The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_010729	Porphyromonas gingivalis ATCC 33277, complete genome	2354886	178930	237517	2354886	tRNA,transposase	Ralstonia_phage(50.0%)	47	NA	NA
WP_077110404.1|178930_179143_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_012457297.1|179294_179873_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_012457298.1|180658_181630_+	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_005873709.1|181747_182557_-	MBL fold metallo-hydrolase	NA	A0A0C5AJ36	Paenibacillus_phage	32.4	2.1e-30
WP_021663757.1|182609_183689_-	asparaginase	NA	NA	NA	NA	NA
WP_004584653.1|184288_185299_+	type I glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_039416899.1|185438_186386_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_012457302.1|186497_187172_-	YggS family pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_004584649.1|187168_187612_-	DUF4494 domain-containing protein	NA	NA	NA	NA	NA
WP_012457304.1|188161_188743_+	DUF3575 domain-containing protein	NA	NA	NA	NA	NA
WP_012457305.1|188768_190241_+	DUF3868 domain-containing protein	NA	NA	NA	NA	NA
WP_012457306.1|190296_191448_+	fimbria major subunit	NA	NA	NA	NA	NA
WP_039417483.1|192511_193873_+	DUF4906 domain-containing protein	NA	NA	NA	NA	NA
WP_012457310.1|193887_195900_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012457311.1|195896_197549_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157761716.1|197583_197838_+	DUF1661 domain-containing protein	NA	NA	NA	NA	NA
WP_012457313.1|198081_198633_+	DUF177 domain-containing protein	NA	NA	NA	NA	NA
WP_010956508.1|198639_198825_+	50S ribosomal protein L32	NA	NA	NA	NA	NA
WP_012457314.1|199004_200012_+	ketoacyl-ACP synthase III	NA	NA	NA	NA	NA
WP_012457315.1|200090_200990_+	GTPase Era	NA	NA	NA	NA	NA
WP_005873469.1|201052_202366_+	ribosome biogenesis GTPase Der	NA	NA	NA	NA	NA
WP_012457316.1|202416_205716_+	DUF2723 domain-containing protein	NA	NA	NA	NA	NA
WP_004584632.1|205716_206364_+	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_012457317.1|206389_207076_+|tRNA	tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD	tRNA	NA	NA	NA	NA
WP_004584630.1|207274_207856_-	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_012457318.1|207892_209230_-	purine permease	NA	H9YQ34	environmental_Halophage	45.9	2.6e-22
WP_012457319.1|209390_210062_-	PorT family protein	NA	NA	NA	NA	NA
WP_012457320.1|210121_211627_-	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_143733416.1|212570_212681_+	DUF1661 domain-containing protein	NA	NA	NA	NA	NA
WP_012457321.1|213102_213288_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012457322.1|213314_214205_-	TraB/GumN family protein	NA	NA	NA	NA	NA
WP_012457323.1|214250_214997_-	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_012457324.1|215326_216328_+	M28 family peptidase	NA	NA	NA	NA	NA
WP_004584619.1|216351_216777_+	SufE family protein	NA	NA	NA	NA	NA
WP_012457325.1|216780_218178_+	protoporphyrinogen oxidase	NA	NA	NA	NA	NA
WP_012457326.1|219031_219931_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_012457327.1|219927_221079_-	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
WP_004583692.1|221115_221886_-	5'/3'-nucleotidase SurE	NA	NA	NA	NA	NA
WP_012457328.1|221882_222440_-	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_012457329.1|222436_223984_-|tRNA	glycine--tRNA ligase	tRNA	A0A2I2L3K8	Orpheovirus	29.8	5.4e-43
WP_012457330.1|224296_225382_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	27.8	3.8e-19
WP_012457331.1|225615_226788_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_012457332.1|226941_228027_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	27.3	2.9e-19
WP_012457333.1|228169_228556_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012457337.1|235109_236195_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	28.4	1.5e-20
WP_039417507.1|236502_237003_+|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
WP_173032066.1|236938_237517_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 2
NC_010729	Porphyromonas gingivalis ATCC 33277, complete genome	2354886	618593	674633	2354886	tRNA,transposase,tail	Ralstonia_phage(40.0%)	43	NA	NA
WP_012457606.1|618593_619646_-|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_012457607.1|619663_620440_-|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	NA	NA	NA	NA
WP_012457608.1|620449_621292_-	undecaprenyl-diphosphate phosphatase	NA	NA	NA	NA	NA
WP_005874556.1|621399_621627_-	DUF3098 domain-containing protein	NA	NA	NA	NA	NA
WP_004585370.1|621673_622501_-	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_012457610.1|624174_624516_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_012457613.1|626731_627817_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	27.1	1.3e-19
WP_012457616.1|629352_634965_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_012457617.1|635150_636635_+	DUF3945 domain-containing protein	NA	NA	NA	NA	NA
WP_012457618.1|636730_638812_+	type IA DNA topoisomerase	NA	A0A076FM50	Aureococcus_anophage	25.1	5.0e-20
WP_012457619.1|638953_640594_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039417024.1|640577_640856_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_012457521.1|642230_643133_+|transposase	IS982-like element IS195 family transposase	transposase	NA	NA	NA	NA
WP_012457621.1|643171_643486_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012457622.1|643569_644655_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	27.4	5.8e-20
WP_039417026.1|645349_645604_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012457624.1|645608_645830_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012457625.1|646046_647105_+	Fic family protein	NA	D7RWK9	Brochothrix_phage	28.5	1.6e-06
WP_012457626.1|647135_648518_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012457627.1|648637_649075_-	DUF3872 domain-containing protein	NA	NA	NA	NA	NA
WP_012457628.1|649094_649679_-	conjugal transfer protein TraO	NA	NA	NA	NA	NA
WP_012457629.1|649683_650619_-	conjugative transposon protein TraN	NA	NA	NA	NA	NA
WP_012457630.1|650692_652054_-	conjugative transposon protein TraM	NA	NA	NA	NA	NA
WP_012457631.1|652050_652314_-	DUF3989 domain-containing protein	NA	NA	NA	NA	NA
WP_012457632.1|652317_652941_-	conjugative transposon protein TraK	NA	NA	NA	NA	NA
WP_012457633.1|652958_653945_-	conjugative transposon protein TraJ	NA	NA	NA	NA	NA
WP_012457634.1|653965_654589_-	DUF4141 domain-containing protein	NA	NA	NA	NA	NA
WP_012457635.1|654640_655108_-	TraG family conjugative transposon ATPase	NA	NA	NA	NA	NA
WP_012457637.1|655768_656854_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	27.4	5.8e-20
WP_012457638.1|657386_657560_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004585574.1|657989_658472_+	ferritin	NA	NA	NA	NA	NA
WP_012457639.1|658719_659805_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	27.8	3.8e-19
WP_012457640.1|659924_661913_-	glucosamine-6-phosphate deaminase	NA	NA	NA	NA	NA
WP_012457641.1|662069_664232_-	S46 family peptidase	NA	NA	NA	NA	NA
WP_012457642.1|664294_664750_-	CYTH domain-containing protein	NA	Q76Z87	Aeromonas_virus	34.9	9.6e-09
WP_012457643.1|664773_665898_-	DUF2027 domain-containing protein	NA	NA	NA	NA	NA
WP_012457644.1|666063_667311_-	DUF1015 domain-containing protein	NA	NA	NA	NA	NA
WP_012457645.1|667329_668250_-	3-phosphoglycerate dehydrogenase	NA	A0A2R8FCS0	Cedratvirus	27.6	2.5e-19
WP_005874020.1|668350_669433_-	phosphoserine transaminase	NA	M1Q1P2	Streptococcus_phage	42.5	1.4e-74
WP_039417505.1|669766_671032_-	nucleotide sugar dehydrogenase	NA	A7IWZ0	Paramecium_bursaria_Chlorella_virus	27.0	1.4e-25
WP_012457647.1|671336_671843_-	histidinol-phosphate aminotransferase	NA	NA	NA	NA	NA
WP_004585684.1|672378_672945_-	elongation factor P	NA	NA	NA	NA	NA
WP_012457649.1|673076_674633_-|tail	lamin tail domain-containing protein	tail	NA	NA	NA	NA
>prophage 3
NC_010729	Porphyromonas gingivalis ATCC 33277, complete genome	2354886	901711	1051143	2354886	protease,tRNA,transposase,integrase	Ralstonia_phage(13.64%)	113	951481:951540	1064023:1064179
WP_012457800.1|901711_904489_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	43.3	8.0e-207
WP_012457804.1|906025_907585_-	FAD-binding protein	NA	NA	NA	NA	NA
WP_004585338.1|907569_909021_-	HD domain-containing protein	NA	A0A2I2MPB1	Mycobacterium_phage	28.8	1.2e-31
WP_077110393.1|909153_909426_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012457806.1|909660_911010_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	26.5	8.3e-32
WP_012457807.1|911014_911806_-	glucosamine-6-phosphate deaminase	NA	NA	NA	NA	NA
WP_039417254.1|911843_913052_-	FprA family A-type flavoprotein	NA	NA	NA	NA	NA
WP_004585342.1|913085_913937_-	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_012457809.1|913973_914879_-	diaminopimelate dehydrogenase	NA	NA	NA	NA	NA
WP_012457810.1|914916_915963_-	transcription antitermination factor NusB	NA	NA	NA	NA	NA
WP_012457811.1|916647_924147_-	cell surface protein SprA	NA	NA	NA	NA	NA
WP_012457812.1|924186_924795_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_012457813.1|925238_926324_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	27.8	2.2e-19
WP_012457814.1|926427_926592_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012457815.1|926878_929554_-	carboxypeptidase regulatory-like domain-containing protein	NA	NA	NA	NA	NA
WP_012457816.1|929570_930287_-	GLPGLI family protein	NA	NA	NA	NA	NA
WP_005874614.1|930383_930596_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012457817.1|930873_931980_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_012457818.1|932088_932283_+	exodeoxyribonuclease VII small subunit	NA	NA	NA	NA	NA
WP_004585423.1|932279_932948_+	2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_012457819.1|933733_934819_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	27.8	4.9e-19
WP_012457820.1|935042_935576_+	ORF6N domain-containing protein	NA	NA	NA	NA	NA
WP_012457821.1|935602_936061_+	DUF1896 domain-containing protein	NA	NA	NA	NA	NA
WP_173032069.1|936445_936778_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012457823.1|936784_937306_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005874553.1|937318_937546_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012457824.1|937568_937850_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012457825.1|937862_938165_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012457828.1|938886_940173_-	T9SS type A sorting domain-containing protein	NA	NA	NA	NA	NA
WP_023846950.1|941352_942498_-	A/G-specific adenine glycosylase	NA	G3CB03	Aeropyrum_pernix_spindle-shaped_virus	31.6	2.9e-25
WP_004585466.1|942625_943564_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_012457832.1|943615_944314_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	32.0	3.4e-29
WP_012457833.1|944310_945060_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_052269035.1|945019_946159_+	porin	NA	NA	NA	NA	NA
WP_004585462.1|946342_946996_+	LysE family transporter	NA	NA	NA	NA	NA
WP_012457835.1|947072_949814_-	DEAD/DEAH box helicase family protein	NA	NA	NA	NA	NA
WP_102981810.1|949806_951474_-	site-specific DNA-methyltransferase	NA	A0A220NUF4	Escherichia_phage	39.8	9.8e-75
951481:951540	attL	TTAACGTCAGTTCGACGTAAGAAAAAGCCAATGAATTTGTTTTCTGATTAGGGTTAAACG	NA	NA	NA	NA
WP_012457521.1|951637_952540_+|transposase	IS982-like element IS195 family transposase	transposase	NA	NA	NA	NA
WP_012457837.1|952700_954218_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	41.6	5.1e-54
WP_004585450.1|954320_955340_+	rod shape-determining protein	NA	NA	NA	NA	NA
WP_005873531.1|955377_956265_+	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_004585452.1|956264_956783_+	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_012457838.1|956775_958641_+	penicillin-binding protein 2	NA	NA	NA	NA	NA
WP_012457839.1|958630_960088_+	rod shape-determining protein RodA	NA	NA	NA	NA	NA
WP_012457840.1|960115_961327_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012457841.1|961558_962017_+	HU family DNA-binding protein	NA	NA	NA	NA	NA
WP_012457842.1|962081_962792_+	DUF3256 family protein	NA	NA	NA	NA	NA
WP_012457843.1|962828_963755_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012457844.1|963938_966518_+	DNA gyrase subunit A	NA	G3M9Z5	Bacillus_virus	33.8	1.9e-109
WP_012457845.1|966551_967754_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_039417240.1|968111_968321_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_012457846.1|968345_971243_+	DEAD/DEAH box helicase	NA	A0A2H4J643	uncultured_Caudovirales_phage	43.8	1.4e-214
WP_012457847.1|971274_971727_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012457848.1|971812_972715_-|transposase	IS982-like element IS195 family transposase	transposase	NA	NA	NA	NA
WP_004585448.1|973196_974576_-	tryptophanase	NA	NA	NA	NA	NA
WP_039417237.1|974828_975974_-	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_039417236.1|975970_976885_-|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_004585445.1|976868_977585_-|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_012457851.1|977611_980467_-	LPS-assembly protein LptD	NA	NA	NA	NA	NA
WP_012457852.1|980939_981476_-	pyridoxamine 5'-phosphate oxidase family protein	NA	NA	NA	NA	NA
WP_012457853.1|981738_982704_+	cation transporter	NA	NA	NA	NA	NA
WP_102981811.1|982700_983219_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012457855.1|983308_984994_-	putative transporter	NA	NA	NA	NA	NA
WP_012457856.1|986904_989508_+	carboxypeptidase-like regulatory domain-containing protein	NA	NA	NA	NA	NA
WP_012457857.1|989940_990882_+	nitronate monooxygenase	NA	NA	NA	NA	NA
WP_077110377.1|990878_991109_+	cysteine-rich CWC family protein	NA	NA	NA	NA	NA
WP_012457858.1|991177_992824_+	fumarate hydratase	NA	NA	NA	NA	NA
WP_012457859.1|992946_994755_+	DNA polymerase III subunit gamma/tau	NA	A0A1U9WR94	Streptococcus_virus	39.1	6.1e-46
WP_010956309.1|995191_995362_-	4Fe-4S binding protein	NA	NA	NA	NA	NA
WP_021679755.1|995697_997218_-	D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase	NA	NA	NA	NA	NA
WP_005873463.1|997442_999113_-	peptidylarginine deiminase PPAD	NA	NA	NA	NA	NA
WP_012457863.1|1000328_1002860_-|protease	thiol protease/hemagglutinin PrtT	protease	NA	NA	NA	NA
WP_012457864.1|1002999_1003485_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	42.9	9.9e-28
WP_012457865.1|1003576_1004263_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_012457866.1|1004448_1005132_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_043876361.1|1005144_1006953_-	tetratricopeptide repeat-containing sensor histidine kinase	NA	NA	NA	NA	NA
WP_004584462.1|1007956_1008754_-	dihydroorotate dehydrogenase electron transfer subunit	NA	NA	NA	NA	NA
WP_004584463.1|1008805_1009246_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_012457848.1|1010417_1011320_-|transposase	IS982-like element IS195 family transposase	transposase	NA	NA	NA	NA
WP_012457870.1|1011517_1012690_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012457871.1|1012704_1013355_-	viroplasmin family protein	NA	NA	NA	NA	NA
WP_039417164.1|1013382_1014396_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_012457873.1|1014408_1014948_-	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_012457874.1|1014956_1016744_-	aminopeptidase P family protein	NA	A0A0P0I8D7	Acinetobacter_phage	40.7	2.5e-129
WP_012457875.1|1016792_1018340_-	DUF4301 family protein	NA	NA	NA	NA	NA
WP_012457876.1|1018922_1020845_+	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	48.8	5.9e-140
WP_039417168.1|1021055_1021610_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_012457877.1|1021622_1022885_+|integrase	site-specific integrase	integrase	H7BUI8	unidentified_phage	26.2	2.2e-10
WP_039417535.1|1022905_1023427_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012457878.1|1023530_1024616_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	28.1	9.9e-20
WP_012457879.1|1025093_1025738_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039417172.1|1025767_1025977_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039417536.1|1026619_1027813_+	virulence-associated protein E	NA	D3W0G0	Lactococcus_phage	27.8	4.0e-14
WP_012457883.1|1028043_1028931_+	toprim domain-containing protein	NA	NA	NA	NA	NA
WP_012457884.1|1029060_1029423_+	plasmid mobilization relaxosome protein MobC	NA	NA	NA	NA	NA
WP_012457885.1|1029412_1030354_+	relaxase/mobilization nuclease domain-containing protein	NA	NA	NA	NA	NA
WP_102981824.1|1030394_1031102_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043876322.1|1031219_1031435_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_012457888.1|1031506_1032715_+	SIR2 family protein	NA	NA	NA	NA	NA
WP_012457889.1|1032704_1034606_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_080504411.1|1034587_1034797_+	KTSC domain-containing protein	NA	A0A0K1LMB5	Caulobacter_phage	55.1	1.9e-12
WP_012457890.1|1034801_1035848_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012457892.1|1037240_1037696_+	GNAT family N-acetyltransferase	NA	E9LUK4	Lactobacillus_phage	38.4	2.7e-19
WP_012457893.1|1037749_1039207_+	putative DNA binding domain-containing protein	NA	NA	NA	NA	NA
WP_012457848.1|1039360_1040263_+|transposase	IS982-like element IS195 family transposase	transposase	NA	NA	NA	NA
WP_012457894.1|1040508_1042389_+	DUF349 domain-containing protein	NA	NA	NA	NA	NA
WP_012457895.1|1042629_1043583_+	D-2-hydroxyacid dehydrogenase	NA	M1NSB9	Streptococcus_phage	27.4	2.1e-21
WP_012457897.1|1043969_1045118_+	8-amino-7-oxononanoate synthase	NA	NA	NA	NA	NA
WP_012457898.1|1045117_1045537_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012457899.1|1046328_1047720_+	lipase	NA	NA	NA	NA	NA
WP_012457900.1|1047724_1048531_+	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
WP_043876323.1|1048569_1050087_+	MBOAT family protein	NA	A0A125RNP0	Pseudomonas_phage	36.5	1.2e-63
WP_012457902.1|1050240_1051143_-|transposase	IS982-like element IS195 family transposase	transposase	NA	NA	NA	NA
1064023:1064179	attR	TTAACGTCAGTTCGACGTAAGAAAAAGCCAATGAATTTGTTTTCTGATTAGGGTTAAACGCCCAAAGAACGTGGGCATTATGCTTGAAAAAGTAGCGAATTATTTGTATCTTAGCTGTTGACAATCAATAAGATACGAACAAACAAAACGCTACTTT	NA	NA	NA	NA
>prophage 4
NC_010729	Porphyromonas gingivalis ATCC 33277, complete genome	2354886	1064179	1117903	2354886	tRNA,transposase	Tupanvirus(25.0%)	47	NA	NA
WP_012457848.1|1064179_1065082_+|transposase	IS982-like element IS195 family transposase	transposase	NA	NA	NA	NA
WP_012457911.1|1066018_1066921_-|transposase	IS982-like element IS195 family transposase	transposase	NA	NA	NA	NA
WP_012457913.1|1067322_1067865_-	HXXEE domain-containing protein	NA	NA	NA	NA	NA
WP_021663951.1|1067961_1068276_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_039417189.1|1068394_1069303_-	TIGR01777 family protein	NA	NA	NA	NA	NA
WP_077070235.1|1070368_1070470_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_039417192.1|1070518_1070716_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004584228.1|1070861_1072823_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.6	8.4e-126
WP_012457917.1|1072924_1073563_+	translation initiation factor IF-3	NA	NA	NA	NA	NA
WP_004584226.1|1073606_1073804_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_012457918.1|1073916_1074264_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_039417546.1|1074795_1075296_+|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
WP_173032070.1|1075237_1075942_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_012457920.1|1076268_1077045_-	DUF4252 domain-containing protein	NA	NA	NA	NA	NA
WP_012457921.1|1077060_1077621_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012457922.1|1077610_1078117_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_012457923.1|1078413_1079499_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	27.8	3.8e-19
WP_148188646.1|1079829_1082211_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_012457925.1|1083417_1085742_-	BamA/TamA family outer membrane protein	NA	NA	NA	NA	NA
WP_012457926.1|1085769_1086519_-	shikimate dehydrogenase	NA	NA	NA	NA	NA
WP_012457927.1|1086515_1087253_-	bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE	NA	NA	NA	NA	NA
WP_012457928.1|1087284_1088226_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0M4JBD3	Mollivirus	28.2	1.2e-26
WP_012457929.1|1088282_1089275_-	PhoH family protein	NA	W8D063	Erwinia_phage	50.0	9.3e-49
WP_012457932.1|1089894_1092210_-	glycoside hydrolase family 92 protein	NA	NA	NA	NA	NA
WP_012457933.1|1092348_1093566_+|tRNA	S-adenosylmethionine:tRNA ribosyltransferase-isomerase	tRNA	NA	NA	NA	NA
WP_012457934.1|1093970_1094888_-	restriction endonuclease	NA	NA	NA	NA	NA
WP_004584192.1|1095990_1096656_+	phosphatidylserine decarboxylase family protein	NA	NA	NA	NA	NA
WP_012457936.1|1096657_1097368_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_004584190.1|1097434_1097680_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004584188.1|1097960_1099442_+|tRNA	proline--tRNA ligase	tRNA	A0A2K9L3R9	Tupanvirus	37.3	3.7e-94
WP_004584187.1|1099496_1099826_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012457937.1|1099840_1100608_+|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_004584185.1|1100627_1101746_+	Mrp/NBP35 family ATP-binding protein	NA	NA	NA	NA	NA
WP_021662093.1|1102251_1103634_+	YihY/virulence factor BrkB family protein	NA	NA	NA	NA	NA
WP_012457939.1|1103667_1104639_-	riboflavin biosynthesis protein RibF	NA	NA	NA	NA	NA
WP_012457940.1|1104626_1105922_-	peptidoglycan DD-metalloendopeptidase family protein	NA	NA	NA	NA	NA
WP_043876364.1|1105933_1106794_-	DUF4292 domain-containing protein	NA	NA	NA	NA	NA
WP_012457944.1|1108559_1108994_-	dUTP diphosphatase	NA	V9SFR6	Tunisvirus	61.3	2.3e-44
WP_012457945.1|1109050_1110796_-	4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase	NA	NA	NA	NA	NA
WP_004584177.1|1110969_1111476_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	44.9	2.1e-25
WP_004584176.1|1111476_1111857_-	glycine cleavage system protein GcvH	NA	NA	NA	NA	NA
WP_012457946.1|1112024_1113032_-	DNA polymerase III subunit delta	NA	NA	NA	NA	NA
WP_005874391.1|1113050_1113827_-	AMP nucleosidase	NA	NA	NA	NA	NA
WP_012457947.1|1113895_1114369_+	type I restriction enzyme HsdR N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_012457948.1|1114371_1115331_+	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.8	1.9e-22
WP_012457949.1|1115335_1116664_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_012457950.1|1117000_1117903_-|transposase	IS982-like element IS195 family transposase	transposase	NA	NA	NA	NA
>prophage 5
NC_010729	Porphyromonas gingivalis ATCC 33277, complete genome	2354886	1135227	1200900	2354886	tRNA,transposase	Bacillus_virus(16.67%)	55	NA	NA
WP_012457963.1|1135227_1135644_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
WP_012457964.1|1135643_1135871_+	immunity 17 family protein	NA	NA	NA	NA	NA
WP_012457965.1|1135998_1136613_+	thymidine kinase	NA	G3MBK1	Bacillus_virus	45.9	1.5e-33
WP_012457966.1|1136609_1137425_+	5'-nucleotidase, lipoprotein e(P4) family	NA	NA	NA	NA	NA
WP_005875201.1|1137463_1137799_+	30S ribosome-binding factor RbfA	NA	NA	NA	NA	NA
WP_012457967.1|1137826_1139050_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_012457968.1|1139195_1139933_+	polyprenol monophosphomannose synthase	NA	A0A0N7A8R9	Sulfolobus_monocaudavirus	34.5	8.5e-23
WP_012457969.1|1139943_1141293_+	dihydroorotase	NA	NA	NA	NA	NA
WP_004584150.1|1141459_1142215_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005875177.1|1142180_1142576_+	GtrA family protein	NA	NA	NA	NA	NA
WP_012457972.1|1143164_1143644_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004584145.1|1143861_1144575_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012457973.1|1144922_1146488_+	sugar transporter	NA	NA	NA	NA	NA
WP_005875195.1|1146613_1147186_+	FHA domain-containing protein	NA	NA	NA	NA	NA
WP_012457974.1|1147240_1148542_+	serine dehydratase subunit alpha family protein	NA	NA	NA	NA	NA
WP_039417209.1|1148558_1149050_+	DNA-deoxyinosine glycosylase	NA	NA	NA	NA	NA
WP_012457976.1|1149161_1149614_-	copper resistance protein NlpE N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_004584135.1|1150638_1151181_+	pyruvoyl-dependent arginine decarboxylase	NA	NA	NA	NA	NA
WP_039417211.1|1151307_1153533_+	glycoside hydrolase family 92 protein	NA	NA	NA	NA	NA
WP_004584133.1|1153712_1153961_+	DUF4492 domain-containing protein	NA	NA	NA	NA	NA
WP_012457978.1|1153980_1155570_+	cytochrome ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_012457979.1|1155615_1156779_+	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_012457980.1|1156925_1157717_+	patatin-like phospholipase family protein	NA	M1I2P3	Paramecium_bursaria_Chlorella_virus	28.8	1.1e-07
WP_012457981.1|1157713_1159408_+	alpha-amylase	NA	NA	NA	NA	NA
WP_012457982.1|1159872_1163079_-	DUF4981 domain-containing protein	NA	L0N6M2	Herpes_simplex_virus	31.3	2.5e-127
WP_004584127.1|1164288_1164981_+	DNA repair protein RadC	NA	NA	NA	NA	NA
WP_012457983.1|1165205_1166858_+	hydroxylamine reductase	NA	NA	NA	NA	NA
WP_013815682.1|1167291_1167441_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012457985.1|1168009_1169701_-	alkaline phosphatase	NA	NA	NA	NA	NA
WP_012457986.1|1169736_1170933_-	aminopeptidase P family protein	NA	NA	NA	NA	NA
WP_012457988.1|1171431_1172196_-	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_004584120.1|1172192_1173293_-	bifunctional 3-deoxy-7-phosphoheptulonate synthase/chorismate mutase type II	NA	NA	NA	NA	NA
WP_012457989.1|1173308_1174559_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_012457990.1|1174555_1175917_-	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_012457991.1|1175913_1176879_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_004584116.1|1176952_1177975_-	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	65.6	2.7e-115
WP_012457992.1|1177995_1178451_-	thioredoxin-dependent thiol peroxidase	NA	NA	NA	NA	NA
WP_012457993.1|1178751_1179021_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012457521.1|1179007_1179910_-|transposase	IS982-like element IS195 family transposase	transposase	NA	NA	NA	NA
WP_012457994.1|1180395_1181307_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039417213.1|1181470_1182895_+|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE	tRNA	NA	NA	NA	NA
WP_012457996.1|1183204_1183396_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_012457997.1|1183609_1184512_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_012457848.1|1184665_1185568_-|transposase	IS982-like element IS195 family transposase	transposase	NA	NA	NA	NA
WP_012457521.1|1185975_1186878_+|transposase	IS982-like element IS195 family transposase	transposase	NA	NA	NA	NA
WP_012457998.1|1186923_1188018_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051892392.1|1188014_1188518_-	LOG family protein	NA	NA	NA	NA	NA
WP_012457999.1|1188514_1189525_-	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_012458000.1|1189491_1190520_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012458001.1|1190494_1191574_-	radical SAM protein	NA	NA	NA	NA	NA
WP_012458002.1|1191491_1192352_-	phosphotransferase	NA	NA	NA	NA	NA
WP_012458003.1|1192348_1193278_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_039417217.1|1193285_1194434_-	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	NA	NA	NA	NA
WP_012458005.1|1194415_1195786_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012458008.1|1199814_1200900_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	27.4	3.4e-20
>prophage 6
NC_010729	Porphyromonas gingivalis ATCC 33277, complete genome	2354886	1535302	1609576	2354886	tRNA,transposase	Ralstonia_phage(45.45%)	45	NA	NA
WP_012458231.1|1535302_1537933_+|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L1X7	Tupanvirus	41.7	2.7e-95
WP_039417117.1|1537947_1539009_+	3-dehydroquinate synthase	NA	NA	NA	NA	NA
WP_005874778.1|1539253_1539985_-	DNA alkylation repair protein	NA	NA	NA	NA	NA
WP_023847619.1|1539999_1540761_-	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_004584578.1|1540790_1541057_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012458235.1|1541837_1543073_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_012458236.1|1543085_1545095_-	NAD-dependent DNA ligase LigA	NA	A0A0A8J9A9	Ralstonia_phage	35.9	3.7e-105
WP_012458237.1|1545082_1545610_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_012458238.1|1545616_1546240_-	recombination protein RecR	NA	NA	NA	NA	NA
WP_004584583.1|1546236_1547751_-	Rne/Rng family ribonuclease	NA	NA	NA	NA	NA
WP_004584585.1|1548071_1548350_-	integration host factor subunit beta	NA	NA	NA	NA	NA
WP_012458240.1|1548461_1549592_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_080504445.1|1549743_1550235_-	anaerobic ribonucleoside-triphosphate reductase activating protein	NA	A0A1W5P0X3	Cronobacter_phage	42.7	4.2e-26
WP_012458242.1|1550267_1552664_-	anaerobic ribonucleoside triphosphate reductase	NA	A0A0A8WEK0	Clostridium_phage	44.0	3.1e-183
WP_012457639.1|1553592_1554678_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	27.8	3.8e-19
WP_012458244.1|1561166_1562798_-	L-glutamate gamma-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_012458245.1|1562874_1563804_-	amidinotransferase	NA	NA	NA	NA	NA
WP_012458246.1|1563810_1565040_-	ornithine--oxo-acid transaminase	NA	NA	NA	NA	NA
WP_004585684.1|1565489_1566056_+	elongation factor P	NA	NA	NA	NA	NA
WP_012457647.1|1566591_1567098_+	histidinol-phosphate aminotransferase	NA	NA	NA	NA	NA
WP_012458248.1|1567239_1568916_-	putative transporter	NA	NA	NA	NA	NA
WP_012458249.1|1569132_1570488_+	dipeptidase	NA	NA	NA	NA	NA
WP_012458250.1|1570562_1571837_+	amidohydrolase	NA	NA	NA	NA	NA
WP_005874035.1|1571856_1572678_+	purine nucleoside phosphorylase I, inosine and guanosine-specific	NA	Q5YBA4	Grouper_iridovirus	41.2	7.5e-52
WP_012458253.1|1574604_1575123_+	histidinol phosphate phosphatase	NA	NA	NA	NA	NA
WP_012458254.1|1575648_1578471_+	T9SS type A sorting domain-containing protein	NA	NA	NA	NA	NA
WP_005873434.1|1579765_1583347_-	pyruvate:ferredoxin (flavodoxin) oxidoreductase	NA	NA	NA	NA	NA
WP_004585089.1|1583535_1584717_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_012457923.1|1585173_1586259_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	27.8	3.8e-19
WP_039417586.1|1586408_1586648_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_012458261.1|1588290_1589259_+	adenine-specific methyltransferase EcoRI family protein	NA	A0A1B0XVT8	Campylobacter_phage	40.2	1.2e-35
WP_012457521.1|1589939_1590842_-|transposase	IS982-like element IS195 family transposase	transposase	NA	NA	NA	NA
WP_010956062.1|1591071_1591371_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012458263.1|1591355_1594505_-	efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	26.0	2.3e-101
WP_012458264.1|1594501_1595563_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_012458265.1|1595598_1596987_-	TolC family protein	NA	NA	NA	NA	NA
WP_012458266.1|1597754_1598840_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	27.8	6.4e-19
WP_012458267.1|1599205_1600666_-	aminoacyl-histidine dipeptidase	NA	NA	NA	NA	NA
WP_004585076.1|1600746_1600962_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012458268.1|1600994_1601615_+	OmpH family outer membrane protein	NA	NA	NA	NA	NA
WP_012458269.1|1601795_1604279_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_143733434.1|1605249_1605414_+	DUF1661 domain-containing protein	NA	NA	NA	NA	NA
WP_012458272.1|1605476_1606325_+	VanW family protein	NA	NA	NA	NA	NA
WP_012458273.1|1606434_1608378_+	NAD(+) synthase	NA	NA	NA	NA	NA
WP_012457639.1|1608490_1609576_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	27.8	3.8e-19
>prophage 7
NC_010729	Porphyromonas gingivalis ATCC 33277, complete genome	2354886	2118543	2181370	2354886	tRNA,transposase	Ralstonia_phage(37.5%)	50	NA	NA
WP_012457330.1|2118543_2119629_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	27.8	3.8e-19
WP_012458602.1|2120465_2121305_-	DNA adenine methylase	NA	A0A1S5PRR3	Streptococcus_phage	46.2	9.0e-69
WP_012458603.1|2121868_2122921_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043876337.1|2123064_2123733_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021662106.1|2123711_2124803_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012458605.1|2125015_2126068_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012458606.1|2126434_2128441_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012458609.1|2129006_2129177_-	DUF1661 domain-containing protein	NA	NA	NA	NA	NA
WP_143733414.1|2129145_2129253_+	DUF1661 domain-containing protein	NA	NA	NA	NA	NA
WP_012457911.1|2129805_2130708_+|transposase	IS982-like element IS195 family transposase	transposase	NA	NA	NA	NA
WP_012457848.1|2131644_2132547_-|transposase	IS982-like element IS195 family transposase	transposase	NA	NA	NA	NA
WP_012457909.1|2133133_2134843_-	S41 family peptidase	NA	NA	NA	NA	NA
WP_102981814.1|2135116_2135470_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012457907.1|2135639_2137346_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	30.6	4.4e-46
WP_012457906.1|2137392_2139147_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	26.0	9.1e-31
WP_012457905.1|2139171_2140449_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043876362.1|2140452_2141217_-	outer membrane lipoprotein-sorting protein	NA	NA	NA	NA	NA
WP_012457904.1|2141321_2143727_-	MMPL family transporter	NA	NA	NA	NA	NA
WP_005874459.1|2143767_2144367_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_013815713.1|2145224_2145446_+	DUF1661 domain-containing protein	NA	NA	NA	NA	NA
WP_012457902.1|2145583_2146486_+|transposase	IS982-like element IS195 family transposase	transposase	NA	NA	NA	NA
WP_012458611.1|2146957_2147248_-	CRISPR-associated endonuclease Cas2	NA	NA	NA	NA	NA
WP_012458266.1|2148229_2149315_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	27.8	6.4e-19
WP_012458614.1|2151762_2152509_-	type III-B CRISPR module RAMP protein Cmr6	NA	NA	NA	NA	NA
WP_012458615.1|2152505_2152943_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012458616.1|2152939_2153641_-	type III-B CRISPR module RAMP protein Cmr4	NA	NA	NA	NA	NA
WP_012458617.1|2153654_2154836_-	type III-B CRISPR module-associated protein Cmr3	NA	NA	NA	NA	NA
WP_039416600.1|2154837_2156460_-	type III-B CRISPR-associated protein Cas10/Cmr2	NA	NA	NA	NA	NA
WP_012458620.1|2157682_2157919_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012458621.1|2157920_2159504_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012458622.1|2159809_2159983_-	DUF1661 domain-containing protein	NA	NA	NA	NA	NA
WP_130262605.1|2159951_2160044_+	DUF1661 domain-containing protein	NA	NA	NA	NA	NA
WP_012458623.1|2160243_2162121_+|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG	tRNA	NA	NA	NA	NA
WP_039417442.1|2162154_2163954_+	excinuclease ABC subunit UvrC	NA	NA	NA	NA	NA
WP_004583644.1|2163960_2164413_+|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
WP_012458625.1|2164417_2164768_+	nucleotide pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_039416603.1|2164754_2165624_+	deoxyribose-phosphate aldolase	NA	NA	NA	NA	NA
WP_012458627.1|2165664_2165826_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012458628.1|2165934_2166909_-	polyprenyl synthetase family protein	NA	NA	NA	NA	NA
WP_012458629.1|2166966_2167605_-	WbqC family protein	NA	NA	NA	NA	NA
WP_012458630.1|2167625_2168252_-	signal peptidase I	NA	NA	NA	NA	NA
WP_012458631.1|2168241_2169639_-	signal peptidase I	NA	NA	NA	NA	NA
WP_004583652.1|2169654_2170371_-	4-hydroxy-tetrahydrodipicolinate reductase	NA	NA	NA	NA	NA
WP_012458632.1|2170431_2171775_-	deoxyguanosinetriphosphate triphosphohydrolase family protein	NA	NA	NA	NA	NA
WP_012458633.1|2171918_2172911_-	putative sulfate exporter family transporter	NA	NA	NA	NA	NA
WP_012458635.1|2173419_2173779_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012458637.1|2174085_2176587_+	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	26.8	6.5e-06
WP_012458638.1|2177156_2177894_+	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_012458639.1|2177966_2179715_+	phospho-sugar mutase	NA	A0A1X9I671	Streptococcus_phage	42.3	1.6e-112
WP_012458641.1|2180320_2181370_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	27.6	1.4e-18
