The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_011837	Clostridium kluyveri NBRC 12016, complete genome	3896121	1803314	1839422	3896121	transposase,integrase	Leptospira_phage(28.57%)	23	1800085:1800105	1839901:1839921
1800085:1800105	attL	TTAGGGGTAATACCAGCAGCC	NA	NA	NA	NA
WP_148204824.1|1803314_1804268_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	31.0	1.8e-12
WP_012102112.1|1804948_1805422_+	arsenate reductase ArsC	NA	A0A2H4J8A6	uncultured_Caudovirales_phage	33.6	1.1e-18
WP_012102113.1|1805570_1806776_-	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	39.8	7.6e-61
WP_012102114.1|1807208_1808006_+	polysaccharide deacetylase	NA	NA	NA	NA	NA
WP_012102115.1|1808997_1809573_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012620502.1|1809609_1811103_+	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_012620503.1|1811551_1812004_+|transposase	transposase family protein	transposase	NA	NA	NA	NA
WP_148204833.1|1811996_1813295_+|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_012102119.1|1813511_1813685_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012102120.1|1813663_1814215_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148204824.1|1814425_1815379_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	31.0	1.8e-12
WP_012102121.1|1816154_1817537_-	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_012102122.1|1817970_1820133_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_012102123.1|1820129_1823159_-	polyketide synthase dehydratase domain-containing protein	NA	D0R7J2	Paenibacillus_phage	36.3	3.4e-41
WP_012102124.1|1823189_1824464_-	ACP S-malonyltransferase	NA	NA	NA	NA	NA
WP_012102125.1|1824549_1830555_-	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	29.8	5.0e-129
WP_012102126.1|1830568_1832629_-	non-ribosomal peptide synthetase	NA	A0A1V0SBX8	Catovirus	28.4	4.2e-19
WP_012102127.1|1832648_1833365_-	thioesterase	NA	NA	NA	NA	NA
WP_012102128.1|1834566_1835253_+	4'-phosphopantetheinyl transferase superfamily protein	NA	NA	NA	NA	NA
WP_155814021.1|1835593_1835737_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041700793.1|1836040_1836229_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172634753.1|1836355_1837477_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_012102131.1|1837469_1839422_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
1839901:1839921	attR	GGCTGCTGGTATTACCCCTAA	NA	NA	NA	NA
>prophage 2
NC_011837	Clostridium kluyveri NBRC 12016, complete genome	3896121	1932517	1988836	3896121	plate,tail,terminase,portal	Clostridium_phage(36.17%)	91	NA	NA
WP_012102222.1|1932517_1933357_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A249XXD2	Clostridium_phage	35.5	6.7e-24
WP_012102223.1|1933373_1933628_-	hemolysin XhlA family protein	NA	NA	NA	NA	NA
WP_172634754.1|1933644_1933815_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012102225.1|1934038_1934680_-	lactate utilization protein	NA	NA	NA	NA	NA
WP_012102226.1|1934831_1935275_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172634755.1|1935589_1935814_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012102228.1|1935975_1937319_-	radical SAM peptide maturase, CXXX-repeat target family	NA	A0A1L7N0Q5	Ralstonia_phage	23.4	2.8e-08
WP_012102229.1|1937311_1937689_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012102230.1|1937708_1938497_-|tail	phage tail protein	tail	A0A0A7RTP0	Clostridium_phage	72.3	1.2e-62
WP_012102231.1|1938500_1939133_-	DUF2313 domain-containing protein	NA	A0A2H4J1P4	uncultured_Caudovirales_phage	59.7	3.5e-65
WP_012102232.1|1939119_1940250_-|plate	baseplate J/gp47 family protein	plate	A0A2H4J7K8	uncultured_Caudovirales_phage	60.5	1.8e-117
WP_012102233.1|1940254_1940725_-	DUF2634 domain-containing protein	NA	A0A2H4J4Q8	uncultured_Caudovirales_phage	46.2	1.5e-33
WP_012102234.1|1940717_1941056_-	hypothetical protein	NA	A0A0A8WFG6	Clostridium_phage	52.3	5.1e-23
WP_012102235.1|1941030_1942017_-	hypothetical protein	NA	A0A2H4J063	uncultured_Caudovirales_phage	55.3	3.3e-94
WP_012102236.1|1942025_1942784_-	SH3 domain-containing protein	NA	A0A2H4J045	uncultured_Caudovirales_phage	55.7	8.4e-66
WP_041700796.1|1942864_1943089_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012102237.1|1943058_1943568_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012102238.1|1943574_1947315_-	transglycosylase SLT domain-containing protein	NA	D9ZNE6	Clostridium_phage	42.3	2.1e-40
WP_012102239.1|1947514_1948255_-	hypothetical protein	NA	A0A2H4JA91	uncultured_Caudovirales_phage	36.7	7.5e-11
WP_155814022.1|1948389_1948620_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012102241.1|1948620_1949046_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041700798.1|1949120_1949321_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041700800.1|1949323_1949503_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148204836.1|1949684_1950095_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041700801.1|1950202_1950394_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041700802.1|1950393_1951227_-	antirepressor	NA	X5JAW1	Clostridium_phage	51.5	6.6e-48
WP_041700803.1|1951356_1951551_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_012102326.1|1951715_1952501_+	helix-turn-helix transcriptional regulator	NA	I3VYY8	Thermoanaerobacterium_phage	47.7	1.8e-07
WP_012102247.1|1952839_1953553_-	Rha family transcriptional regulator	NA	Q332L4	Clostridium_botulinum_C_phage	38.3	2.8e-23
WP_012620535.1|1953750_1954590_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_012102328.1|1954877_1955333_-	hypothetical protein	NA	A0A2H4J883	uncultured_Caudovirales_phage	49.3	9.2e-28
WP_012102329.1|1955414_1955813_-	type II toxin-antitoxin system HicB family antitoxin	NA	A0A0A7S1E5	Clostridium_phage	52.3	4.1e-32
WP_012102330.1|1955858_1956041_-	type II toxin-antitoxin system HicA family toxin	NA	D6R431	Bacillus_phage	48.3	2.2e-09
WP_012102331.1|1956117_1956534_-|tail	phage tail tube protein	tail	A0A2H4J032	uncultured_Caudovirales_phage	72.9	8.4e-52
WP_012102332.1|1956552_1957971_-|tail	phage tail sheath subtilisin-like domain-containing protein	tail	A0A2H4J1N7	uncultured_Caudovirales_phage	53.4	8.4e-144
WP_012102254.1|1957972_1958407_-	hypothetical protein	NA	A0A2H4J7J8	uncultured_Caudovirales_phage	53.7	3.5e-08
WP_012102255.1|1958410_1959238_-	hypothetical protein	NA	A0A2H4J4Q0	uncultured_Caudovirales_phage	55.8	5.0e-80
WP_012102256.1|1959241_1959652_-	hypothetical protein	NA	A0A2H4J736	uncultured_Caudovirales_phage	51.9	7.8e-34
WP_012102257.1|1959651_1960035_-	hypothetical protein	NA	B6SBT3	Clostridium_virus	45.2	4.0e-24
WP_012102258.1|1960031_1960361_-	hypothetical protein	NA	B6SBT2	Clostridium_virus	48.2	3.1e-25
WP_012102259.1|1960406_1961441_-	hypothetical protein	NA	A0A0A8WEW9	Clostridium_phage	53.8	1.4e-103
WP_012102260.1|1961456_1961834_-	DUF2190 family protein	NA	A0A0N7ACR5	Bacillus_phage	48.7	3.2e-18
WP_012102335.1|1961854_1963330_-	hypothetical protein	NA	B6SBS9	Clostridium_virus	53.9	2.5e-114
WP_012102262.1|1963478_1963895_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012102263.1|1963956_1964181_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012102264.1|1964186_1965518_-	hypothetical protein	NA	A0A0A8WIZ2	Clostridium_phage	49.1	1.6e-91
WP_012102265.1|1965510_1967031_-|portal	phage portal protein	portal	A0A0A8WI73	Clostridium_phage	69.4	4.3e-202
WP_012102266.1|1967021_1968293_-|terminase	PBSX family phage terminase large subunit	terminase	E5DV50	Deep-sea_thermophilic_phage	39.7	1.5e-75
WP_012102268.1|1968282_1969065_-	hypothetical protein	NA	A0A2H4J4R0	uncultured_Caudovirales_phage	46.8	1.4e-39
WP_012102269.1|1969143_1971126_-	NACHT domain-containing protein	NA	X5JAK5	Clostridium_phage	46.8	4.0e-152
WP_172634756.1|1971243_1971471_+	DUF2188 domain-containing protein	NA	E8ZD70	Streptococcus_phage	69.3	3.0e-19
WP_172634757.1|1971467_1971623_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172634758.1|1971630_1971792_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012102271.1|1972037_1972328_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012102272.1|1972723_1973008_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012102273.1|1973126_1973483_-	transcriptional regulator	NA	M9Q1J7	Clostridium_phage	43.8	3.5e-22
WP_012102274.1|1973703_1974159_-	hypothetical protein	NA	A0A0A7RVS1	Clostridium_phage	39.3	1.1e-25
WP_012102275.1|1974207_1974822_-	hypothetical protein	NA	A0A2K9VCQ2	Lactobacillus_phage	28.1	1.5e-12
WP_012102276.1|1974846_1975047_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155814023.1|1975069_1975231_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012102277.1|1975254_1975632_-	DnaJ domain-containing protein	NA	NA	NA	NA	NA
WP_012102278.1|1975632_1975950_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012102279.1|1976113_1976425_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012102280.1|1976433_1976754_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155814024.1|1976759_1976903_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012102281.1|1977061_1977544_-	hypothetical protein	NA	A0A0A7RW43	Clostridium_phage	62.1	2.8e-51
WP_012102282.1|1977536_1977953_-	DUF1064 domain-containing protein	NA	A0A0A7RTV9	Clostridium_phage	60.6	6.2e-39
WP_012103625.1|1977957_1978140_-	hypothetical protein	NA	A0A0A7S0P6	Clostridium_phage	50.0	8.5e-09
WP_012102283.1|1978136_1978865_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172634759.1|1979348_1979762_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012102286.1|1979767_1980595_-	DNA adenine methylase	NA	U5P0W8	Brevibacillus_phage	38.0	2.0e-41
WP_012102287.1|1980660_1980828_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012102288.1|1980831_1982175_-	replicative DNA helicase	NA	A0A1P8VVQ6	Streptococcus_phage	41.2	1.6e-80
WP_012102289.1|1982178_1983117_-	phage replisome organizer N-terminal domain-containing protein	NA	V9QKF6	Oenococcus_phage	54.2	3.3e-35
WP_012102290.1|1983157_1983952_-	PD-(D/E)XK nuclease-like domain-containing protein	NA	A0A290GJV0	Caldibacillus_phage	45.8	5.7e-57
WP_012102291.1|1983951_1984845_-	recombinase RecT	NA	A0A0A7RW37	Clostridium_phage	52.4	4.4e-66
WP_012102292.1|1984847_1985024_-	hypothetical protein	NA	A0A0A7RWI6	Clostridium_phage	58.2	6.1e-12
WP_012102293.1|1985026_1985266_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012102294.1|1985456_1985693_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012102337.1|1985696_1985837_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012102295.1|1985838_1986240_-	hypothetical protein	NA	B5SP14	Lactococcus_phage	44.3	5.7e-13
WP_155814025.1|1986252_1986402_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012102296.1|1986415_1986580_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012102338.1|1986542_1986728_-	aspartyl-phosphate phosphatase Spo0E family protein	NA	NA	NA	NA	NA
WP_012102297.1|1986724_1986976_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012102298.1|1987003_1987426_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012102339.1|1987432_1987585_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012102340.1|1987585_1987798_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012102341.1|1987794_1987965_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012102342.1|1987976_1988492_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_012102344.1|1988593_1988836_-	helix-turn-helix transcriptional regulator	NA	I3PGW3	Xanthomonas_phage	46.6	5.8e-05
>prophage 3
NC_011837	Clostridium kluyveri NBRC 12016, complete genome	3896121	2603262	2679121	3896121	tail,protease,capsid,integrase,head,portal,terminase,transposase,holin	Erysipelothrix_phage(62.96%)	79	2597746:2597761	2676799:2676814
2597746:2597761	attL	TTATATCTATTTACAT	NA	NA	NA	NA
WP_012102936.1|2603262_2604189_+|integrase	site-specific integrase	integrase	A8ATM2	Listeria_phage	49.4	4.6e-82
WP_012102937.1|2604185_2605334_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_012102938.1|2605408_2608618_-	type I restriction endonuclease subunit R	NA	NA	NA	NA	NA
WP_012620725.1|2608614_2609190_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_012102940.1|2609350_2609665_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012102941.1|2609678_2610437_-	N-acyl homoserine lactonase family protein	NA	NA	NA	NA	NA
WP_012102942.1|2610725_2611343_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_155814033.1|2611476_2611629_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012102944.1|2611733_2611997_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012620727.1|2612103_2612427_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012102946.1|2612407_2613301_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_012102949.1|2614477_2614981_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_148204850.1|2614993_2615590_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012102951.1|2615612_2616317_-	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_012102952.1|2616479_2617061_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_049759124.1|2617057_2617774_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.4	1.8e-33
WP_012102955.1|2617822_2618812_-	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_012102957.1|2618798_2619485_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	33.6	9.7e-29
WP_012102958.1|2619743_2620562_-	aminoglycoside nucleotidyltransferase ANT(9)	NA	NA	NA	NA	NA
WP_012620729.1|2620634_2621855_-	GNAT family N-acetyltransferase	NA	A0A2K5B2B6	Erysipelothrix_phage	30.4	8.6e-12
WP_012102960.1|2621895_2622636_-	class I SAM-dependent methyltransferase	NA	A0A1X9I6N4	Streptococcus_phage	90.9	4.0e-129
WP_012102961.1|2622616_2623486_-	nucleotidyltransferase domain-containing protein	NA	A0A1X9I6C9	Streptococcus_phage	90.7	5.1e-152
WP_012102962.1|2623717_2625181_-	Msr family ABC-F type ribosomal protection protein	NA	A0A1B0RXA0	Streptococcus_phage	89.9	4.9e-240
WP_012102963.1|2625294_2626521_-	macrolide efflux MFS transporter Mef(A)	NA	A0A1B0RXG2	Streptococcus_phage	95.3	1.9e-208
WP_012102964.1|2626951_2628523_-	recombinase family protein	NA	A0A2K5B2B4	Erysipelothrix_phage	60.3	1.1e-173
WP_012102965.1|2628526_2628940_-	recombinase	NA	NA	NA	NA	NA
WP_041700825.1|2628940_2630503_-	recombinase family protein	NA	A0A2K5B2B2	Erysipelothrix_phage	53.8	8.1e-156
WP_049759170.1|2630564_2630768_-	hypothetical protein	NA	A0A2K5B2B1	Erysipelothrix_phage	50.0	2.6e-06
WP_012102968.1|2630997_2631699_-	N-acetylmuramoyl-L-alanine amidase	NA	H7BVK7	unidentified_phage	44.3	3.5e-50
WP_012102969.1|2631716_2633111_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012102970.1|2633107_2633548_-|holin	phage holin family protein	holin	A0A2K5B2A2	Erysipelothrix_phage	64.5	5.0e-47
WP_012102971.1|2633632_2636104_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012102972.1|2636115_2636619_-	hypothetical protein	NA	A0A0C5ABC3	Paenibacillus_phage	42.7	1.3e-22
WP_012102973.1|2636636_2638553_-	siphovirus ReqiPepy6 Gp37-like family protein	NA	A0A0K2CZQ1	Paenibacillus_phage	33.0	4.2e-45
WP_012102974.1|2638555_2639407_-|tail	phage tail family protein	tail	E2ELJ6	Clostridium_phage	35.3	3.0e-40
WP_012102975.1|2639420_2641841_-	hypothetical protein	NA	A0A2K5B297	Erysipelothrix_phage	47.5	6.0e-25
WP_012620734.1|2642025_2642460_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012102977.1|2642764_2643151_-	hypothetical protein	NA	A0A2K5B295	Erysipelothrix_phage	75.0	1.7e-43
WP_012102978.1|2643162_2643753_-|tail	phage tail protein	tail	A0A2K5B294	Erysipelothrix_phage	73.1	2.4e-76
WP_012102979.1|2643756_2644098_-	hypothetical protein	NA	A0A2K5B293	Erysipelothrix_phage	54.1	6.3e-29
WP_012102980.1|2644094_2644526_-	HK97 gp10 family phage protein	NA	A0A2K5B292	Erysipelothrix_phage	61.5	6.7e-44
WP_012102981.1|2644531_2644867_-|head,tail	head-tail adaptor protein	head,tail	A0A2K5B291	Erysipelothrix_phage	54.5	1.5e-27
WP_012102982.1|2644870_2645188_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2K5B290	Erysipelothrix_phage	80.0	1.4e-38
WP_012102983.1|2645207_2645588_-	hypothetical protein	NA	A0A2K5B289	Erysipelothrix_phage	43.5	1.4e-13
WP_012102984.1|2645600_2646806_-|capsid	phage major capsid protein	capsid	A0A2I4R671	Erysipelothrix_phage	82.8	7.3e-189
WP_012102985.1|2646825_2647515_-|protease	Clp protease ClpP	protease	A0A2K5B288	Erysipelothrix_phage	64.7	1.5e-74
WP_012102986.1|2647515_2648760_-|portal	phage portal protein	portal	A0A2K5B287	Erysipelothrix_phage	73.1	7.1e-179
WP_041700827.1|2648810_2650415_-|terminase	terminase large subunit	terminase	A0A2K5B285	Erysipelothrix_phage	84.1	9.5e-269
WP_012102988.1|2650503_2650692_-	DUF5049 domain-containing protein	NA	NA	NA	NA	NA
WP_012102989.1|2650684_2651143_-	gamma-glutamylcyclotransferase	NA	G3MAQ5	Bacillus_virus	34.3	8.2e-16
WP_012102990.1|2651181_2652081_-	amidoligase family protein	NA	A0A2K9V489	Faecalibacterium_phage	41.5	3.7e-52
WP_012102991.1|2652216_2652444_-	DUF4314 domain-containing protein	NA	E4ZFL7	Streptococcus_phage	41.2	1.8e-08
WP_012102992.1|2652443_2653232_-	hypothetical protein	NA	A0A2K5B280	Erysipelothrix_phage	44.9	2.2e-48
WP_012102993.1|2653333_2654575_-	DNA modification methylase	NA	A0A2I4R670	Erysipelothrix_phage	76.3	5.7e-189
WP_148204851.1|2654555_2655731_-	methionine adenosyltransferase	NA	A0A2K5B278	Erysipelothrix_phage	76.8	5.3e-176
WP_012102995.1|2655751_2656303_-|terminase	terminase	terminase	A0A2K5B277	Erysipelothrix_phage	77.0	8.2e-79
WP_012102996.1|2656413_2656773_-	HNH endonuclease	NA	A0A2K5B276	Erysipelothrix_phage	65.3	6.8e-42
WP_041700829.1|2657056_2657248_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_012102997.1|2657240_2657816_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	43.5	1.5e-14
WP_012102998.1|2657991_2658405_-	DUF1492 domain-containing protein	NA	A0A2K5B275	Erysipelothrix_phage	30.9	3.8e-12
WP_000338537.1|2658401_2658620_-	hypothetical protein	NA	A0A2K5B274	Erysipelothrix_phage	57.1	1.6e-14
WP_081427985.1|2658619_2660008_-	DEAD/DEAH box helicase	NA	A0A2K5B273	Erysipelothrix_phage	79.1	7.9e-187
WP_012103000.1|2659961_2660243_-	VRR-NUC domain-containing protein	NA	A0A2K5B272	Erysipelothrix_phage	67.8	1.8e-26
WP_012103001.1|2660461_2662828_-	hypothetical protein	NA	A0A1W6JQ82	Corynebacterium_phage	52.2	1.8e-244
WP_012103002.1|2662824_2663259_-	hypothetical protein	NA	A0A2K5B270	Erysipelothrix_phage	70.1	5.3e-57
WP_012103003.1|2663258_2664011_-	phage antirepressor Ant	NA	A0A2H4IZX7	uncultured_Caudovirales_phage	47.8	5.2e-60
WP_012103004.1|2664104_2666039_-	DNA polymerase	NA	A0A2K5B2B0	Erysipelothrix_phage	74.1	5.1e-293
WP_012103005.1|2666117_2666666_-	DUF2815 family protein	NA	A0A2K5B2A9	Erysipelothrix_phage	89.0	3.5e-90
WP_012103006.1|2666670_2667807_-	DUF2800 domain-containing protein	NA	A0A2K5B2A8	Erysipelothrix_phage	81.2	2.1e-182
WP_012103007.1|2667799_2668123_-	hypothetical protein	NA	A0A2K5B2A7	Erysipelothrix_phage	62.4	2.2e-23
WP_012103009.1|2668362_2669028_-	hypothetical protein	NA	A0A2K5B267	Erysipelothrix_phage	33.0	1.6e-15
WP_012103011.1|2669368_2671237_-	helix-turn-helix transcriptional regulator	NA	E4ZFJ9	Streptococcus_phage	29.7	8.9e-77
WP_012103012.1|2671438_2671642_+	helix-turn-helix transcriptional regulator	NA	A0A2K5B261	Erysipelothrix_phage	75.4	3.7e-21
WP_012103013.1|2671698_2672898_+	MspI family type II restriction endonuclease	NA	NA	NA	NA	NA
WP_012103015.1|2672952_2674203_-	DNA cytosine methyltransferase	NA	Q6DMX0	Streptococcus_phage	46.0	2.8e-66
WP_012103016.1|2674610_2675972_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	32.6	1.0e-58
WP_012103017.1|2676002_2676731_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012103018.1|2676985_2678119_+	sulfatase-like hydrolase/transferase	NA	NA	NA	NA	NA
2676799:2676814	attR	ATGTAAATAGATATAA	NA	NA	NA	NA
WP_148204824.1|2678167_2679121_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	31.0	1.8e-12
>prophage 4
NC_011837	Clostridium kluyveri NBRC 12016, complete genome	3896121	2683522	2695592	3896121		Synechococcus_phage(25.0%)	12	NA	NA
WP_012103024.1|2683522_2684539_-	phosphodiester glycosidase family protein	NA	A0A291LB83	Escherichia_phage	29.9	1.4e-15
WP_012103025.1|2684723_2685965_-	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_012103026.1|2686013_2687513_-	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	43.6	3.5e-63
WP_012103027.1|2687532_2688147_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	38.0	9.9e-25
WP_012103028.1|2688134_2689130_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A1D7SCX2	Cyanophage	45.1	9.9e-67
WP_012103029.1|2689143_2690595_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	34.4	8.0e-57
WP_012103030.1|2690635_2691343_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3F9V5	Synechococcus_phage	45.4	2.0e-45
WP_012103031.1|2691345_2691825_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	47.4	8.8e-29
WP_012103032.1|2692307_2692895_+	hydrolase	NA	NA	NA	NA	NA
WP_012103033.1|2693130_2693322_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012103034.1|2693375_2693966_-	YdcF family protein	NA	NA	NA	NA	NA
WP_012103035.1|2694185_2695592_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	32.1	1.4e-53
>prophage 5
NC_011837	Clostridium kluyveri NBRC 12016, complete genome	3896121	2860415	2897701	3896121	terminase,transposase,integrase	Clostridium_phage(30.0%)	38	2884495:2884512	2899248:2899265
WP_012103199.1|2860415_2860919_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_012103200.1|2860927_2861197_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_012103201.1|2861627_2862470_-	recombinase family protein	NA	NA	NA	NA	NA
WP_012103202.1|2862494_2863139_-	recombinase family protein	NA	M9Q2G2	Clostridium_phage	42.9	1.6e-33
WP_012103203.1|2863227_2863413_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012103205.1|2864525_2864915_-	cysteine-rich VLP protein	NA	NA	NA	NA	NA
WP_155814035.1|2865944_2866085_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012103208.1|2866170_2866455_+	50S ribosomal protein L7/L12	NA	NA	NA	NA	NA
WP_081427989.1|2866850_2867231_+|transposase	IS200/IS605 family transposase	transposase	A0A1P8BMC0	Lactococcus_phage	35.4	9.5e-10
WP_012103212.1|2868372_2869017_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_172634767.1|2869269_2870235_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012103214.1|2870389_2870941_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012103215.1|2871228_2871450_-	helix-turn-helix transcriptional regulator	NA	A0A2K9V490	Faecalibacterium_phage	40.3	2.2e-06
WP_012103216.1|2871579_2871786_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012103218.1|2873536_2875015_-	cell wall-binding repeat-containing protein	NA	A0A0A8WJG0	Clostridium_phage	30.8	3.2e-21
WP_012103219.1|2875648_2876572_+	LD-carboxypeptidase	NA	NA	NA	NA	NA
WP_012103221.1|2877288_2877477_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012103222.1|2877696_2877894_-	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	70.5	2.9e-18
WP_012103223.1|2878293_2878722_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_012103224.1|2878796_2880662_+	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_012103227.1|2882671_2883214_-	flavodoxin family protein	NA	NA	NA	NA	NA
WP_012103229.1|2883501_2883678_-	hypothetical protein	NA	NA	NA	NA	NA
2884495:2884512	attL	TTATAAACTATTTATTTA	NA	NA	NA	NA
WP_012620802.1|2884866_2885067_-	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	72.3	1.6e-13
WP_012103230.1|2885176_2885533_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012103231.1|2885711_2886104_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081427991.1|2886545_2886650_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_012103232.1|2886726_2887107_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_012103235.1|2889304_2889487_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012103236.1|2889653_2889827_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012103237.1|2889844_2890018_-	aspartyl-phosphate phosphatase Spo0E family protein	NA	NA	NA	NA	NA
WP_012103238.1|2890744_2891014_-	ribosomal protein L7/L12	NA	NA	NA	NA	NA
WP_012103239.1|2891387_2891957_-|terminase	terminase small subunit	terminase	E5DV49	Deep-sea_thermophilic_phage	56.4	1.2e-43
WP_012103240.1|2892104_2892266_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012103241.1|2892270_2892432_-	hypothetical protein	NA	A0A0A7RUG6	Clostridium_phage	53.1	5.0e-05
WP_012103243.1|2893497_2894058_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012103244.1|2894653_2895586_-	class A beta-lactamase	NA	A0A1B0VBP7	Salmonella_phage	42.7	4.2e-51
WP_012620804.1|2896999_2897185_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081427992.1|2897320_2897701_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2R2ZGM9	Clostridioides_phage	31.4	5.6e-10
2899248:2899265	attR	TTATAAACTATTTATTTA	NA	NA	NA	NA
>prophage 6
NC_011837	Clostridium kluyveri NBRC 12016, complete genome	3896121	2914184	2956497	3896121	terminase,capsid,transposase,integrase	Bacillus_phage(25.0%)	49	2914004:2914049	2950160:2950205
2914004:2914049	attL	CTCCAAAACCGTTGGTTGTGGGTTCGATTCCTACTGCCCCTGCCAA	NA	NA	NA	NA
WP_012103265.1|2914184_2915363_-|integrase	site-specific integrase	integrase	A0A1B0T6A8	Bacillus_phage	31.4	5.0e-41
WP_012103266.1|2915441_2915645_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_012103267.1|2915853_2917272_-	hypothetical protein	NA	Q8W5V7	Listeria_phage	30.2	2.9e-27
WP_012103268.1|2917466_2918921_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012103269.1|2919920_2920649_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012103270.1|2921008_2921608_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012103271.1|2921762_2922092_+	helix-turn-helix transcriptional regulator	NA	A0A0A7AR52	Bacillus_phage	27.6	1.6e-05
WP_041700837.1|2922103_2922295_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012103273.1|2922351_2923203_-	hypothetical protein	NA	E5DV80	Deep-sea_thermophilic_phage	41.4	1.2e-25
WP_148204891.1|2923297_2924251_-	YqaJ viral recombinase family protein	NA	A0A139ZPJ9	Marinitoga_camini_virus	42.9	4.6e-69
WP_012103276.1|2924298_2925234_-	DUF945 domain-containing protein	NA	A0A1B1INH0	uncultured_Mediterranean_phage	29.2	4.1e-30
WP_012103277.1|2925438_2927061_+	cell wall-binding repeat-containing protein	NA	NA	NA	NA	NA
WP_012103278.1|2927143_2927998_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_012103280.1|2928175_2928613_+	type I restriction enzyme HsdR N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_148204824.1|2928983_2929937_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	31.0	1.8e-12
WP_012103281.1|2930106_2931942_+	SAM-dependent DNA methyltransferase	NA	NA	NA	NA	NA
WP_012103282.1|2931938_2933369_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_012103283.1|2933587_2933803_+	DUF3791 domain-containing protein	NA	NA	NA	NA	NA
WP_012103284.1|2933799_2934279_+	DUF3990 domain-containing protein	NA	NA	NA	NA	NA
WP_012103285.1|2934282_2934534_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012103286.1|2934880_2936131_-|integrase	site-specific integrase	integrase	A0A2I7SC08	Paenibacillus_phage	34.9	1.9e-59
WP_012103287.1|2936186_2936765_-	Uma2 family endonuclease	NA	NA	NA	NA	NA
WP_012103288.1|2936796_2937285_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_012103289.1|2937427_2937820_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_012103290.1|2937812_2938043_+	excisionase family DNA-binding protein	NA	NA	NA	NA	NA
WP_012103291.1|2938068_2940375_+	hypothetical protein	NA	A0A1B2AQ05	Phage_Wrath	32.0	1.6e-99
WP_012103292.1|2940824_2941274_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012103293.1|2941382_2941604_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012103294.1|2941527_2941863_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012103296.1|2941881_2942217_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012103297.1|2942209_2942362_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012103298.1|2942440_2942647_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012103299.1|2942808_2943039_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_012103300.1|2943144_2943456_+	histidine kinase	NA	NA	NA	NA	NA
WP_012103301.1|2943648_2943849_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012103302.1|2943854_2944376_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012103303.1|2944494_2944848_+|terminase	P27 family phage terminase small subunit	terminase	A0A0S2SXN4	Bacillus_phage	36.1	2.6e-09
WP_012103304.1|2944859_2945105_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012103305.1|2945163_2946444_+|capsid	phage major capsid protein	capsid	A0A0U4IB53	Exiguobacterium_phage	56.1	3.7e-90
WP_012103306.1|2946509_2947217_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_172634769.1|2947421_2947616_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148204856.1|2947792_2949574_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012103308.1|2950311_2950449_-	hypothetical protein	NA	NA	NA	NA	NA
2950160:2950205	attR	CTCCAAAACCGTTGGTTGTGGGTTCGATTCCTACTGCCCCTGCCAA	NA	NA	NA	NA
WP_148204857.1|2950587_2950713_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012103309.1|2951342_2951510_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012103310.1|2951595_2951793_-	cold-shock protein	NA	A0A1X9IGI9	Lactococcus_phage	70.0	4.9e-18
WP_012103311.1|2952068_2953241_+	iron-containing alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_012103312.1|2953964_2954264_+	YjgB family protein	NA	NA	NA	NA	NA
WP_012103314.1|2955318_2956497_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
>prophage 7
NC_011837	Clostridium kluyveri NBRC 12016, complete genome	3896121	3021807	3027541	3896121		Bacillus_phage(66.67%)	6	NA	NA
WP_012103385.1|3021807_3022485_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.4	1.2e-36
WP_012103386.1|3022580_3023609_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	26.0	1.0e-21
WP_012103387.1|3023598_3024288_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	32.7	1.6e-26
WP_012103388.1|3024310_3025723_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	27.7	5.6e-23
WP_012103389.1|3025749_3026469_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	35.1	5.4e-38
WP_012103390.1|3026629_3027541_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	45.9	4.4e-45
>prophage 8
NC_011837	Clostridium kluyveri NBRC 12016, complete genome	3896121	3081152	3128467	3896121	tRNA,transposase,integrase	Tupanvirus(20.0%)	39	3075923:3075939	3103297:3103313
3075923:3075939	attL	TTCTCTTCTATAATTTT	NA	NA	NA	NA
WP_012103438.1|3081152_3083018_+|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
WP_012103439.1|3083043_3083907_+|integrase	tyrosine-type recombinase/integrase	integrase	S5M9V8	Brevibacillus_phage	25.4	6.5e-14
WP_012103440.1|3083930_3084674_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012620857.1|3084834_3088011_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172634772.1|3088124_3088259_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081427997.1|3088282_3088501_-|transposase	transposase	transposase	S5VTP8	Leptospira_phage	60.0	4.0e-13
WP_081427998.1|3088497_3088836_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_012103443.1|3088784_3089177_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_012103445.1|3089540_3090134_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012103446.1|3090529_3090823_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012103448.1|3091149_3094944_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012103449.1|3094981_3095389_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012103450.1|3095449_3099391_-	cell wall-binding repeat-containing protein	NA	NA	NA	NA	NA
WP_012103451.1|3099959_3101009_-	cell wall-binding repeat-containing protein	NA	NA	NA	NA	NA
WP_012103452.1|3101207_3101648_+	cell wall hydrolase	NA	NA	NA	NA	NA
WP_012103453.1|3101721_3102141_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012103454.1|3102214_3103114_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	32.7	4.7e-31
WP_012103455.1|3103193_3104159_-	HAMP domain-containing histidine kinase	NA	A0A2K9L0Z8	Tupanvirus	30.6	2.8e-21
3103297:3103313	attR	TTCTCTTCTATAATTTT	NA	NA	NA	NA
WP_172634773.1|3104839_3105019_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012103458.1|3105765_3106239_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012103459.1|3106225_3106882_+	accessory gene regulator B family protein	NA	NA	NA	NA	NA
WP_081427999.1|3106887_3107022_+	cyclic lactone autoinducer peptide	NA	NA	NA	NA	NA
WP_012103460.1|3107129_3108983_+	PAS domain S-box protein	NA	NA	NA	NA	NA
WP_012103461.1|3109025_3110738_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	39.8	1.0e-10
WP_012103462.1|3110988_3112365_-	4-aminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	26.3	6.9e-26
WP_012103463.1|3112511_3113744_-	PucR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012103464.1|3114033_3114588_-	protein kinase	NA	NA	NA	NA	NA
WP_012103465.1|3114844_3115405_-	MEDS domain-containing protein	NA	NA	NA	NA	NA
WP_012103466.1|3115615_3116263_-	hemolysin III family protein	NA	NA	NA	NA	NA
WP_012103467.1|3116469_3117141_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012103468.1|3117158_3118115_-	EamA family transporter	NA	NA	NA	NA	NA
WP_012103469.1|3118476_3120249_-|tRNA	aspartate--tRNA ligase	tRNA	A0A2K9L424	Tupanvirus	28.5	3.0e-21
WP_012103470.1|3120335_3121586_-|tRNA	histidine--tRNA ligase	tRNA	A0A2I2L577	Orpheovirus	29.8	1.6e-34
WP_012103471.1|3121622_3123071_-	coproporphyrinogen III oxidase	NA	NA	NA	NA	NA
WP_012103472.1|3123113_3123713_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_012103473.1|3123794_3124244_-|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
WP_012103474.1|3124318_3126499_-	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	A0A1B1IUF0	uncultured_Mediterranean_phage	34.2	6.9e-12
WP_012103475.1|3126598_3127117_-	adenine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_012103476.1|3127303_3128467_-|transposase	transposase	transposase	Q332B3	Clostridium_botulinum_C_phage	47.7	3.5e-87
>prophage 9
NC_011837	Clostridium kluyveri NBRC 12016, complete genome	3896121	3219856	3289288	3896121	tail,plate,capsid,portal,tRNA,terminase,holin	uncultured_Caudovirales_phage(33.33%)	92	NA	NA
WP_012103559.1|3219856_3222505_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	44.7	7.7e-183
WP_012103560.1|3222831_3223614_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_155814039.1|3223660_3223804_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012103561.1|3224109_3224307_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_012103562.1|3224517_3224874_+	helix-turn-helix transcriptional regulator	NA	A0A0A8WF84	Clostridium_phage	34.0	7.8e-06
WP_012103563.1|3224928_3225081_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012103564.1|3225102_3225498_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012103565.1|3225670_3225841_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012103566.1|3226561_3227746_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012102314.1|3228290_3228875_-	DUF2335 domain-containing protein	NA	NA	NA	NA	NA
WP_012103567.1|3228829_3229036_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012103568.1|3229138_3229558_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012103569.1|3229578_3229953_-	hypothetical protein	NA	A0A2H4J4N9	uncultured_Caudovirales_phage	69.1	4.0e-37
WP_012102220.1|3230069_3230303_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012103570.1|3230425_3232078_-	DUF4368 domain-containing protein	NA	A0A0A7RTP8	Clostridium_phage	24.9	8.3e-18
WP_012103571.1|3232135_3232339_-	transposon-encoded TnpW family protein	NA	NA	NA	NA	NA
WP_012103572.1|3232414_3233314_-|capsid	phage major capsid protein	capsid	A0A2I4R671	Erysipelothrix_phage	44.7	2.7e-71
WP_012103574.1|3233587_3235897_-	nucleoside triphosphatase	NA	A0A2H4J4H0	uncultured_Caudovirales_phage	33.0	1.4e-111
WP_012103576.1|3236537_3236777_+	helix-turn-helix transcriptional regulator	NA	A0A2K5B263	Erysipelothrix_phage	58.8	1.5e-16
WP_012103577.1|3236769_3238740_+	site-specific DNA-methyltransferase	NA	Q1MVP0	Enterobacteria_phage	35.3	5.5e-101
WP_012103578.1|3238754_3241715_+	type III restriction-modification system endonuclease	NA	Q71TG1	Escherichia_phage	34.7	8.4e-138
WP_012103579.1|3241737_3243357_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_012103580.1|3243481_3243733_-	hypothetical protein	NA	R4JMM4	Bacillus_phage	53.3	1.3e-18
WP_012103581.1|3243818_3244739_-	glycoside hydrolase family 25 protein	NA	D9ZNF3	Clostridium_phage	52.3	7.5e-61
WP_011930397.1|3244751_3245144_-|holin	phage holin family protein	holin	D9ZNF2	Clostridium_phage	62.5	1.5e-42
WP_081428000.1|3245400_3245541_-	XkdX family protein	NA	NA	NA	NA	NA
WP_012103582.1|3245556_3245901_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012103583.1|3245916_3247602_-	hypothetical protein	NA	S6B1J7	Thermus_phage	31.8	1.0e-23
WP_012103584.1|3247613_3248234_-	YmfQ family protein	NA	A0A0A7RTU9	Clostridium_phage	61.2	3.1e-74
WP_012103585.1|3248237_3249878_-	hypothetical protein	NA	A0A0A7S1G0	Clostridium_phage	50.8	6.0e-101
WP_012103586.1|3249881_3251009_-|plate	baseplate J/gp47 family protein	plate	A0A2H4J7K8	uncultured_Caudovirales_phage	44.1	9.8e-71
WP_012103587.1|3251013_3251472_-	DUF2634 domain-containing protein	NA	A0A2H4J4Q8	uncultured_Caudovirales_phage	52.6	1.2e-38
WP_012103588.1|3251472_3251802_-	hypothetical protein	NA	A0A2H4J746	uncultured_Caudovirales_phage	48.1	2.3e-20
WP_012103589.1|3251776_3252763_-	hypothetical protein	NA	A0A2H4J063	uncultured_Caudovirales_phage	55.9	4.5e-96
WP_012103590.1|3252773_3253529_-	SH3 domain-containing protein	NA	A0A2H4J045	uncultured_Caudovirales_phage	55.5	2.6e-67
WP_041700796.1|3253610_3253835_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012103591.1|3253804_3254323_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012103592.1|3254329_3258157_-|tail	phage tail tape measure protein	tail	A0A2H4J055	uncultured_Caudovirales_phage	40.9	2.0e-107
WP_155814040.1|3258163_3258331_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012103593.1|3258333_3258771_-	hypothetical protein	NA	A0A2H4J883	uncultured_Caudovirales_phage	58.7	1.0e-36
WP_012103594.1|3258929_3259109_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012103595.1|3259108_3259915_-	ORF6N domain-containing protein	NA	A0A288WG93	Bacillus_phage	51.0	1.2e-33
WP_012103597.1|3260491_3261328_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012103598.1|3261402_3261813_-|tail	phage tail tube protein	tail	A0A2H4J032	uncultured_Caudovirales_phage	65.7	3.6e-47
WP_012103599.1|3261823_3263251_-|tail	phage tail sheath subtilisin-like domain-containing protein	tail	A0A2H4J1N7	uncultured_Caudovirales_phage	57.3	2.6e-153
WP_012103600.1|3263252_3263564_-	hypothetical protein	NA	A0A0A8WEX5	Clostridium_phage	48.4	6.6e-09
WP_012103601.1|3263590_3264406_-	hypothetical protein	NA	A0A2H4J4Q0	uncultured_Caudovirales_phage	62.5	4.1e-95
WP_012103602.1|3264390_3264633_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012103603.1|3264653_3265079_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012103604.1|3265092_3265485_-	hypothetical protein	NA	A0A2H4J057	uncultured_Caudovirales_phage	46.9	7.2e-21
WP_012103605.1|3265484_3265805_-	hypothetical protein	NA	A0A2H4J040	uncultured_Caudovirales_phage	51.5	9.1e-22
WP_012103606.1|3265807_3266041_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012103607.1|3266100_3267150_-|capsid	major capsid protein	capsid	D9ZND6	Clostridium_phage	51.4	1.1e-87
WP_012103608.1|3267167_3267560_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012103609.1|3267582_3268188_-	phage scaffolding protein	NA	A0A0A7RW68	Clostridium_phage	39.3	5.9e-30
WP_012103610.1|3268237_3268417_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012103611.1|3268475_3268742_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012103612.1|3268751_3269168_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012103613.1|3269244_3269454_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012103614.1|3269518_3269821_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012103615.1|3269810_3271226_-	hypothetical protein	NA	A0A2H4J048	uncultured_Caudovirales_phage	40.7	3.6e-62
WP_012103616.1|3271228_3272752_-|portal	phage portal protein	portal	D9ZNC8	Clostridium_phage	54.7	1.4e-144
WP_012103617.1|3272751_3274104_-|terminase	PBSX family phage terminase large subunit	terminase	A0A2P1JTW5	Anoxybacillus_phage	70.0	1.8e-159
WP_012103618.1|3274103_3274958_-	DUF1804 family protein	NA	Q5YA77	Bacillus_phage	42.6	1.9e-50
WP_172634774.1|3275332_3275494_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012103621.1|3275614_3275806_+	type II toxin-antitoxin system HicA family toxin	NA	A0A1L2JY37	Aeribacillus_phage	51.6	1.2e-10
WP_012103622.1|3275860_3276265_+	type II toxin-antitoxin system HicB family antitoxin	NA	A0A090DBV2	Clostridium_phage	54.9	5.1e-38
WP_012103623.1|3276942_3277227_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012102273.1|3277345_3277702_-	transcriptional regulator	NA	M9Q1J7	Clostridium_phage	43.8	3.5e-22
WP_012103624.1|3277922_3278378_-	hypothetical protein	NA	A0A0A7RVS1	Clostridium_phage	39.3	6.6e-26
WP_012103625.1|3278478_3278661_-	hypothetical protein	NA	A0A0A7S0P6	Clostridium_phage	50.0	8.5e-09
WP_012103626.1|3278657_3279137_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012103627.1|3279405_3279624_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012103628.1|3279620_3280529_-	DNA (cytosine-5-)-methyltransferase	NA	A0A0F7L3U1	uncultured_marine_virus	34.4	2.3e-41
WP_012103630.1|3280900_3281734_-	DNA adenine methylase	NA	U5P0W8	Brevibacillus_phage	35.7	1.0e-40
WP_172634775.1|3281799_3281967_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012102288.1|3281970_3283314_-	replicative DNA helicase	NA	A0A1P8VVQ6	Streptococcus_phage	41.2	1.6e-80
WP_012103631.1|3283317_3284256_-	phage replisome organizer N-terminal domain-containing protein	NA	V9QKF6	Oenococcus_phage	56.7	6.6e-36
WP_012103632.1|3284371_3285244_-	hypothetical protein	NA	E5DV80	Deep-sea_thermophilic_phage	50.0	1.1e-64
WP_012103633.1|3285259_3285748_-	siphovirus Gp157 family protein	NA	E5DV79	Deep-sea_thermophilic_phage	41.9	2.2e-27
WP_012103634.1|3285751_3285994_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012103635.1|3286184_3286484_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012103636.1|3286487_3286628_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012103637.1|3286629_3287049_-	hypothetical protein	NA	A0A2H4J466	uncultured_Caudovirales_phage	36.1	1.7e-12
WP_012103638.1|3287061_3287211_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012103639.1|3287226_3287547_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012102296.1|3287559_3287724_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012103640.1|3287686_3287872_-	aspartyl-phosphate phosphatase Spo0E family protein	NA	NA	NA	NA	NA
WP_012103641.1|3287868_3288066_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012103642.1|3288096_3288309_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012103643.1|3288301_3288520_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012103644.1|3288520_3289288_-	ORF6C domain-containing protein	NA	A0A0H3UZF1	Geobacillus_virus	48.8	1.6e-24
>prophage 1
NC_011836	Clostridium kluyveri NBRC 12016 plasmid pCKL1, complete sequence	59182	0	29193	59182	tail,holin	Clostridium_phage(70.59%)	31	NA	NA
WP_011930403.1|0_7686_+|tail	phage tail tape measure protein	tail	I3NL90	Bifidobacterium_phage	35.0	2.7e-34
WP_011930402.1|7699_8572_+|tail	phage tail family protein	tail	E2ELJ6	Clostridium_phage	50.5	2.8e-73
WP_011930401.1|8575_9673_+	siphovirus ReqiPepy6 Gp37-like family protein	NA	E2ELJ7	Clostridium_phage	48.5	1.6e-89
WP_011930400.1|9674_12425_+	hypothetical protein	NA	E2ELJ8	Clostridium_phage	58.1	3.4e-72
WP_011930399.1|12425_12914_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011930398.1|12889_13348_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011930397.1|13602_13995_+|holin	phage holin family protein	holin	D9ZNF2	Clostridium_phage	62.5	1.5e-42
WP_011930396.1|14007_14928_+	peptidoglycan-binding protein	NA	D9ZNF3	Clostridium_phage	58.7	1.8e-62
WP_011930395.1|15046_15463_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011930394.1|15553_16309_+	DNA adenine methylase	NA	A0A2H4IYF4	uncultured_Caudovirales_phage	56.1	1.0e-79
WP_011930393.1|16634_16844_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011930392.1|16845_17028_+	hypothetical protein	NA	A0A0A7RTH9	Clostridium_phage	86.0	2.6e-18
WP_011930391.1|17140_17725_-	hypothetical protein	NA	A0A0A8WEM4	Clostridium_phage	39.1	6.7e-23
WP_011930390.1|17948_18860_+	ParM/StbA family protein	NA	NA	NA	NA	NA
WP_011930389.1|18871_19138_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011930388.1|19168_19588_+	DUF5348 domain-containing protein	NA	NA	NA	NA	NA
WP_155814049.1|19878_20016_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011930387.1|20012_21188_+	cell division protein FtsK	NA	A0A127AW94	Bacillus_phage	31.8	5.5e-16
WP_012620006.1|21171_21678_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011930385.1|21810_22206_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_011930384.1|22259_22589_-	hypothetical protein	NA	A0A0A7RU16	Clostridium_phage	36.1	6.9e-09
WP_011930383.1|22913_23096_+	type II toxin-antitoxin system HicA family toxin	NA	A0A0A7RWW9	Clostridium_phage	60.0	6.7e-14
WP_011930382.1|23149_23551_+	type II toxin-antitoxin system HicB family antitoxin	NA	A0A0A7S1E5	Clostridium_phage	57.9	9.6e-37
WP_011930381.1|23984_24860_+	transcriptional regulator	NA	A0A1B1P7T6	Bacillus_phage	55.1	1.4e-24
WP_011930380.1|24913_26239_-	3'-5' exonuclease	NA	A0A0A7RWA3	Clostridium_phage	41.6	6.1e-72
WP_011930379.1|26372_26711_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_011930378.1|26832_27084_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_011930377.1|27482_27842_-	helix-turn-helix transcriptional regulator	NA	A0A0A8WE86	Clostridium_phage	39.5	4.0e-18
WP_011930376.1|28008_28155_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155814050.1|28212_28362_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011930375.1|28401_29193_+	ORF6N domain-containing protein	NA	A0A0H3UZF1	Geobacillus_virus	42.3	1.1e-20
>prophage 2
NC_011836	Clostridium kluyveri NBRC 12016 plasmid pCKL1, complete sequence	59182	41996	58952	59182	terminase,tail,head,capsid,protease,portal	Bacillus_phage(21.43%)	21	NA	NA
WP_011930349.1|41996_42590_+	hypothetical protein	NA	R4JDR3	Bacillus_phage	30.3	3.1e-15
WP_011930348.1|42602_42998_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_011930347.1|42998_43589_+	ERCC4 domain-containing protein	NA	A0A2D1GQA7	Lysinibacillus_phage	42.2	1.6e-27
WP_011930346.1|43604_46211_+	DNA primase	NA	A0A1S5RG58	Helicobacter_phage	32.6	7.5e-05
WP_172634807.1|46479_46677_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011930420.1|46810_47260_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011930419.1|47561_47831_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011930418.1|47864_48158_+	transglycosylase	NA	A0A0K2CZP5	Paenibacillus_phage	37.6	6.8e-08
WP_011930417.1|48233_48542_+	HNH endonuclease	NA	Q4ZCU3	Staphylococcus_virus	50.6	2.6e-18
WP_041701139.1|48722_49175_+|terminase	phage terminase small subunit P27 family	terminase	A6M947	Geobacillus_virus	41.3	2.8e-24
WP_011930414.1|52142_53399_+|portal	phage portal protein	portal	A0A0U3SQF0	Bacillus_phage	60.8	1.8e-129
WP_049759179.1|53382_54123_+|protease	Clp protease ClpP	protease	A0A0K2CZ28	Paenibacillus_phage	62.9	7.4e-83
WP_011930412.1|54103_55291_+|capsid	phage major capsid protein	capsid	A0A0K2CZ99	Paenibacillus_phage	54.1	1.4e-107
WP_011930411.1|55355_55559_+	fibronectin type III domain-containing protein	NA	NA	NA	NA	NA
WP_011930410.1|55578_55896_+|head,tail	phage head-tail connector protein	head,tail	A0A286QPQ3	Streptococcus_phage	36.5	4.5e-05
WP_011930409.1|55858_56227_+|head	phage head closure protein	head	NA	NA	NA	NA
WP_011930408.1|56260_56647_+	HK97 gp10 family phage protein	NA	E2ELI9	Clostridium_phage	37.3	1.9e-18
WP_011930407.1|56643_56970_+	hypothetical protein	NA	A0A0S2SY15	Bacillus_phage	35.2	1.3e-10
WP_011930406.1|57008_57923_+	Ig-like domain-containing protein	NA	A0A0A7RUI3	Clostridium_phage	33.8	7.1e-19
WP_011930405.1|57986_58349_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011930404.1|58583_58952_+	DUF4064 domain-containing protein	NA	Q0SPK7	Clostridium_phage	50.0	1.1e-18
