transposase	Acidithiobacillus_phage(33.33%)	7	NA	NA
WP_148219834.1|181175_182111_+	sugar nucleotide-binding protein	NA	A0A140G5S3	Enterobacteria_phage	23.8	1.7e-07
WP_012978678.1|182113_183394_+	NAD(P)-binding protein	NA	Q6XM31	Feldmannia_irregularis_virus	27.2	9.3e-33
WP_012978679.1|183450_184323_+	DUF4422 domain-containing protein	NA	NA	NA	NA	NA
WP_012973093.1|184970_185363_+|transposase	transposase	transposase	A0A1B0YZU7	Pseudomonas_phage	46.0	2.5e-05
WP_012973092.1|185359_185707_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	54.2	2.9e-29
WP_012972684.1|186396_187152_-	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	47.9	2.7e-56
WP_012972683.1|187162_188677_-|transposase	IS21-like element ISAzs2 family transposase	transposase	K4I413	Acidithiobacillus_phage	36.3	2.3e-75
>prophage 4
NC_013860	Azospirillum sp. B510 plasmid pAB510f, complete sequence	261596	250128	259578	261596		Escherichia_phage(28.57%)	8	NA	NA
WP_012978711.1|250128_250680_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A218MN57	uncultured_virus	44.6	1.2e-34
WP_012978712.1|250762_251830_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	52.0	3.2e-95
WP_012978713.1|251826_252717_+	dTDP-4-dehydrorhamnose reductase	NA	A0A1D7XFA3	Escherichia_phage	39.6	9.3e-40
WP_042447041.1|252728_253592_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	K7QKA7	Escherichia_phage	62.5	2.4e-101
WP_012978715.1|253674_254661_+	SDR family oxidoreductase	NA	A0A2K9KZK0	Tupanvirus	47.2	4.3e-86
WP_012978716.1|254722_255739_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	34.6	3.2e-44
WP_012978717.1|255879_257376_-	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_012978718.1|257379_259578_-	peptidase domain-containing ABC transporter	NA	W8CYL7	Bacillus_phage	28.7	1.9e-41
