The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_012796	Desulfovibrio magneticus RS-1, complete genome	5248049	72824	122493	5248049	integrase,transposase	Bacillus_phage(20.0%)	43	84143:84188	120908:120953
WP_012749653.1|72824_74180_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_012749654.1|74420_75743_-	HD domain-containing protein	NA	NA	NA	NA	NA
WP_012749655.1|75778_77074_-	dihydroorotase	NA	NA	NA	NA	NA
WP_012749656.1|77070_78012_-	aspartate carbamoyltransferase catalytic subunit	NA	A0A1J0F9B8	Only_Syngen_Nebraska_virus	31.5	4.3e-27
WP_043599758.1|78116_78923_-	sirohydrochlorin cobaltochelatase	NA	NA	NA	NA	NA
WP_012749658.1|78919_79792_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012749659.1|79788_80484_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	32.9	1.8e-22
WP_012749660.1|80480_82109_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_012749661.1|82120_82963_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_012749662.1|82955_83954_-	ABC transporter permease	NA	NA	NA	NA	NA
84143:84188	attL	ATGGCATTCAAGAGGTCGTGGGTTCGATTCCCTCCAGCTCCACCAC	NA	NA	NA	NA
WP_012749663.1|84613_86311_+	AIPR family protein	NA	NA	NA	NA	NA
WP_012749664.1|86469_87204_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012749665.1|87259_88108_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012749666.1|88417_88990_-	MucR family transcriptional regulator	NA	NA	NA	NA	NA
WP_052278925.1|89329_89542_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148208325.1|90449_91265_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012749670.1|91273_92149_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012749671.1|92176_93283_+	replication initiation protein	NA	NA	NA	NA	NA
WP_012749673.1|94651_95032_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012749674.1|95398_95956_+|integrase	tyrosine-type recombinase/integrase	integrase	D2XR58	Bacillus_phage	38.4	2.7e-21
WP_012749675.1|96070_97195_+|integrase	tyrosine-type recombinase/integrase	integrase	Q9AZK8	Lactococcus_phage	24.8	4.2e-05
WP_012749678.1|98674_98896_+	(2Fe-2S)-binding protein	NA	NA	NA	NA	NA
WP_012749681.1|99999_100359_-	DUF488 family protein	NA	A0A2D1GR07	Pseudomonas_phage	38.4	2.3e-05
WP_148208326.1|101294_102860_+	DNA primase	NA	A0A2H4J990	uncultured_Caudovirales_phage	33.0	1.5e-61
WP_012749684.1|102921_103686_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148208327.1|103744_105061_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012749686.1|105118_106057_+	hypothetical protein	NA	A0A1C9EG97	Acidianus_two-tailed_virus	28.8	5.8e-08
WP_012749688.1|106460_106868_+	MucR family transcriptional regulator	NA	A0A1P8VVG0	Erythrobacter_phage	31.5	1.5e-08
WP_012749690.1|107272_107497_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012749691.1|107486_107876_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070098044.1|108410_109349_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158304231.1|109420_111334_+	DUF927 domain-containing protein	NA	NA	NA	NA	NA
WP_012749694.1|111663_112071_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012749697.1|113663_114026_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012749699.1|114357_114915_+|integrase	tyrosine-type recombinase/integrase	integrase	D2XR58	Bacillus_phage	36.1	1.0e-20
WP_043599764.1|115006_116200_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4JCB7	uncultured_Caudovirales_phage	25.2	4.0e-14
WP_158304232.1|116361_117372_+	WYL domain-containing protein	NA	NA	NA	NA	NA
WP_012749702.1|117558_117732_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012749703.1|117932_118364_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012749704.1|118411_118675_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012749705.1|118772_119405_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012749706.1|119392_120640_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_012749707.1|121473_122493_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
120908:120953	attR	ATGGCATTCAAGAGGTCGTGGGTTCGATTCCCTCCAGCTCCACCAC	NA	NA	NA	NA
>prophage 2
NC_012796	Desulfovibrio magneticus RS-1, complete genome	5248049	997337	1066278	5248049	integrase,transposase	Leptospira_phage(25.0%)	54	1060490:1060515	1084248:1084273
WP_012750446.1|997337_998426_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0S2GLI2	Bacillus_phage	23.3	2.0e-12
WP_012750447.1|998426_998654_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_012750448.1|998897_999455_-|integrase	tyrosine-type recombinase/integrase	integrase	D2XR58	Bacillus_phage	36.6	4.9e-23
WP_012750449.1|999729_1000107_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012750453.1|1001883_1003521_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012750454.1|1004278_1004713_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043600061.1|1005284_1007054_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012750456.1|1007288_1007666_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012750457.1|1008058_1008448_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012750459.1|1009059_1010163_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012750460.1|1010407_1011568_-	response regulator	NA	NA	NA	NA	NA
WP_012750461.1|1011554_1011935_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_158304239.1|1011931_1014862_-	PAS domain S-box protein	NA	NA	NA	NA	NA
WP_012750463.1|1015297_1015594_-	glutaredoxin family protein	NA	NA	NA	NA	NA
WP_148208353.1|1016101_1016557_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043600063.1|1017002_1017251_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012750464.1|1017371_1018010_-	class I SAM-dependent methyltransferase	NA	A0A222ZTW3	Mycobacterium_phage	27.7	4.8e-06
WP_043600066.1|1018188_1019259_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_012750467.1|1020558_1020780_-	alkylphosphonate utilization protein	NA	NA	NA	NA	NA
WP_012750468.1|1020917_1022186_-	AMP-binding protein	NA	NA	NA	NA	NA
WP_012750469.1|1022367_1023186_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.3	1.0e-08
WP_148208514.1|1023170_1024331_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_012750471.1|1024445_1025492_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_012750472.1|1025495_1026383_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_043600070.1|1026482_1028384_-	long-chain fatty acid--CoA ligase	NA	A0A1V0SBX8	Catovirus	23.9	1.3e-46
WP_012750474.1|1028421_1029204_-	ABC transporter ATP-binding protein	NA	A0A285PWH2	Cedratvirus	23.1	3.0e-10
WP_012750475.1|1029203_1029863_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_148208355.1|1030028_1030265_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012750476.1|1030715_1031066_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_012750477.1|1031062_1031416_+	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	46.7	6.9e-23
WP_012750478.1|1031465_1033037_+|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	43.4	6.1e-111
WP_043600073.1|1033602_1034577_-	SH3 domain-containing protein	NA	NA	NA	NA	NA
WP_012750480.1|1034647_1035265_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081429569.1|1035722_1036523_+	PAN domain-containing protein	NA	NA	NA	NA	NA
WP_081429570.1|1036543_1037455_+	PD40 domain-containing protein	NA	NA	NA	NA	NA
WP_012750482.1|1037479_1038028_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012750478.1|1038415_1039987_-|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	43.4	6.1e-111
WP_012750477.1|1040036_1040390_-	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	46.7	6.9e-23
WP_012750476.1|1040386_1040737_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_158304240.1|1040855_1046888_-	PAS domain S-box protein	NA	A0A1V0SGX0	Hokovirus	33.7	3.6e-42
WP_012750484.1|1047228_1047525_-	glutaredoxin family protein	NA	NA	NA	NA	NA
WP_012750486.1|1048351_1049047_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_012750487.1|1049033_1051703_-	sensor histidine kinase KdpD	NA	Q8QKV7	Ectocarpus_siliculosus_virus	24.3	1.5e-05
WP_012750488.1|1051713_1052301_-	potassium-transporting ATPase subunit KdpC	NA	NA	NA	NA	NA
WP_012750489.1|1052312_1054382_-	potassium-transporting ATPase subunit KdpB	NA	A0A1J0FA34	Only_Syngen_Nebraska_virus	25.7	8.0e-26
WP_012750490.1|1054392_1056141_-	potassium-transporting ATPase subunit KdpA	NA	NA	NA	NA	NA
WP_070098047.1|1056137_1056221_-	K(+)-transporting ATPase subunit F	NA	NA	NA	NA	NA
WP_012750493.1|1056722_1057193_-	purine-binding chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_012750494.1|1057192_1059661_-	PAS domain-containing protein	NA	NA	NA	NA	NA
1060490:1060515	attL	TCAAATACGAAATTTCTTTCGTTTTT	NA	NA	NA	NA
WP_012750498.1|1061213_1063103_-	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	37.0	5.0e-19
WP_012750499.1|1063542_1063818_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012750500.1|1063921_1064389_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043600075.1|1064467_1065616_-|integrase	site-specific integrase	integrase	A0A160DFH7	Gordonia_phage	26.0	6.0e-07
WP_012750502.1|1065720_1066278_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0A8WEV9	Clostridium_phage	36.1	2.4e-22
1084248:1084273	attR	TCAAATACGAAATTTCTTTCGTTTTT	NA	NA	NA	NA
>prophage 3
NC_012796	Desulfovibrio magneticus RS-1, complete genome	5248049	1567483	1620602	5248049	integrase,transposase	Pseudomonas_phage(20.0%)	42	1579612:1579671	1630462:1630525
WP_015860123.1|1567483_1568422_-|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	37.7	6.8e-49
WP_148208521.1|1568630_1568906_+	Com family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_015860125.1|1569328_1570789_-	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_148208375.1|1570778_1572755_-	PocR ligand-binding domain-containing protein	NA	NA	NA	NA	NA
WP_015860127.1|1573262_1573661_+	heme-binding protein	NA	NA	NA	NA	NA
WP_043600201.1|1573714_1576105_+	glycyl radical protein	NA	A0A2H4YEI2	Aeromonas_phage	38.7	8.6e-08
WP_015860129.1|1576170_1577133_+	glycyl-radical enzyme activating protein	NA	NA	NA	NA	NA
WP_015860130.1|1577395_1577785_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148208376.1|1577796_1578414_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
1579612:1579671	attL	AGCCCTTGGACTTCCTGGTTGCGGGGGTGGGATTTGAACCCACGGTCTTCGGGTTATGAG	NA	NA	NA	NA
WP_015860133.1|1579894_1581091_+|integrase	site-specific integrase	integrase	G8EYF8	Synechococcus_phage	25.6	1.3e-07
WP_015860134.1|1581094_1581355_+	DUF4160 domain-containing protein	NA	NA	NA	NA	NA
WP_015860135.1|1581358_1581619_+	DUF2442 domain-containing protein	NA	NA	NA	NA	NA
WP_043600206.1|1581848_1584092_+	CRISPR-associated helicase/endonuclease Cas3	NA	NA	NA	NA	NA
WP_015860137.1|1584401_1585058_+	type I-C CRISPR-associated protein Cas5	NA	NA	NA	NA	NA
WP_015860138.1|1585054_1586764_+	type I-C CRISPR-associated protein Cas8c/Csd1	NA	NA	NA	NA	NA
WP_015860139.1|1586767_1587637_+	type I-C CRISPR-associated protein Cas7/Csd2	NA	NA	NA	NA	NA
WP_015860140.1|1587651_1588284_+	CRISPR-associated protein Cas4	NA	NA	NA	NA	NA
WP_015860141.1|1588280_1589312_+	type I-C CRISPR-associated endonuclease Cas1	NA	NA	NA	NA	NA
WP_015860142.1|1589315_1589606_+	CRISPR-associated endonuclease Cas2	NA	NA	NA	NA	NA
WP_015860143.1|1591907_1593263_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_015860144.1|1593388_1594165_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	35.8	3.4e-38
WP_015860147.1|1595940_1597671_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070098049.1|1598916_1599690_-	phage repressor protein	NA	A0A125RN88	Pseudomonas_phage	28.6	8.1e-16
WP_148208377.1|1599920_1600355_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081429585.1|1600351_1600570_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_015860150.1|1600599_1602699_+|transposase	Mu transposase C-terminal domain-containing protein	transposase	A0A1B0T6H2	Thiobacimonas_phage	25.1	8.1e-18
WP_015860151.1|1602695_1603418_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_015860152.1|1603414_1604038_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015860153.1|1604030_1604564_+	host-nuclease inhibitor Gam family protein	NA	A0A0N7ACD4	Bacillus_phage	30.8	5.6e-08
WP_015860154.1|1604697_1605276_+	DUF1018 domain-containing protein	NA	NA	NA	NA	NA
WP_015860155.1|1605279_1605621_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043600211.1|1605748_1606756_+|integrase	site-specific integrase	integrase	W6MYA3	Pseudomonas_phage	43.1	1.8e-63
WP_148208378.1|1606817_1608935_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015860158.1|1608968_1609466_-	conjugal transfer protein TraD	NA	NA	NA	NA	NA
WP_015860159.1|1609787_1612631_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_015860160.1|1612893_1613460_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_015860161.1|1613601_1615491_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015860162.1|1616021_1616756_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015860163.1|1616752_1617511_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015860164.1|1617596_1618337_-	type II restriction endonuclease PaeR7I	NA	NA	NA	NA	NA
WP_015860165.1|1618326_1619988_-	Eco57I restriction-modification methylase domain-containing protein	NA	R4TFP1	Halovirus	23.3	2.7e-16
WP_043600215.1|1620053_1620602_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2L1IV36	Escherichia_phage	47.0	3.3e-40
1630462:1630525	attR	AGCCCTTGGACTTCCTGGTTGCGGGGGTGGGATTTGAACCCACGGTCTTCGGGTTATGAGCCCG	NA	NA	NA	NA
>prophage 4
NC_012796	Desulfovibrio magneticus RS-1, complete genome	5248049	1901057	1908217	5248049		Streptococcus_phage(33.33%)	7	NA	NA
WP_015860397.1|1901057_1901858_-	pyrroline-5-carboxylate reductase	NA	A0A1X9I6T5	Streptococcus_phage	32.2	1.4e-26
WP_006921020.1|1901862_1902279_-	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	41.7	1.1e-19
WP_015860398.1|1902520_1903759_-	DUF190 domain-containing protein	NA	NA	NA	NA	NA
WP_015860399.1|1904244_1904622_-	CrcB family protein	NA	A0A2H4J148	uncultured_Caudovirales_phage	32.4	4.8e-06
WP_015860400.1|1904859_1905705_+	Fe-S cluster assembly protein NifU	NA	A0A2H4N7M4	Lake_Baikal_phage	50.0	8.5e-27
WP_015860401.1|1905704_1906892_+	cysteine desulfurase NifS	NA	H7BUW1	unidentified_phage	40.2	7.3e-40
WP_015860402.1|1907287_1908217_+	cysteine synthase A	NA	A0A1X9I5K7	Streptococcus_phage	54.1	2.5e-80
>prophage 5
NC_012796	Desulfovibrio magneticus RS-1, complete genome	5248049	2809834	2816874	5248049	integrase,terminase	Lactobacillus_phage(16.67%)	9	2804995:2805009	2816415:2816429
2804995:2805009	attL	GGCCAGCCCGGCCAC	NA	NA	NA	NA
WP_015861186.1|2809834_2811319_-|terminase	phage terminase large subunit family protein	terminase	A0A2K9VCJ4	Lactobacillus_phage	27.1	9.7e-26
WP_015861187.1|2811452_2812160_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0A8WE94	Clostridium_phage	30.4	2.3e-09
WP_015861188.1|2812211_2812760_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043600608.1|2813815_2815180_-	replicative DNA helicase	NA	A0A1P8VVQ6	Streptococcus_phage	32.5	6.8e-58
WP_015861191.1|2815311_2815566_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A1S5NR91	Burkholderia_phage	55.3	2.2e-15
WP_015861192.1|2815549_2815894_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_015861193.1|2815915_2816248_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_015861194.1|2816244_2816517_+	type II toxin-antitoxin system HicB family antitoxin	NA	A0A0U4ISP5	Pseudomonas_phage	39.8	1.2e-09
2816415:2816429	attR	GGCCAGCCCGGCCAC	NA	NA	NA	NA
WP_015861195.1|2816583_2816874_+	type II toxin-antitoxin system HicB family antitoxin	NA	A0A0D4DCG1	Acinetobacter_phage	46.6	1.1e-13
>prophage 6
NC_012796	Desulfovibrio magneticus RS-1, complete genome	5248049	3029208	3072146	5248049	protease,transposase	Leptospira_phage(37.5%)	30	NA	NA
WP_015861371.1|3029208_3030057_-|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_015861372.1|3030053_3031166_-|protease	FtsH protease activity modulator HflK	protease	NA	NA	NA	NA
WP_015861373.1|3031248_3032613_+	phosphomannomutase/phosphoglucomutase	NA	A0A127AWJ1	Bacillus_phage	31.2	3.0e-53
WP_015861374.1|3032706_3033204_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015861375.1|3033334_3034234_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015861376.1|3034356_3035625_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_015861377.1|3035621_3036326_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.0	4.8e-31
WP_015861378.1|3036303_3037566_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_012750478.1|3037688_3039260_-|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	43.4	6.1e-111
WP_012750477.1|3039309_3039663_-	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	46.7	6.9e-23
WP_012750476.1|3039659_3040010_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_015861379.1|3040532_3041066_-	chemotaxis protein CheW	NA	A0A248SKJ8	Salicola_phage	29.6	9.9e-05
WP_043600662.1|3041085_3043101_-	HAMP domain-containing protein	NA	NA	NA	NA	NA
WP_015861381.1|3043598_3044255_+	MEDS domain-containing protein	NA	NA	NA	NA	NA
WP_015861382.1|3044244_3047433_+	PAS domain S-box protein	NA	A0A1V0SGX0	Hokovirus	29.9	1.9e-34
WP_015861383.1|3048121_3049252_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_015861385.1|3051683_3055022_-	PAS domain S-box protein	NA	NA	NA	NA	NA
WP_148208433.1|3055725_3056673_-	HD domain-containing protein	NA	NA	NA	NA	NA
WP_015861387.1|3056705_3057836_-	response regulator	NA	NA	NA	NA	NA
WP_015861388.1|3057828_3059049_-	HDOD domain-containing protein	NA	NA	NA	NA	NA
WP_015861389.1|3059066_3061793_-	PAS domain-containing protein	NA	NA	NA	NA	NA
WP_148208538.1|3061796_3062645_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_015861391.1|3062916_3063570_+	response regulator	NA	NA	NA	NA	NA
WP_052278995.1|3063740_3064127_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015861392.1|3064907_3066263_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_043600665.1|3066767_3067316_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043600668.1|3067342_3069202_-	ATP-dependent helicase	NA	S5MMD7	Bacillus_phage	31.3	3.9e-80
WP_015861395.1|3069215_3070013_-	PD-(D/E)XK nuclease family protein	NA	NA	NA	NA	NA
WP_148208434.1|3070110_3070533_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012750478.1|3070574_3072146_-|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	43.4	6.1e-111
>prophage 7
NC_012796	Desulfovibrio magneticus RS-1, complete genome	5248049	3380028	3449537	5248049	integrase,transposase	Bacillus_phage(40.0%)	59	3400647:3400664	3452901:3452918
WP_015861633.1|3380028_3381600_+|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	42.5	3.7e-108
WP_015861634.1|3381694_3382615_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_158304250.1|3382877_3384968_+	MCP four helix bundle domain-containing protein	NA	NA	NA	NA	NA
WP_015861636.1|3385011_3385374_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015861638.1|3386260_3386773_+	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_015861639.1|3386841_3388851_+	HAMP domain-containing protein	NA	NA	NA	NA	NA
WP_148208442.1|3388904_3389252_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015861641.1|3389275_3390220_+	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	32.6	2.3e-41
WP_015861642.1|3390326_3393293_+	GAF domain-containing protein	NA	A0A2K9L4R6	Tupanvirus	28.1	2.1e-19
WP_015861643.1|3393319_3393721_+	response regulator	NA	W8CYM9	Bacillus_phage	30.8	1.2e-07
WP_015861644.1|3393781_3394099_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015861645.1|3394749_3395154_-	hemerythrin family protein	NA	NA	NA	NA	NA
WP_015861646.1|3395220_3396297_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	35.6	4.7e-14
WP_015861647.1|3396538_3397738_+	DnaJ domain-containing protein	NA	NA	NA	NA	NA
WP_015861648.1|3398455_3399169_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043600735.1|3400007_3401957_+	autotransporter domain-containing protein	NA	NA	NA	NA	NA
3400647:3400664	attL	GCCGGCCTGGGCGGGGCC	NA	NA	NA	NA
WP_015861650.1|3402051_3403785_+	TIGR03768 family metallophosphoesterase	NA	NA	NA	NA	NA
WP_043600737.1|3404025_3405984_+	tyrosine-protein phosphatase	NA	NA	NA	NA	NA
WP_015861652.1|3406389_3407037_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148208445.1|3407346_3408132_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015861654.1|3408276_3408594_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043600741.1|3408725_3409016_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015861657.1|3409025_3409355_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158304252.1|3409657_3410656_+	WYL domain-containing protein	NA	NA	NA	NA	NA
WP_015861659.1|3410680_3411220_+	3'-5' exonuclease	NA	NA	NA	NA	NA
WP_015861660.1|3411280_3411982_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015861392.1|3412017_3413373_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_015861661.1|3413525_3413849_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148208446.1|3414343_3414607_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015861664.1|3414610_3414808_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015861665.1|3414837_3415215_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158304253.1|3415540_3417265_-	sigma 54-interacting transcriptional regulator	NA	NA	NA	NA	NA
WP_015861669.1|3417825_3418263_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015861670.1|3418339_3418960_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015861671.1|3419226_3422139_+	DUF927 domain-containing protein	NA	NA	NA	NA	NA
WP_015861672.1|3422471_3422792_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015861675.1|3424266_3424644_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015861676.1|3424916_3425474_+|integrase	tyrosine-type recombinase/integrase	integrase	H0USV4	Bacillus_phage	40.4	2.9e-23
WP_081429620.1|3425653_3425881_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_043600747.1|3425882_3426929_+|integrase	site-specific integrase	integrase	K7PHM9	Enterobacterial_phage	23.0	5.1e-05
WP_015861678.1|3426988_3427393_-	hemerythrin family protein	NA	NA	NA	NA	NA
WP_015861679.1|3427459_3428536_-	diguanylate cyclase	NA	NA	NA	NA	NA
WP_015861680.1|3428777_3429977_+	DnaJ domain-containing protein	NA	NA	NA	NA	NA
WP_148208447.1|3430825_3431722_+	PDZ domain-containing protein	NA	NA	NA	NA	NA
WP_015861683.1|3431884_3432214_+	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_148208543.1|3432299_3433232_+	response regulator	NA	Q8QKV7	Ectocarpus_siliculosus_virus	30.6	5.4e-06
WP_015861685.1|3433253_3434489_+	SpoIIE family protein phosphatase	NA	NA	NA	NA	NA
WP_015861686.1|3434571_3435816_+	HD domain-containing protein	NA	NA	NA	NA	NA
WP_043600758.1|3436668_3436893_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015861688.1|3436932_3437130_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015861689.1|3437159_3437537_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148208448.1|3437779_3439624_-	hypothetical protein	NA	A0A220YL66	Alteromonas_virus	25.4	1.3e-48
WP_015861691.1|3439616_3440174_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015861693.1|3441353_3441752_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015861694.1|3442035_3444948_+	DUF927 domain-containing protein	NA	NA	NA	NA	NA
WP_015861695.1|3445278_3445578_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015861697.1|3446897_3447275_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015861698.1|3447549_3448107_+|integrase	tyrosine-type recombinase/integrase	integrase	D2XR58	Bacillus_phage	36.6	4.9e-23
WP_015861700.1|3448490_3449537_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
3452901:3452918	attR	GCCGGCCTGGGCGGGGCC	NA	NA	NA	NA
>prophage 8
NC_012796	Desulfovibrio magneticus RS-1, complete genome	5248049	3581462	3648892	5248049	integrase,tRNA	Leuconostoc_phage(23.08%)	60	3644731:3644745	3653216:3653230
WP_015861806.1|3581462_3582431_+|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	NA	NA	NA	NA
WP_015861807.1|3582447_3582717_+	30S ribosomal protein S15	NA	NA	NA	NA	NA
WP_015861808.1|3582875_3585131_+	polyribonucleotide nucleotidyltransferase	NA	NA	NA	NA	NA
WP_043600818.1|3585297_3586044_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043601797.1|3586163_3587000_-	AmmeMemoRadiSam system protein B	NA	NA	NA	NA	NA
WP_043601799.1|3587087_3590018_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_015861812.1|3590160_3591174_-	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_015861813.1|3591373_3591760_-	flagellar basal body rod protein FlgG	NA	NA	NA	NA	NA
WP_043601802.1|3591885_3592473_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015861815.1|3592656_3594276_-	benzoylformate decarboxylase	NA	NA	NA	NA	NA
WP_043600821.1|3594410_3596381_-	PAS domain-containing hybrid sensor histidine kinase/response regulator	NA	A0A1V0SGX0	Hokovirus	31.8	1.1e-37
WP_043601804.1|3596471_3597248_-	GTP cyclohydrolase I FolE2	NA	NA	NA	NA	NA
WP_015861818.1|3597519_3597939_-	nickel-responsive transcriptional regulator NikR	NA	NA	NA	NA	NA
WP_015861819.1|3598054_3598750_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_015861820.1|3598978_3599353_+	glycine cleavage system protein GcvH	NA	NA	NA	NA	NA
WP_015861821.1|3599367_3600699_+	aminomethyl-transferring glycine dehydrogenase subunit GcvPA	NA	M4QFZ1	Prochlorococcus_phage	34.3	7.9e-43
WP_043600823.1|3600695_3602144_+	aminomethyl-transferring glycine dehydrogenase subunit GcvPB	NA	M4QFZ1	Prochlorococcus_phage	36.6	3.9e-64
WP_015861823.1|3602133_3603501_+	FAD-dependent oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	26.5	9.6e-12
WP_015861824.1|3603632_3604529_+	L-2-amino-thiazoline-4-carboxylic acid hydrolase	NA	NA	NA	NA	NA
WP_015861825.1|3604729_3605326_+	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_043600825.1|3605345_3605729_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015861827.1|3605826_3606414_+	DJ-1/PfpI family protein	NA	NA	NA	NA	NA
WP_043600827.1|3606580_3607027_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_015861829.1|3607119_3607296_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015861830.1|3607953_3609177_+	HD-GYP domain-containing protein	NA	NA	NA	NA	NA
WP_015861831.1|3609849_3610968_+	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_148208454.1|3611183_3611888_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015861835.1|3612793_3613150_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015861836.1|3613271_3614372_-|integrase	site-specific integrase	integrase	A0A097BYJ7	Leuconostoc_phage	23.9	8.0e-09
WP_015861837.1|3614450_3615008_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B0T6D2	Bacillus_phage	39.3	1.7e-23
WP_015861838.1|3615131_3615557_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015861839.1|3615689_3616256_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015861840.1|3616267_3616912_-	PD-(D/E)XK nuclease family protein	NA	NA	NA	NA	NA
WP_015861841.1|3616972_3618031_-	cysteine peptidase	NA	Q0IL45	Leucania_separata_nucleopolyhedrovirus	30.5	2.4e-18
WP_015861843.1|3618324_3619059_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015861844.1|3619135_3620131_-	WYL domain-containing protein	NA	NA	NA	NA	NA
WP_015861845.1|3620127_3620460_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015861847.1|3620930_3621284_+	DUF3024 domain-containing protein	NA	NA	NA	NA	NA
WP_015861848.1|3621302_3622037_-	DUF4145 domain-containing protein	NA	NA	NA	NA	NA
WP_015861849.1|3622170_3622983_-	abortive infection family protein	NA	NA	NA	NA	NA
WP_015861851.1|3623514_3624021_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015861854.1|3625376_3625733_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015861855.1|3625854_3626955_-|integrase	site-specific integrase	integrase	A0A097BYJ7	Leuconostoc_phage	23.9	2.8e-09
WP_015861856.1|3627033_3627591_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0A8WEV9	Clostridium_phage	37.4	4.9e-23
WP_043600840.1|3627866_3628244_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015861859.1|3629646_3630735_-	replication initiation protein	NA	NA	NA	NA	NA
WP_015861860.1|3631036_3631924_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148208455.1|3631927_3632971_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015861863.1|3633881_3634418_-	MucR family transcriptional regulator	NA	NA	NA	NA	NA
WP_015861864.1|3634973_3635354_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081429628.1|3636862_3637765_-	hypothetical protein	NA	C7BGG1	Burkholderia_phage	31.5	3.1e-19
WP_148208545.1|3637847_3638357_-	hypothetical protein	NA	NA	NA	NA	NA
WP_173362482.1|3638946_3639123_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081429629.1|3639320_3640718_+	radical SAM protein	NA	NA	NA	NA	NA
WP_015861871.1|3641072_3642869_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.8	1.0e-53
WP_015861872.1|3643297_3643804_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015861873.1|3643885_3644236_-	hypothetical protein	NA	NA	NA	NA	NA
3644731:3644745	attL	CATAGAAAACGCAAC	NA	NA	NA	NA
WP_148208456.1|3645429_3646290_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015861879.1|3647090_3648215_-|integrase	site-specific integrase	integrase	A0A097BYJ7	Leuconostoc_phage	25.0	3.3e-10
WP_015861880.1|3648334_3648892_-|integrase	tyrosine-type recombinase/integrase	integrase	D2XR58	Bacillus_phage	36.1	1.9e-22
3653216:3653230	attR	GTTGCGTTTTCTATG	NA	NA	NA	NA
>prophage 9
NC_012796	Desulfovibrio magneticus RS-1, complete genome	5248049	4603838	4658673	5248049	integrase,transposase	Leptospira_phage(25.0%)	52	4602306:4602323	4631768:4631785
4602306:4602323	attL	GCCGAGGCCGCCGCCGCC	NA	NA	NA	NA
WP_015862693.1|4603838_4605005_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_012750478.1|4605424_4606996_-|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	43.4	6.1e-111
WP_012750477.1|4607045_4607399_-	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	46.7	6.9e-23
WP_012750476.1|4607395_4607746_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_015862694.1|4607806_4608706_+|integrase	site-specific integrase	integrase	A0A1S5NNJ1	Burkholderia_phage	29.1	2.1e-07
WP_015862695.1|4609835_4611269_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	33.2	1.1e-53
WP_015862696.1|4611466_4612417_+	response regulator	NA	NA	NA	NA	NA
WP_015862697.1|4612449_4613619_-	SpoIIE family protein phosphatase	NA	W8CYM9	Bacillus_phage	38.3	8.8e-14
WP_015862698.1|4613788_4616797_-	OmpA family protein	NA	NA	NA	NA	NA
WP_043601151.1|4616835_4617696_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148208553.1|4617767_4619615_-	KUP/HAK/KT family potassium transporter	NA	M1I6H8	Paramecium_bursaria_Chlorella_virus	35.0	1.4e-74
WP_158304261.1|4620112_4621696_+	AAA family ATPase	NA	A0A2C9CXH0	Yersinia_phage	38.0	2.5e-48
WP_015862702.1|4621726_4622638_-	P-loop NTPase	NA	NA	NA	NA	NA
WP_015862703.1|4622634_4623192_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015862704.1|4623349_4624423_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015862705.1|4624825_4625143_-	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_015862706.1|4625234_4625759_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015862707.1|4625996_4626833_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015862708.1|4626819_4627431_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015862709.1|4627541_4628990_-	HEAT repeat domain-containing protein	NA	NA	NA	NA	NA
WP_015862710.1|4629032_4630244_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015862711.1|4630287_4631331_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052279024.1|4631323_4632271_-	hypothetical protein	NA	NA	NA	NA	NA
4631768:4631785	attR	GGCGGCGGCGGCCTCGGC	NA	NA	NA	NA
WP_015862713.1|4632498_4632837_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015862714.1|4632896_4633952_-	rod shape-determining protein	NA	NA	NA	NA	NA
WP_015862715.1|4633979_4634522_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015862716.1|4634582_4635323_-	metal-dependent transcriptional regulator	NA	NA	NA	NA	NA
WP_158304262.1|4635375_4637265_-	50S ribosome-binding GTPase	NA	NA	NA	NA	NA
WP_015862718.1|4637383_4637809_+	4Fe-4S binding protein	NA	NA	NA	NA	NA
WP_148208486.1|4637771_4638044_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015862720.1|4638057_4638381_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043601157.1|4638384_4638696_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015862722.1|4638770_4639676_-	cation transporter	NA	NA	NA	NA	NA
WP_015862723.1|4639679_4639952_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043601163.1|4640012_4640396_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015862725.1|4640376_4641237_-	4Fe-4S binding protein	NA	NA	NA	NA	NA
WP_015862726.1|4641309_4641714_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015862727.1|4641931_4642789_-	trypsin-like peptidase domain-containing protein	NA	A0A1B1IT49	uncultured_Mediterranean_phage	35.0	3.1e-16
WP_015862728.1|4642785_4645161_-	trypsin-like peptidase domain-containing protein	NA	NA	NA	NA	NA
WP_015862729.1|4645162_4646791_-	PDZ domain-containing protein	NA	NA	NA	NA	NA
WP_015862730.1|4646820_4648092_-	PDZ domain-containing protein	NA	NA	NA	NA	NA
WP_015862731.1|4648105_4648981_-	cation transporter	NA	NA	NA	NA	NA
WP_015862732.1|4649137_4649638_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052279026.1|4649656_4650403_-	LemA family protein	NA	NA	NA	NA	NA
WP_015862734.1|4650427_4650763_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043601171.1|4650807_4651767_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043601173.1|4651799_4652597_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_043601177.1|4652589_4652784_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043601180.1|4653423_4654743_+|transposase	IS1380 family transposase	transposase	NA	NA	NA	NA
WP_012749714.1|4655396_4656752_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_052279027.1|4657352_4658189_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052279028.1|4658211_4658673_+|transposase	transposase	transposase	NA	NA	NA	NA
