The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_010376	Finegoldia magna ATCC 29328, complete genome	1797577	715050	723196	1797577		Planktothrix_phage(16.67%)	9	NA	NA
WP_012290545.1|715050_715665_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	28.6	1.5e-17
WP_012290546.1|715741_717847_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	37.7	1.6e-77
WP_002838120.1|717859_718309_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	49.3	1.1e-33
WP_012290547.1|718317_720054_+	fibronectin/fibrinogen-binding protein	NA	M1HQM6	Paramecium_bursaria_Chlorella_virus	41.3	1.5e-09
WP_012290548.1|720123_720999_+	YicC family protein	NA	NA	NA	NA	NA
WP_002838275.1|721006_721258_+	DUF370 domain-containing protein	NA	NA	NA	NA	NA
WP_002839418.1|721259_721847_+	guanylate kinase	NA	A0A0M5KCK5	Mollivirus	32.0	4.3e-09
WP_002838258.1|721839_722037_+	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_012290549.1|722029_723196_+	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	31.5	2.7e-39
>prophage 2
NC_010376	Finegoldia magna ATCC 29328, complete genome	1797577	773864	781926	1797577		Catovirus(33.33%)	9	NA	NA
WP_012290578.1|773864_775634_+	C40 family peptidase	NA	A0A2H5BMT3	Streptomyces_phage	43.5	5.6e-20
WP_012290579.1|775732_776371_+	helix-hairpin-helix domain-containing protein	NA	A0A1V0SDW0	Indivirus	45.5	3.7e-06
WP_012290580.1|776384_777449_+	selenide, water dikinase SelD	NA	NA	NA	NA	NA
WP_002838404.1|777456_778155_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	31.2	1.4e-22
WP_012290581.1|778195_778780_+	peptidylprolyl isomerase	NA	A0A1V0S9I2	Catovirus	41.4	8.0e-24
WP_012290582.1|778781_779414_+	thymidine kinase	NA	G3MBK1	Bacillus_virus	35.9	7.1e-26
WP_002841719.1|779435_779906_-	S-ribosylhomocysteine lyase	NA	NA	NA	NA	NA
WP_012290583.1|779914_781018_-	rod shape-determining protein RodA	NA	NA	NA	NA	NA
WP_002841740.1|781092_781926_+	deoxyribonuclease IV	NA	A0A1V0SBL9	Catovirus	30.5	1.2e-25
>prophage 3
NC_010376	Finegoldia magna ATCC 29328, complete genome	1797577	880237	891815	1797577	tRNA	Bacillus_phage(25.0%)	11	NA	NA
WP_002838433.1|880237_882409_-	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	A0A2H4IAY1	Erwinia_phage	42.5	3.9e-07
WP_012290642.1|882473_884216_-	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	33.9	2.7e-83
WP_002838251.1|884282_884591_-	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	38.1	3.9e-06
WP_012290643.1|884614_885754_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	46.6	5.3e-88
WP_002838448.1|885746_886784_-|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_002842216.1|886793_887801_-	Holliday junction branch migration DNA helicase RuvB	NA	B3GAM6	uncultured_virus	28.8	9.6e-09
WP_002838203.1|887809_888406_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_002842206.1|888414_888909_-	crossover junction endodeoxyribonuclease RuvC	NA	A0A0D3MSZ5	Lactococcus_phage	25.6	6.3e-06
WP_012290644.1|889026_889764_+	3-oxoacyl-ACP reductase FabG	NA	NA	NA	NA	NA
WP_012290645.1|889756_890476_+	response regulator transcription factor	NA	Q8QKV7	Ectocarpus_siliculosus_virus	32.5	9.9e-08
WP_012290646.1|890465_891815_+	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	30.7	1.1e-23
>prophage 1
NC_010371	Finegoldia magna ATCC 29328 plasmid pFMC, complete sequence	189163	65905	132825	189163	transposase,integrase	Geobacillus_virus(18.18%)	55	74932:74952	118286:118306
WP_012289898.1|65905_66301_+|transposase	IS200/IS605 family transposase	transposase	A0A0H3UZM0	Geobacillus_virus	63.3	3.2e-45
WP_012289899.1|66301_67723_+	hypothetical protein	NA	A0A0H3UZK2	Geobacillus_virus	46.7	2.9e-104
WP_148161032.1|67944_68256_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041250686.1|68333_68963_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012289902.1|69097_69523_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012289903.1|69522_69741_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012289904.1|69769_70345_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012289905.1|70376_70862_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148161033.1|70867_71347_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012289907.1|71380_71752_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158297419.1|71766_72042_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_012289909.1|72569_73346_+	AAA family ATPase	NA	A0A1X9I765	Streptococcus_phage	38.3	2.4e-36
WP_012289910.1|73358_73613_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012289911.1|73825_74692_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
74932:74952	attL	TTCATCATTGTTATACCCACA	NA	NA	NA	NA
WP_012289912.1|75316_75553_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_012289913.1|75556_76636_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0K0MWE8	Gordonia_phage	30.1	3.0e-08
WP_012289914.1|76729_77143_-|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	32.8	8.1e-15
WP_012289915.1|77240_78632_+|transposase	transposase	transposase	G3MB42	Bacillus_virus	36.1	1.1e-55
WP_012289916.1|78790_79396_-	TPM domain-containing protein	NA	NA	NA	NA	NA
WP_012289917.1|80322_80841_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012289918.1|80849_81545_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012289919.1|81567_83208_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012289920.1|83334_87567_-	toprim domain-containing protein	NA	NA	NA	NA	NA
WP_012289921.1|87567_90462_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012289922.1|90461_91547_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012289923.1|91561_92002_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012289924.1|92579_93302_+	C39 family peptidase	NA	NA	NA	NA	NA
WP_012289925.1|93364_93694_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012289926.1|94044_94713_+	glucosaminidase domain-containing protein	NA	G3MAW8	Bacillus_virus	41.7	6.5e-22
WP_012289927.1|94712_95144_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012289928.1|95159_95819_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012289929.1|95811_96528_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041250687.1|96614_98114_-	DUF5633 domain-containing protein	NA	NA	NA	NA	NA
WP_012289931.1|98716_101836_-	G5 domain-containing protein	NA	NA	NA	NA	NA
WP_148161038.1|102025_102667_-	class A sortase	NA	NA	NA	NA	NA
WP_012289933.1|102656_103208_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158297420.1|103194_103854_-	sortase	NA	NA	NA	NA	NA
WP_012289935.1|103888_105826_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012289936.1|105827_106571_-	class C sortase	NA	NA	NA	NA	NA
WP_012289937.1|106611_108564_-	isopeptide-forming domain-containing fimbrial protein	NA	NA	NA	NA	NA
WP_012289938.1|108602_118130_-	BspA family leucine-rich repeat surface protein	NA	NA	NA	NA	NA
WP_050716648.1|118490_120287_+	thermonuclease family protein	NA	A0A2P1JU10	Anoxybacillus_phage	41.7	5.9e-17
118286:118306	attR	TTCATCATTGTTATACCCACA	NA	NA	NA	NA
WP_012289941.1|120469_120940_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012289942.1|121038_121323_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012289943.1|121466_122168_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012289944.1|122171_122669_-	signal peptidase I	NA	NA	NA	NA	NA
WP_012289945.1|122674_123280_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012289946.1|123290_123638_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012289947.1|123805_124246_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012289948.1|124396_125647_-|transposase	transposase	transposase	A0A1L2BWW3	Bacteriophage	37.5	1.5e-59
WP_012289949.1|125957_127499_-	AAA family ATPase	NA	A0A1V0SIA7	Klosneuvirus	36.3	2.2e-28
WP_012289950.1|127726_130420_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012289951.1|130675_130954_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012289952.1|130956_131493_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012289953.1|131661_132825_-|transposase	transposase	transposase	Q331V1	Clostridium_botulinum_C_phage	57.0	3.2e-117
