The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_007712	Sodalis glossinidius str. 'morsitans', complete genome	4171146	150426	157802	4171146	plate,transposase	Salmonella_phage(33.33%)	7	NA	NA
WP_011409959.1|150426_150891_+	lysozyme	NA	B6SD42	Bacteriophage	65.8	2.7e-51
WP_166506342.1|152236_152500_+	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	65.9	4.2e-25
WP_166506343.1|152496_152877_+	hypothetical protein	NA	A0A2H4J159	uncultured_Caudovirales_phage	38.9	5.4e-05
WP_011409960.1|152776_154003_+|plate	baseplate J/gp47 family protein	plate	A0A0M4RD32	Salmonella_phage	53.7	2.2e-108
WP_011409961.1|153999_154653_+	DUF2612 domain-containing protein	NA	A9YX13	Burkholderia_phage	43.7	1.2e-49
WP_148203317.1|156009_156450_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409963.1|156878_157802_+|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	68.1	7.2e-120
>prophage 2
NC_007712	Sodalis glossinidius str. 'morsitans', complete genome	4171146	445139	450147	4171146	portal	Ralstonia_phage(42.86%)	10	NA	NA
WP_050747346.1|445139_445409_+	hypothetical protein	NA	A3E2I1	Sodalis_phage	49.3	1.9e-09
WP_158302312.1|445401_445554_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041866559.1|445768_446050_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050747347.1|446141_446477_+	hypothetical protein	NA	Q7M2A0	Enterobacteria_phage	45.8	2.0e-11
WP_050747348.1|446525_446933_+	hypothetical protein	NA	A0A077K8T2	Ralstonia_phage	45.0	1.2e-26
WP_050747349.1|446890_447157_+	toprim domain-containing protein	NA	A0A077K8T2	Ralstonia_phage	58.6	7.5e-22
WP_050747350.1|447175_447472_+	hypothetical protein	NA	A0A077K8T2	Ralstonia_phage	43.9	1.2e-15
WP_158302313.1|447496_447652_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050747352.1|448767_448986_-	ogr/Delta-like zinc finger family protein	NA	F1BUM8	Cronobacter_phage	41.7	6.4e-11
WP_041866560.1|449076_450147_-|portal	phage portal protein	portal	F1BUM7	Cronobacter_phage	66.8	1.3e-133
>prophage 3
NC_007712	Sodalis glossinidius str. 'morsitans', complete genome	4171146	453226	459746	4171146	tail,holin	Cronobacter_phage(71.43%)	10	NA	NA
WP_011410109.1|453226_453805_+	DUF2597 family protein	NA	F1BUL4	Cronobacter_phage	58.7	1.5e-35
WP_041866562.1|453813_454116_+|holin	phage holin family protein	holin	A0A0M5M1H1	Salmonella_phage	45.9	1.3e-14
WP_041866564.1|454586_454841_+	phage gene	NA	NA	NA	NA	NA
WP_158302314.1|455030_455432_+	hypothetical protein	NA	F1BUK9	Cronobacter_phage	56.2	1.0e-17
WP_050747354.1|455362_456373_+|tail	phage tail tape measure protein	tail	F1BUK9	Cronobacter_phage	52.0	3.2e-89
WP_050747355.1|456418_456622_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148203342.1|456591_456855_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041866565.1|456800_457109_+	DUF2590 family protein	NA	F1BUK8	Cronobacter_phage	58.3	1.8e-19
WP_011410110.1|458250_458859_+	hypothetical protein	NA	F1BUK5	Cronobacter_phage	65.9	1.1e-65
WP_083764646.1|459464_459746_+	hypothetical protein	NA	Q37842	Escherichia_phage	50.6	7.5e-20
>prophage 4
NC_007712	Sodalis glossinidius str. 'morsitans', complete genome	4171146	582249	588002	4171146	tail,plate	Escherichia_phage(50.0%)	11	NA	NA
WP_050747374.1|582249_582549_+	hypothetical protein	NA	C9DGQ1	Escherichia_phage	47.5	2.0e-10
WP_083764655.1|582545_582797_+	tape measure protein	NA	A0A0C4UQU8	Shigella_phage	57.6	1.6e-13
WP_050747375.1|582777_583227_+	hypothetical protein	NA	A0A0C4UQU8	Shigella_phage	32.5	1.2e-11
WP_041866594.1|583483_583726_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083764656.1|583722_584208_+	DNA circularization N-terminal domain-containing protein	NA	A0A0C4UR32	Shigella_phage	50.5	7.1e-18
WP_083764657.1|584207_584468_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041866596.1|584534_584846_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158302321.1|586062_586581_+|plate	baseplate J/gp47 family protein	plate	C9DGQ6	Escherichia_phage	50.6	3.9e-46
WP_011410187.1|586571_587021_+	DUF2313 domain-containing protein	NA	C9DGQ7	Escherichia_phage	44.4	5.5e-33
WP_050747378.1|587020_587452_+	hypothetical protein	NA	A0A0C4UQS2	Shigella_phage	51.4	3.4e-24
WP_148203349.1|587372_588002_+|tail	tail fiber protein	tail	Q37842	Escherichia_phage	40.2	7.3e-23
>prophage 5
NC_007712	Sodalis glossinidius str. 'morsitans', complete genome	4171146	1137408	1241583	4171146	terminase,protease,tRNA,plate,portal,holin,transposase,capsid,head,tail	Enterobacteria_phage(16.67%)	106	NA	NA
WP_011410535.1|1137408_1138683_+|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	56.4	1.9e-131
WP_011410536.1|1138877_1141232_+	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	52.9	4.2e-225
WP_011410537.1|1141446_1141719_+	DNA-binding protein HU-beta	NA	A4JWM7	Burkholderia_virus	58.4	1.1e-20
WP_011410538.1|1141953_1143807_+	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_158302339.1|1144293_1144452_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011410539.1|1144703_1145399_-	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	67.6	3.7e-84
WP_011410540.1|1146880_1148659_+	SmdA family multidrug ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	28.7	6.2e-43
WP_011410541.1|1148642_1150418_+	SmdB family multidrug efflux ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	26.1	4.3e-36
WP_011410542.1|1150796_1151135_+	P-II family nitrogen regulator	NA	NA	NA	NA	NA
WP_041866665.1|1153404_1153707_-	MGMT family protein	NA	NA	NA	NA	NA
WP_011410544.1|1154494_1154698_-	hemolysin expression modulator Hha	NA	NA	NA	NA	NA
WP_011410545.1|1154744_1155104_-	Hha toxicity modulator TomB	NA	NA	NA	NA	NA
WP_011410546.1|1155620_1155761_-	50S ribosomal protein L36	NA	NA	NA	NA	NA
WP_011410547.1|1156189_1159354_-	multidrug efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	21.5	6.7e-40
WP_011410548.1|1159372_1160569_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_011410549.1|1160713_1161373_+	multidrug efflux transporter transcriptional repressor AcrR	NA	NA	NA	NA	NA
WP_070108800.1|1161402_1161552_-	DUF2496 domain-containing protein	NA	NA	NA	NA	NA
WP_011410550.1|1161661_1162195_-	primosomal replication protein	NA	NA	NA	NA	NA
WP_011410551.1|1162450_1163002_+	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	46.3	1.5e-27
WP_011410552.1|1163076_1165281_+	DNA polymerase III subunit gamma/tau	NA	A0A1L2BWV7	Bacteriophage	33.4	2.4e-44
WP_011410553.1|1165340_1165670_+	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_011410554.1|1165669_1166275_+	recombination protein RecR	NA	NA	NA	NA	NA
WP_162010790.1|1166421_1168308_+	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	37.1	2.9e-115
WP_011410556.1|1168625_1169270_+	adenylate kinase	NA	NA	NA	NA	NA
WP_011410557.1|1169677_1170685_+	ferrochelatase	NA	NA	NA	NA	NA
WP_166506442.1|1170708_1171713_-|tRNA	Cys-tRNA(Pro)/Cys-tRNA(Cys) deacylase YbaK	tRNA	NA	NA	NA	NA
WP_011410558.1|1171791_1172592_-	TraB/GumN family protein	NA	NA	NA	NA	NA
WP_158302340.1|1174919_1175237_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011410559.1|1175392_1175992_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158302341.1|1176315_1176561_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011410561.1|1176754_1177672_-	SPFH/Band 7/PHB domain protein	NA	NA	NA	NA	NA
WP_011410562.1|1178183_1178750_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	28.3	3.4e-19
WP_050747441.1|1178788_1180015_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011410563.1|1180247_1182479_+	NADP-dependent isocitrate dehydrogenase	NA	NA	NA	NA	NA
WP_011410564.1|1182517_1183588_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_011410565.1|1183584_1184094_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	NA	NA	NA	NA
WP_050747442.1|1184327_1184513_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011410566.1|1184777_1185497_-	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_011410567.1|1185507_1186002_-	peptidylprolyl isomerase B	NA	NA	NA	NA	NA
WP_011410568.1|1186255_1187629_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	33.7	5.3e-42
WP_011410569.1|1187788_1188661_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.2	2.2e-30
WP_148203645.1|1189542_1190994_+	SH3 domain-containing protein	NA	NA	NA	NA	NA
WP_148203384.1|1191087_1191600_+	DUF1543 domain-containing protein	NA	NA	NA	NA	NA
WP_011410572.1|1191722_1192313_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	62.7	6.1e-64
WP_083764684.1|1192435_1192948_+	hypothetical protein	NA	Q2A0A9	Sodalis_phage	37.1	1.9e-05
WP_083764685.1|1192947_1193556_+|tail	tail fiber assembly protein	tail	Q2A0A8	Sodalis_phage	43.1	9.2e-31
WP_041867402.1|1194550_1195141_-	DUF2313 domain-containing protein	NA	A0A192Y5V3	Salmonella_phage	63.7	4.2e-73
WP_011410576.1|1195146_1196217_-|plate	baseplate J/gp47 family protein	plate	Q8W615	Enterobacteria_phage	64.1	9.5e-132
WP_011410577.1|1196206_1196617_-	phage GP46 family protein	NA	Q8HAB8	Salmonella_phage	59.3	1.9e-32
WP_011410578.1|1196622_1197189_-|plate	phage baseplate assembly protein	plate	U5P081	Shigella_phage	42.9	1.1e-30
WP_041866669.1|1198295_1199618_-	DNA circularization N-terminal domain-containing protein	NA	Q8SBG8	Shigella_phage	51.5	2.4e-124
WP_011410580.1|1201620_1201944_-|tail	phage tail assembly protein	tail	Q8W621	Enterobacteria_phage	50.0	1.6e-21
WP_041866670.1|1201940_1202306_-|tail	phage tail tube protein	tail	U5P076	Shigella_phage	69.0	3.9e-45
WP_011410582.1|1202305_1203805_-|tail	phage tail sheath subtilisin-like domain-containing protein	tail	Q8HAC5	Salmonella_phage	63.6	1.3e-179
WP_041866671.1|1203801_1204074_-	DUF2635 domain-containing protein	NA	NA	NA	NA	NA
WP_011410583.1|1204070_1204610_-	hypothetical protein	NA	A0A192Y5U4	Salmonella_phage	56.7	3.2e-51
WP_011410584.1|1204599_1205133_-	hypothetical protein	NA	Q8HAC8	Salmonella_phage	59.9	6.5e-49
WP_041866672.1|1205119_1205503_-|head	phage head closure protein	head	NA	NA	NA	NA
WP_041866673.1|1205499_1205817_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A192Y8J4	Salmonella_phage	33.0	1.2e-10
WP_011410585.1|1205876_1207121_-|capsid	phage major capsid protein	capsid	K7PM57	Enterobacteria_phage	68.7	7.6e-149
WP_011410586.1|1208026_1209355_-|portal	phage portal protein	portal	A0A1P8DTI5	Proteus_phage	64.5	8.6e-167
WP_011410587.1|1209354_1211103_-|terminase	terminase large subunit	terminase	A0A0U2C138	Paracoccus_phage	44.9	2.1e-136
WP_041867403.1|1211053_1211521_-|terminase	phage terminase small subunit P27 family	terminase	Q9B019	Phage_GMSE-1	98.7	1.1e-81
WP_011410589.1|1211674_1212013_-	HNH endonuclease	NA	Q9B020	Phage_GMSE-1	98.1	1.6e-56
WP_148203385.1|1212021_1212336_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050747444.1|1212341_1212557_-	DUF551 domain-containing protein	NA	NA	NA	NA	NA
WP_011410590.1|1212946_1213936_-	DNA cytosine methyltransferase	NA	W0LM09	Edwardsiella_phage	58.8	2.2e-106
WP_041866674.1|1214181_1214391_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050747445.1|1214368_1214983_-	Rha family transcriptional regulator	NA	Q9B021	Phage_GMSE-1	100.0	1.5e-33
WP_011410591.1|1215146_1215644_-	lysozyme	NA	B6SD42	Bacteriophage	70.3	2.2e-59
WP_041866675.1|1215643_1215877_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083764686.1|1215899_1216079_-|holin	holin	holin	B6SD41	Bacteriophage	68.5	1.7e-14
WP_041866676.1|1216118_1216484_-	RusA family crossover junction endodeoxyribonuclease	NA	F1C5C9	Cronobacter_phage	38.5	3.2e-15
WP_011410592.1|1216449_1216995_-	phage N-6-adenine-methyltransferase	NA	Q9EYC2	Enterobacteria_phage	57.2	1.4e-46
WP_041866677.1|1217290_1218022_-	DNA replication protein DnaC	NA	A0A1W6JP39	Morganella_phage	49.2	1.5e-59
WP_050747446.1|1218330_1218579_-	hypothetical protein	NA	K7PGT1	Enterobacteria_phage	62.7	4.3e-11
WP_041866678.1|1218772_1219183_-	replication protein	NA	K7PGT1	Enterobacteria_phage	37.1	1.9e-11
WP_148203387.1|1219175_1219469_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148203388.1|1219470_1219662_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011410594.1|1219956_1220757_-	KilA-N domain-containing protein	NA	Q3LZN6	Bacteriophage	86.1	1.6e-128
WP_011410595.1|1220873_1221233_+	hypothetical protein	NA	Q3LZN5	Bacteriophage	57.1	1.4e-23
WP_041867407.1|1221241_1221643_-	single-stranded DNA-binding protein	NA	A0A1W6JNW8	Morganella_phage	53.3	2.6e-34
WP_041866680.1|1221675_1222296_-	YqaJ viral recombinase family protein	NA	S0A2A9	Cellulophaga_phage	46.3	7.6e-41
WP_011410597.1|1222282_1222789_-	hypothetical protein	NA	A0A0F7L6F4	uncultured_marine_virus	30.0	7.7e-07
WP_041866681.1|1222788_1223076_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011410598.1|1223600_1224506_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	65.8	1.5e-114
WP_011410599.1|1224713_1225292_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_011410600.1|1225481_1226870_-	MFS transporter	NA	NA	NA	NA	NA
WP_041866682.1|1229945_1230131_-	ANR family transcriptional regulator	NA	NA	NA	NA	NA
WP_083764690.1|1230136_1230340_-	hypothetical protein	NA	A0A286S1P6	Klebsiella_phage	47.6	5.6e-09
WP_011410601.1|1230352_1231102_-	Rha family transcriptional regulator	NA	A0A2I7RX10	Vibrio_phage	51.9	3.1e-65
WP_050747449.1|1231146_1231734_-	phage antirepressor KilAC domain-containing protein	NA	Q7Y5W2	Haemophilus_phage	46.8	5.0e-26
WP_148203389.1|1231811_1232159_-	hypothetical protein	NA	K7PL51	Enterobacteria_phage	59.3	4.3e-09
WP_148203390.1|1232229_1233000_-	Rha family transcriptional regulator	NA	A0A0P0ZGC2	Escherichia_phage	65.4	1.7e-34
WP_011410603.1|1233751_1234444_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_148203392.1|1234476_1234686_-	transcriptional regulator	NA	A3E2I1	Sodalis_phage	65.2	4.0e-10
WP_011410604.1|1234950_1235547_-	hypothetical protein	NA	G9L666	Escherichia_phage	49.7	3.1e-47
WP_011410605.1|1235615_1236254_-	PD-(D/E)XK nuclease family protein	NA	Q7Y5X2	Haemophilus_phage	53.9	5.4e-58
WP_158302342.1|1237128_1237287_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041866683.1|1237450_1237693_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050747926.1|1237839_1238322_+	hypothetical protein	NA	K7PK22	Enterobacteria_phage	55.8	6.5e-40
WP_083764691.1|1238310_1238658_-	hypothetical protein	NA	Q9B030	Phage_GMSE-1	45.9	7.3e-17
WP_050747451.1|1239113_1239560_-	helix-turn-helix domain-containing protein	NA	A0A2R2X2B0	Escherichia_phage	63.5	2.1e-24
WP_083765077.1|1239665_1239872_+	hypothetical protein	NA	K7PLQ6	Enterobacteria_phage	49.2	9.6e-09
WP_041866685.1|1240006_1240330_+	hypothetical protein	NA	A0A1W6JNY4	Morganella_phage	51.5	1.4e-17
WP_041866687.1|1241019_1241583_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
>prophage 6
NC_007712	Sodalis glossinidius str. 'morsitans', complete genome	4171146	1247897	1294714	4171146	terminase,lysis,transposase,holin,tail	Edwardsiella_phage(52.17%)	45	NA	NA
WP_173340366.1|1247897_1248083_+|holin	holin	holin	B6SD41	Bacteriophage	70.7	1.2e-18
WP_148203395.1|1248608_1248929_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148203647.1|1249122_1249551_+|lysis	lysis protein	lysis	Q2A0C4	Sodalis_phage	49.6	7.9e-21
WP_011410612.1|1249946_1251317_+|terminase	PBSX family phage terminase large subunit	terminase	A0A220NQL3	Acinetobacter_phage	57.2	3.2e-140
WP_050747457.1|1251316_1251814_+	DUF1073 domain-containing protein	NA	NA	NA	NA	NA
WP_158302345.1|1251841_1252726_+	DUF1073 domain-containing protein	NA	A0A077KC81	Edwardsiella_phage	41.7	1.9e-61
WP_011410614.1|1253470_1254574_+	DUF2213 domain-containing protein	NA	A0A2R3UAL3	Myoviridae_environmental_samples	48.3	3.3e-39
WP_011410615.1|1254573_1255056_+	hypothetical protein	NA	A0A077KAW3	Edwardsiella_phage	49.1	2.1e-38
WP_011410616.1|1255058_1256090_+	hypothetical protein	NA	A0A077KC85	Edwardsiella_phage	40.1	2.5e-57
WP_041866692.1|1256086_1256353_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041866693.1|1256436_1256859_+	DUF4054 domain-containing protein	NA	NA	NA	NA	NA
WP_041866694.1|1256855_1257311_+	hypothetical protein	NA	A0A077KC03	Edwardsiella_phage	52.5	1.8e-31
WP_011410618.1|1257297_1257687_+	hypothetical protein	NA	A0A077KAW7	Edwardsiella_phage	58.3	6.0e-36
WP_148203396.1|1257658_1258192_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011410619.1|1258188_1259670_+	DUF3383 domain-containing protein	NA	A0A077KGV4	Edwardsiella_phage	51.1	1.1e-133
WP_011410620.1|1259679_1260114_+	hypothetical protein	NA	A0A077K9T0	Edwardsiella_phage	60.4	1.5e-43
WP_041866696.1|1260113_1260536_+	hypothetical protein	NA	A0A077KC08	Edwardsiella_phage	49.6	5.6e-27
WP_148203397.1|1260559_1260748_+	transcription elongation factor GreA	NA	NA	NA	NA	NA
WP_011410621.1|1260734_1262582_+	hypothetical protein	NA	A0A077KC92	Edwardsiella_phage	31.8	2.5e-31
WP_011410622.1|1262592_1263387_+	hypothetical protein	NA	A0A077KGW3	Edwardsiella_phage	47.8	3.2e-44
WP_011410623.1|1263386_1263692_+	hypothetical protein	NA	A0A077K9U4	Edwardsiella_phage	54.5	3.1e-27
WP_011410624.1|1263684_1264566_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050747461.1|1264528_1265215_+	hypothetical protein	NA	A0A077KAY0	Edwardsiella_phage	47.0	1.2e-50
WP_041866697.1|1265217_1265577_+	hypothetical protein	NA	B7X9X8	uncultured_phage	32.2	1.7e-08
WP_050747463.1|1266275_1266563_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158302346.1|1266571_1266748_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011410626.1|1267337_1268234_+|tail	tail fiber protein	tail	H9C0Y2	Aeromonas_phage	40.4	4.7e-15
WP_166506520.1|1268277_1268703_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041866698.1|1268702_1269077_+|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	36.4	1.3e-06
WP_158302347.1|1269117_1270047_-	acyltransferase family protein	NA	NA	NA	NA	NA
WP_148203398.1|1270033_1270213_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011410628.1|1270291_1271161_-	papain-like cysteine peptidase	NA	NA	NA	NA	NA
WP_011410629.1|1271275_1272226_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	82.9	8.5e-116
WP_083764694.1|1272909_1273098_-	transcriptional regulator	NA	Q2A088	Sodalis_phage	48.1	1.2e-05
WP_148203399.1|1273316_1273628_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011410631.1|1280076_1280976_-|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	64.5	2.7e-111
WP_148203400.1|1281214_1281463_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148203401.1|1281729_1282047_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041866701.1|1284945_1285302_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011410632.1|1285351_1287355_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_011410633.1|1287351_1288077_+	DsbA family protein	NA	NA	NA	NA	NA
WP_011410634.1|1288076_1288580_+	protein disulfide oxidoreductase	NA	NA	NA	NA	NA
WP_148203402.1|1290314_1290752_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041866703.1|1292681_1293203_+	acyltransferase family protein	NA	NA	NA	NA	NA
WP_011410636.1|1293775_1294714_+|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	67.8	3.6e-119
>prophage 7
NC_007712	Sodalis glossinidius str. 'morsitans', complete genome	4171146	1355558	1415206	4171146	integrase,tRNA,plate,transposase,capsid,tail	Burkholderia_virus(39.47%)	64	1353191:1353207	1423928:1423944
1353191:1353207	attL	ACAGCGCCGGCCAGGCC	NA	NA	NA	NA
WP_011410666.1|1355558_1358141_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	42.0	8.9e-184
WP_011410667.1|1358410_1358890_+	zinc ribbon-containing protein	NA	NA	NA	NA	NA
WP_011410668.1|1358972_1359698_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.2	9.0e-25
WP_011410669.1|1361073_1361970_-	amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_011410670.1|1363276_1364806_-	apolipoprotein N-acyltransferase	NA	NA	NA	NA	NA
WP_011410671.1|1364813_1365692_-	CNNM family magnesium/cobalt transport protein CorC	NA	NA	NA	NA	NA
WP_011410672.1|1365733_1366204_-	rRNA maturation RNase YbeY	NA	NA	NA	NA	NA
WP_011410673.1|1366200_1367295_-	PhoH family protein	NA	A0A0S0MVD6	Pseudomonas_phage	44.7	2.5e-47
WP_011410674.1|1367518_1368943_-|tRNA	tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB	tRNA	NA	NA	NA	NA
WP_011410675.1|1369116_1370301_+	2-octaprenyl-3-methyl-6-methoxy-1,4-benzoquinol hydroxylase	NA	NA	NA	NA	NA
WP_041866742.1|1370647_1371163_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148203414.1|1371223_1371475_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011410676.1|1372555_1374217_-	asparagine synthase B	NA	H8ZJK1	Ostreococcus_tauri_virus	37.4	6.3e-82
WP_148203415.1|1374259_1374568_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011410677.1|1374681_1375935_-	ROK family transcriptional regulator	NA	NA	NA	NA	NA
WP_011410678.1|1375952_1377095_-	N-acetylglucosamine-6-phosphate deacetylase	NA	NA	NA	NA	NA
WP_001281697.1|1377363_1377753_-	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	53.4	3.8e-30
WP_001135926.1|1378379_1379069_-	DUF2786 domain-containing protein	NA	A0A1W6DYA0	Aeromonas_phage	33.9	5.9e-26
WP_001569383.1|1379055_1379352_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016246284.1|1379367_1379640_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001569384.1|1379636_1379825_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000005725.1|1379903_1380515_-	DUF3164 family protein	NA	A0A2D1GNM4	Pseudomonas_phage	68.5	7.2e-76
WP_000835317.1|1380532_1380802_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011410679.1|1380804_1381971_-	AAA family ATPase	NA	A4JWN1	Burkholderia_virus	61.1	1.3e-121
WP_011410680.1|1381981_1383751_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	Q6QIE0	Burkholderia_phage	67.8	6.2e-229
WP_006687266.1|1383754_1384663_-	DUF3102 domain-containing protein	NA	A4JWN3	Burkholderia_virus	55.4	6.3e-76
WP_000042842.1|1384672_1384978_-	helix-turn-helix domain-containing protein	NA	Q5ZR02	Pseudomonas_phage	58.0	9.2e-24
WP_001041677.1|1384974_1385199_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001569385.1|1385287_1385698_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001569386.1|1385733_1386267_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000664222.1|1386314_1387085_-	DNA adenine methylase	NA	A2I2Y7	Vibrio_virus	64.9	7.6e-99
WP_000793140.1|1387332_1387683_+	membrane protein	NA	A4JWP3	Burkholderia_virus	54.8	4.0e-23
WP_024191701.1|1387697_1388420_+	transglycosylase SLT domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	58.8	1.8e-62
WP_011410681.1|1388409_1389063_+	hypothetical protein	NA	A0A0S4L1H0	Pseudomonas_phage	30.7	2.4e-08
WP_000175096.1|1389059_1389392_+	hypothetical protein	NA	Q6QIC4	Burkholderia_phage	47.7	1.1e-17
WP_006122433.1|1389384_1389696_+	hypothetical protein	NA	A0A0S4L0A3	Pseudomonas_phage	63.6	3.2e-32
WP_011410682.1|1389695_1390241_+	DUF3486 family protein	NA	A4JWJ3	Burkholderia_virus	67.6	1.2e-58
WP_011410683.1|1390237_1391761_+	hypothetical protein	NA	A4JWJ4	Burkholderia_virus	62.4	2.6e-183
WP_011410684.1|1391760_1393257_+	DUF935 domain-containing protein	NA	Q6QIC0	Burkholderia_phage	59.8	1.5e-170
WP_011410685.1|1393237_1394059_+|capsid	minor capsid protein	capsid	Q6QIB9	Burkholderia_phage	61.5	5.8e-97
WP_011410686.1|1394061_1394520_+	phage virion morphogenesis protein	NA	Q6QIB8	Burkholderia_phage	43.6	1.3e-29
WP_011410687.1|1394734_1395832_+	hypothetical protein	NA	A4JWJ9	Burkholderia_virus	49.6	5.0e-96
WP_011410688.1|1395845_1396799_+	hypothetical protein	NA	A4JWK0	Burkholderia_virus	44.0	7.5e-64
WP_011410689.1|1396809_1397166_+	DUF2190 family protein	NA	NA	NA	NA	NA
WP_000271666.1|1397167_1397614_+	DUF1320 domain-containing protein	NA	A4JWK2	Burkholderia_virus	51.7	1.1e-33
WP_001101809.1|1397613_1398078_+	hypothetical protein	NA	Q6QIB2	Burkholderia_phage	51.7	4.1e-39
WP_000666495.1|1398077_1398329_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000729861.1|1398318_1399746_+|tail	phage tail sheath subtilisin-like domain-containing protein	tail	A4JWK5	Burkholderia_virus	78.6	3.4e-217
WP_162837902.1|1399742_1400267_+|tail	phage major tail tube protein	tail	A4JWK6	Burkholderia_virus	67.8	4.7e-68
WP_000215406.1|1400269_1400551_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011410690.1|1400649_1400964_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_001148841.1|1400929_1401067_+|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_011410691.1|1401159_1403625_+|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	42.8	7.4e-172
WP_000458380.1|1403624_1404509_+|tail	phage tail protein	tail	A4JWL1	Burkholderia_virus	47.9	3.1e-51
WP_000478225.1|1404508_1404721_+|tail	tail protein X	tail	Q6QIA3	Burkholderia_phage	57.1	1.5e-17
WP_000808003.1|1404708_1405878_+	phage late control D family protein	NA	Q6QIA2	Burkholderia_phage	49.1	3.0e-86
WP_000929399.1|1405877_1406390_+|plate	phage baseplate assembly protein V	plate	A4JWL4	Burkholderia_virus	38.5	9.4e-21
WP_000859115.1|1406444_1406792_+	GPW/gp25 family protein	NA	Q6QIA0	Burkholderia_phage	63.3	7.8e-35
WP_001569394.1|1406782_1407886_+|plate	baseplate J/gp47 family protein	plate	A4JWL6	Burkholderia_virus	53.5	9.2e-106
WP_011410693.1|1407878_1408457_+|tail	phage tail protein I	tail	A4JWL7	Burkholderia_virus	65.8	1.1e-65
WP_041866745.1|1409604_1410006_+|tail	tail fiber assembly protein	tail	A0A218M4J2	Erwinia_phage	45.5	1.8e-14
WP_011410695.1|1410021_1410849_-	glucosamine-6-phosphate deaminase	NA	NA	NA	NA	NA
WP_011410696.1|1411178_1413215_+	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_011410697.1|1413535_1415206_+|tRNA	glutamine--tRNA ligase	tRNA	A0A222YZ70	Escherichia_phage	82.1	1.1e-275
1423928:1423944	attR	GGCCTGGCCGGCGCTGT	NA	NA	NA	NA
>prophage 8
NC_007712	Sodalis glossinidius str. 'morsitans', complete genome	4171146	1523283	1542752	4171146	protease,holin	Bacteriophage(21.05%)	30	NA	NA
WP_041866756.1|1523283_1523679_-	single-stranded DNA-binding protein	NA	A0A1W6JNW8	Morganella_phage	57.1	6.5e-38
WP_011410791.1|1523669_1524287_-	ERF family protein	NA	A0A1W6JP21	Morganella_phage	66.2	1.1e-68
WP_148203420.1|1524295_1524493_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148203421.1|1524598_1524742_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	NA	NA	NA	NA
WP_041866757.1|1524956_1525193_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011410792.1|1525185_1525785_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041866758.1|1525794_1526607_-	Rha family transcriptional regulator	NA	Q8W644	Enterobacteria_phage	43.7	2.0e-28
WP_041866759.1|1526674_1527445_-	Rha family transcriptional regulator	NA	Q3LZN7	Bacteriophage	47.5	1.5e-33
WP_041866760.1|1527761_1528136_+	hypothetical protein	NA	Q3LZN5	Bacteriophage	75.9	1.3e-16
WP_050747502.1|1528138_1528375_-	DUF1374 domain-containing protein	NA	NA	NA	NA	NA
WP_041866761.1|1528371_1528575_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041866762.1|1528592_1528868_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041867441.1|1528944_1530024_-	RelA/SpoT domain-containing protein	NA	A0A1B0VBT5	Salmonella_phage	35.5	2.8e-46
WP_011410797.1|1530948_1531668_-	helix-turn-helix transcriptional regulator	NA	W6MVG5	Pseudomonas_phage	45.9	1.7e-47
WP_083764701.1|1531784_1532069_+	hypothetical protein	NA	A0A2H4J8E6	uncultured_Caudovirales_phage	57.1	5.6e-15
WP_011410798.1|1532995_1533706_-	helix-turn-helix transcriptional regulator	NA	M9NZE3	Enterobacteria_phage	59.1	4.4e-77
WP_083764703.1|1533839_1534046_+	helix-turn-helix domain-containing protein	NA	K7P6H5	Enterobacteria_phage	48.4	2.1e-08
WP_050747503.1|1534231_1534531_+	hypothetical protein	NA	A0A1W6JNY4	Morganella_phage	47.9	9.1e-16
WP_050747504.1|1534954_1535263_+	hypothetical protein	NA	G9L680	Escherichia_phage	47.1	1.1e-13
WP_011410799.1|1536692_1537130_+	recombination protein NinB	NA	G8C7V3	Escherichia_phage	66.4	1.8e-49
WP_041867442.1|1537829_1538291_+	hypothetical protein	NA	C6ZR60	Salmonella_phage	75.7	1.9e-65
WP_158302357.1|1538287_1538446_+	hypothetical protein	NA	A0A219UQU1	Bacillus_phage	44.0	3.8e-05
WP_083764704.1|1538530_1538770_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158302358.1|1538798_1539017_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148203422.1|1539257_1539599_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148203423.1|1540295_1540493_+	hypothetical protein	NA	NA	NA	NA	NA
WP_173340367.1|1540567_1540747_+|holin	holin	holin	B6SD41	Bacteriophage	68.4	2.2e-17
WP_011410800.1|1540749_1541226_+	lysozyme	NA	B6SD42	Bacteriophage	70.3	2.1e-59
WP_148203425.1|1541914_1542091_+	DUF2824 family protein	NA	Q2A0B3	Sodalis_phage	87.9	2.1e-20
WP_041866769.1|1542074_1542752_+	hypothetical protein	NA	Q2A0B2	Sodalis_phage	95.0	9.7e-90
>prophage 9
NC_007712	Sodalis glossinidius str. 'morsitans', complete genome	4171146	1669334	1720106	4171146	tail,protease,tRNA,holin	Phage_GMSE-1(16.67%)	30	NA	NA
WP_011410872.1|1669334_1669949_+|tail	phage tail protein I	tail	F1BUP2	Erwinia_phage	56.5	7.8e-62
WP_041866793.1|1671461_1671887_+|tail	tail fiber assembly protein	tail	Q9B026	Phage_GMSE-1	100.0	1.1e-78
WP_011410873.1|1671873_1672449_+	DNA adenine methylase	NA	Q9B025	Phage_GMSE-1	100.0	4.5e-64
WP_148203436.1|1672820_1673459_-	hypothetical protein	NA	A0A0M4R2V3	Salmonella_phage	31.8	2.4e-13
WP_041866617.1|1673722_1674616_-|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	33.3	2.6e-13
WP_148203359.1|1677211_1677439_+	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_011410875.1|1677676_1679077_-|tRNA	asparagine--tRNA ligase	tRNA	A0A167RLM0	Powai_lake_megavirus	33.1	1.8e-74
WP_041866795.1|1679310_1680534_-	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_011410877.1|1680825_1683444_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.3	5.4e-19
WP_011410878.1|1683727_1684738_+	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_011410880.1|1686704_1688846_+	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
WP_011410881.1|1688836_1690759_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	27.3	1.8e-48
WP_011410882.1|1690827_1692096_+	membrane integrity-associated transporter subunit PqiA	NA	NA	NA	NA	NA
WP_011410883.1|1692092_1693733_+	intermembrane transport protein PqiB	NA	NA	NA	NA	NA
WP_011410884.1|1693729_1694398_+	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_011410886.1|1694928_1695447_-	bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase	NA	NA	NA	NA	NA
WP_011410887.1|1695512_1697264_-|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_011410888.1|1697470_1697929_+	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_041866797.1|1698214_1698454_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041866798.1|1698676_1698997_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011410890.1|1702505_1703576_-	porin OmpA	NA	NA	NA	NA	NA
WP_011410891.1|1707814_1709869_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	26.0	2.2e-20
WP_011410892.1|1709940_1710402_-	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_158302360.1|1710497_1711088_-	DUF2057 family protein	NA	NA	NA	NA	NA
WP_011410894.1|1711890_1712208_-	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_011410896.1|1714054_1714714_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	53.2	2.7e-44
WP_011410897.1|1714863_1715190_+	TusE/DsrC/DsvC family sulfur relay protein	NA	NA	NA	NA	NA
WP_011410898.1|1715482_1715683_-	acylphosphatase	NA	NA	NA	NA	NA
WP_083764709.1|1718673_1719186_+	hypothetical protein	NA	B6SD57	Bacteriophage	55.9	2.0e-50
WP_148203653.1|1719914_1720106_+|holin	holin	holin	B6SD41	Bacteriophage	67.2	3.1e-17
>prophage 10
NC_007712	Sodalis glossinidius str. 'morsitans', complete genome	4171146	1793943	1823478	4171146	integrase,tail,protease,tRNA	Enterobacteria_phage(28.57%)	32	1780376:1780393	1807407:1807424
1780376:1780393	attL	CGCTCCTTGTGGCGCACG	NA	NA	NA	NA
WP_011410945.1|1793943_1795053_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_158302365.1|1795233_1795389_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011410946.1|1795385_1795682_-	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_083764713.1|1796850_1797090_-|integrase	tyrosine-type recombinase/integrase	integrase	K7PHK0	Enterobacteria_phage	57.9	3.7e-12
WP_011410947.1|1797143_1797914_-|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	Q9MCR4	Enterobacteria_phage	47.1	6.5e-58
WP_083764714.1|1797891_1798131_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041866812.1|1798275_1798548_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158302366.1|1798565_1798739_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148203656.1|1798818_1799196_-	single-stranded DNA-binding protein	NA	A0A1W6JNW8	Morganella_phage	53.6	1.8e-29
WP_050747541.1|1799738_1800026_-	hypothetical protein	NA	F1C5A3	Cronobacter_phage	50.0	5.3e-13
WP_050747542.1|1800039_1800393_-	hypothetical protein	NA	A0A1P8DTE1	Proteus_phage	51.9	3.5e-14
WP_011410949.1|1800686_1801337_+	hypothetical protein	NA	Q3LZQ4	Bacteriophage	84.2	1.4e-16
WP_148203443.1|1801339_1801576_-	DUF1374 domain-containing protein	NA	NA	NA	NA	NA
WP_041866814.1|1801572_1801776_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083764715.1|1802594_1803653_-	AIPR family protein	NA	NA	NA	NA	NA
WP_041867463.1|1805357_1805765_-	hypothetical protein	NA	K7PK07	Enterobacteria_phage	74.0	7.7e-26
WP_173340369.1|1806312_1806717_+|tail	phage minor tail protein L	tail	M9NYX1	Enterobacteria_phage	67.4	1.2e-47
WP_011410950.1|1807429_1808026_+|tail	tail assembly protein	tail	K7PH59	Enterobacterial_phage	51.2	1.1e-52
1807407:1807424	attR	CGTGCGCCACAAGGAGCG	NA	NA	NA	NA
WP_158302367.1|1810293_1810758_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041866817.1|1810829_1811210_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148203657.1|1811158_1811353_+	outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_158302368.1|1811574_1811829_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148203446.1|1812102_1812621_+|tail	tail fiber domain-containing protein	tail	I6XHA6	Vibriophage	41.4	6.6e-14
WP_011410952.1|1813204_1813984_-	hypothetical protein	NA	B6SD57	Bacteriophage	39.7	1.1e-52
WP_148203447.1|1814163_1814403_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011410953.1|1814431_1815100_-	arginine ABC transporter permease ArtM	NA	NA	NA	NA	NA
WP_011410954.1|1815099_1815816_-	arginine ABC transporter permease ArtQ	NA	NA	NA	NA	NA
WP_011410955.1|1815825_1816557_-	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_011410956.1|1816579_1817308_-	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	37.4	1.0e-28
WP_011410957.1|1817453_1818095_-	lipoprotein	NA	NA	NA	NA	NA
WP_011410735.1|1822617_1822839_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	1.2e-17
WP_011410736.1|1823157_1823478_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	50.6	1.4e-14
>prophage 11
NC_007712	Sodalis glossinidius str. 'morsitans', complete genome	4171146	1904224	2023066	4171146	terminase,integrase,plate,transposase,holin,head,tail	Bacteriophage(19.35%)	119	1936652:1936678	1988012:1988038
WP_011410980.1|1904224_1904638_+	recombination protein NinB	NA	G8C7V3	Escherichia_phage	63.9	1.6e-39
WP_158302370.1|1904594_1904762_+	NinE family protein	NA	NA	NA	NA	NA
WP_041866837.1|1904784_1905162_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A1V0E5J0	Salmonella_phage	37.5	2.8e-14
WP_041866838.1|1905158_1905497_+	hypothetical protein	NA	NA	NA	NA	NA
WP_173340370.1|1905939_1906128_+|holin	holin	holin	B6SD41	Bacteriophage	69.0	1.0e-17
WP_166506342.1|1907307_1907571_+	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	65.9	4.2e-25
WP_166506343.1|1907567_1907948_+	hypothetical protein	NA	A0A2H4J159	uncultured_Caudovirales_phage	38.9	5.4e-05
WP_011409960.1|1907847_1909074_+|plate	baseplate J/gp47 family protein	plate	A0A0M4RD32	Salmonella_phage	53.7	2.2e-108
WP_011409961.1|1909070_1909724_+	DUF2612 domain-containing protein	NA	A9YX13	Burkholderia_phage	43.7	1.2e-49
WP_148203317.1|1911080_1911521_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409963.1|1911949_1912873_+|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	68.1	7.2e-120
WP_011410981.1|1914957_1915704_-	glycosyltransferase family 25 protein	NA	NA	NA	NA	NA
WP_041866841.1|1917048_1917249_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158302371.1|1917577_1917742_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041866842.1|1917729_1917915_-	DUF1090 family protein	NA	NA	NA	NA	NA
WP_148203660.1|1922107_1922194_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011410983.1|1922358_1922520_+	YqaE/Pmp3 family membrane protein	NA	NA	NA	NA	NA
WP_041867474.1|1922864_1923164_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011410985.1|1923470_1924520_+	FAD:protein FMN transferase ApbE	NA	NA	NA	NA	NA
WP_011410986.1|1924621_1925002_+	DUF305 domain-containing protein	NA	A0A218MND9	uncultured_virus	49.1	3.5e-20
WP_041866843.1|1931645_1931852_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_041866844.1|1933484_1933793_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050747556.1|1935928_1936534_-	KilA-N domain-containing protein	NA	B6SD58	Bacteriophage	49.0	4.5e-54
WP_011410988.1|1936651_1937059_+	hypothetical protein	NA	Q3LZQ4	Bacteriophage	90.2	1.7e-20
1936652:1936678	attL	ATGGGCCAAGTCGCATTTGATACATTG	NA	NA	NA	NA
WP_041866846.1|1937235_1937472_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158302372.1|1937851_1938058_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011410989.1|1938106_1938394_-	VRR-NUC domain-containing protein	NA	Q3LZN4	Bacteriophage	68.0	5.8e-12
WP_041866496.1|1938377_1938557_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041866849.1|1941839_1942154_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148203462.1|1942183_1942588_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158302317.1|1942669_1942819_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011410990.1|1944046_1944358_+	helix-turn-helix transcriptional regulator	NA	A0A220NRR8	Escherichia_phage	55.9	1.3e-12
WP_011410991.1|1944369_1945014_+	bifunctional DNA primase/polymerase	NA	A0A2H4PRF8	Proteus_phage	29.7	1.3e-06
WP_050747559.1|1946236_1946428_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041866852.1|1946442_1946856_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158302373.1|1948178_1948343_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050747560.1|1948698_1949040_+|holin	phage holin, lambda family	holin	NA	NA	NA	NA
WP_011410992.1|1949039_1949477_+	lysozyme	NA	B6SD02	Bacteriophage	67.4	3.5e-48
WP_011410993.1|1949686_1950076_+	hypothetical protein	NA	B6SD43	Bacteriophage	69.8	3.8e-38
WP_041866853.1|1949969_1950212_+	hypothetical protein	NA	B6SCZ0	Bacteriophage	85.3	1.1e-30
WP_041866854.1|1950304_1950613_+	hypothetical protein	NA	Q716H4	Shigella_phage	54.3	2.4e-19
WP_050747561.1|1951726_1952008_-	antA/AntB antirepressor family protein	NA	A0A0R6PJV6	Moraxella_phage	47.3	3.6e-14
WP_050747562.1|1953203_1953506_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083764721.1|1953721_1953874_-	ORF6N domain-containing protein	NA	F1C5A3	Cronobacter_phage	64.6	2.6e-11
WP_011410994.1|1954054_1954369_+	hypothetical protein	NA	Q3LZN5	Bacteriophage	60.7	1.7e-20
WP_011410996.1|1956107_1956554_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011410997.1|1956524_1956833_-	VRR-NUC domain-containing protein	NA	Q3LZN4	Bacteriophage	68.0	6.3e-12
WP_041866496.1|1956816_1956996_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148203320.1|1958295_1958547_-	helix-turn-helix transcriptional regulator	NA	B6SCU0	Bacteriophage	74.0	5.4e-22
WP_011410998.1|1960552_1961101_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041866855.1|1961127_1961676_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011410999.1|1964545_1965259_-	PAS domain-containing protein	NA	NA	NA	NA	NA
WP_041866857.1|1967645_1967888_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011411000.1|1968083_1969007_+|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	67.4	6.1e-119
WP_041866858.1|1969046_1969244_-	DUF2594 family protein	NA	NA	NA	NA	NA
WP_011411001.1|1969909_1970566_+	UvrY/SirA/GacA family response regulator transcription factor	NA	NA	NA	NA	NA
WP_011411002.1|1970558_1972391_+	excinuclease ABC subunit UvrC	NA	NA	NA	NA	NA
WP_011411003.1|1972456_1973005_+	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_011411004.1|1974023_1975040_-|integrase	tyrosine-type recombinase/integrase	integrase	H9C152	Pectobacterium_phage	67.2	2.5e-137
WP_083764723.1|1975049_1975274_-	DUF4224 domain-containing protein	NA	H9C153	Pectobacterium_phage	40.6	3.6e-09
WP_011411005.1|1975398_1976067_-	helix-turn-helix transcriptional regulator	NA	Q2A088	Sodalis_phage	75.5	3.2e-93
WP_041866859.1|1976063_1976321_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041866860.1|1976317_1976698_-	DUF551 domain-containing protein	NA	NA	NA	NA	NA
WP_041866861.1|1976694_1976955_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041866862.1|1976970_1977261_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011411006.1|1977353_1978367_-	recombination protein RecT	NA	Q858E1	Salmonella_phage	73.2	4.9e-138
WP_011411007.1|1978376_1979273_-	YqaJ viral recombinase family protein	NA	Q858E0	Salmonella_phage	65.8	5.4e-112
WP_148203465.1|1979272_1979656_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041866864.1|1979830_1980040_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148203466.1|1980127_1980568_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041867482.1|1981045_1981438_-	helix-turn-helix domain-containing protein	NA	H6WRX4	Salmonella_phage	38.5	2.7e-15
WP_083764724.1|1981562_1981835_+	helix-turn-helix domain-containing protein	NA	H6WRX5	Salmonella_phage	57.7	8.5e-21
WP_041866865.1|1981818_1982250_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011411009.1|1982310_1983426_+	hypothetical protein	NA	A0A0D4DBT2	Acinetobacter_phage	62.9	2.4e-45
WP_011411010.1|1983725_1984373_+	phage replication protein	NA	A0A2H4J1B6	uncultured_Caudovirales_phage	46.9	7.2e-42
WP_041866867.1|1984369_1984630_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041866868.1|1984632_1984989_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011411011.1|1984957_1985491_+	phage N-6-adenine-methyltransferase	NA	Q9MCP3	Enterobacteria_phage	60.5	4.4e-53
WP_011411013.1|1986310_1986679_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A1C9IIA0	Salmonella_phage	59.2	8.0e-38
WP_041866869.1|1986712_1986916_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011411014.1|1987009_1987606_+	hypothetical protein	NA	G9L666	Escherichia_phage	49.5	4.7e-48
WP_011411015.1|1987642_1988038_-	hypothetical protein	NA	Q3LZN5	Bacteriophage	48.9	2.1e-20
1988012:1988038	attR	CAATGTATCAAATGCGACTTGGCCCAT	NA	NA	NA	NA
WP_025246086.1|1988329_1988596_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041866870.1|1988687_1989113_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041866871.1|1989123_1989372_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011411017.1|1989375_1991001_+|head,tail	head-tail connector protein	head,tail	A0A2H4J3N6	uncultured_Caudovirales_phage	57.4	8.7e-169
WP_041866872.1|1990997_1991225_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050747565.1|1991214_1991490_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011411018.1|1991502_1992318_+	hypothetical protein	NA	A0A2H4JEQ5	uncultured_Caudovirales_phage	39.2	9.7e-44
WP_041866873.1|1992524_1993436_+	hypothetical protein	NA	A0A2H4JC66	uncultured_Caudovirales_phage	39.0	1.4e-43
WP_011411020.1|1993490_1994054_+	hypothetical protein	NA	A0A2H4JCY7	uncultured_Caudovirales_phage	47.6	3.5e-45
WP_011411021.1|1994055_1996044_+	hypothetical protein	NA	A0A2H4J6H2	uncultured_Caudovirales_phage	48.3	3.3e-186
WP_011411022.1|1996046_1996496_+	GNAT family N-acetyltransferase	NA	A0A2H4J9Z5	uncultured_Caudovirales_phage	40.9	6.8e-23
WP_041866874.1|1996497_1997010_+	hypothetical protein	NA	A0A2H4J679	uncultured_Caudovirales_phage	51.2	1.8e-08
WP_011411024.1|1997009_1999541_+	hypothetical protein	NA	A0A193GYI3	Enterobacter_phage	44.5	5.1e-176
WP_011411025.1|1999537_2001010_+	hypothetical protein	NA	A0A0F6TJQ3	Escherichia_coli_O157_typing_phage	49.0	8.6e-91
WP_011411026.1|2001011_2003486_+	hypothetical protein	NA	A0A193GZ61	Enterobacter_phage	71.8	0.0e+00
WP_041866875.1|2003564_2003906_+	hypothetical protein	NA	A0A2H4J7H0	uncultured_Caudovirales_phage	50.0	1.2e-19
WP_011411027.1|2003902_2005513_+|terminase	phage terminase large subunit	terminase	A0A2H4JCA3	uncultured_Caudovirales_phage	68.9	5.7e-221
WP_041866876.1|2005528_2007634_+	hypothetical protein	NA	A0A2H4YD81	Klebsiella_virus	42.3	3.1e-94
WP_011411028.1|2007641_2008721_-	acyltransferase	NA	NA	NA	NA	NA
WP_011411029.1|2008959_2009166_+|holin	class II holin family protein	holin	A5LH82	Enterobacteria_phage	63.6	3.9e-18
WP_011411030.1|2009169_2009697_+	lysozyme	NA	H9C184	Pectobacterium_phage	76.6	1.8e-75
WP_041866877.1|2009693_2010047_+	hypothetical protein	NA	R9TPM9	Aeromonas_phage	46.0	1.8e-15
WP_041866878.1|2010829_2011072_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011411806.1|2011290_2011509_-	ogr/Delta-like zinc finger family protein	NA	Q53ZE7	Salmonella_virus	61.1	4.9e-19
WP_011411031.1|2012661_2013126_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	65.6	1.7e-45
WP_041866879.1|2013132_2013870_-	hypothetical protein	NA	A0A1S6L010	Salmonella_phage	56.1	1.3e-26
WP_041866880.1|2013869_2014106_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041866881.1|2014107_2014329_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011411032.1|2014325_2014835_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158302374.1|2014903_2015056_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083764725.1|2015541_2015985_-|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	54.1	7.3e-38
WP_050747566.1|2015950_2016181_-	hypothetical protein	NA	A0A2H4JCP8	uncultured_Caudovirales_phage	50.0	1.6e-15
WP_083765094.1|2019461_2019830_-	phage virion morphogenesis protein	NA	A0A1S5NPT5	Burkholderia_phage	52.1	3.5e-25
WP_011411035.1|2019864_2020242_-|tail	phage tail protein	tail	F1BUP9	Erwinia_phage	62.5	9.0e-29
WP_158302375.1|2020305_2020461_-	hypothetical protein	NA	B6SCZ0	Bacteriophage	76.9	1.9e-09
WP_083764726.1|2020926_2022195_-	DUF3472 domain-containing protein	NA	NA	NA	NA	NA
WP_011411038.1|2022334_2023066_-|head	head completion/stabilization protein	head	F1BUQ7	Erwinia_phage	47.5	8.7e-36
>prophage 12
NC_007712	Sodalis glossinidius str. 'morsitans', complete genome	4171146	2037591	2048935	4171146	terminase,holin	Bacteriophage(25.0%)	15	NA	NA
WP_070108753.1|2037591_2038245_-	helix-turn-helix domain-containing protein	NA	K7PLZ5	Enterobacterial_phage	36.1	4.6e-36
WP_083764728.1|2038366_2038618_+	hypothetical protein	NA	K7PHB1	Enterobacterial_phage	48.4	5.8e-08
WP_011411042.1|2039027_2040014_+	hypothetical protein	NA	G9L6A8	Escherichia_phage	50.2	1.7e-55
WP_148203663.1|2040021_2040459_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	39.7	8.6e-23
WP_083764732.1|2041028_2041448_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158302373.1|2041835_2042000_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050747560.1|2042355_2042697_+|holin	phage holin, lambda family	holin	NA	NA	NA	NA
WP_011410992.1|2042696_2043134_+	lysozyme	NA	B6SD02	Bacteriophage	67.4	3.5e-48
WP_011410993.1|2043343_2043733_+	hypothetical protein	NA	B6SD43	Bacteriophage	69.8	3.8e-38
WP_041866894.1|2043626_2043869_+	hypothetical protein	NA	B6SCZ0	Bacteriophage	83.3	2.8e-31
WP_011411045.1|2043920_2044445_+|terminase	terminase small subunit	terminase	A0A2H4J480	uncultured_Caudovirales_phage	59.5	1.4e-51
WP_050747574.1|2046680_2046992_+	hypothetical protein	NA	K4HYQ5	Acinetobacter_phage	46.4	1.3e-09
WP_011411046.1|2046991_2048020_+	hypothetical protein	NA	Q8HAP7	Burkholderia_phage	47.6	2.5e-81
WP_041867495.1|2048023_2048368_+	hypothetical protein	NA	H9C0V9	Aeromonas_phage	34.9	1.4e-07
WP_011411048.1|2048371_2048935_+	DUF4054 domain-containing protein	NA	K4HYQ8	Acinetobacter_phage	41.8	1.2e-11
>prophage 13
NC_007712	Sodalis glossinidius str. 'morsitans', complete genome	4171146	2064565	2081748	4171146	holin	Enterobacteria_phage(33.33%)	17	NA	NA
WP_011411055.1|2064565_2064982_+	hypothetical protein	NA	Q3LZN5	Bacteriophage	75.0	3.1e-14
WP_011411056.1|2067698_2068085_-	hypothetical protein	NA	Q9B030	Phage_GMSE-1	72.4	3.2e-45
WP_011411057.1|2068571_2069294_-	LexA family transcriptional regulator	NA	A4KWV9	Enterobacteria_phage	55.7	1.5e-72
WP_041866907.1|2069399_2069588_+	Cro/Cl family transcriptional regulator	NA	K7PLQ6	Enterobacteria_phage	74.2	6.1e-18
WP_041866908.1|2069743_2070028_+	hypothetical protein	NA	A0A088CBI6	Shigella_phage	40.5	6.2e-06
WP_050747504.1|2070415_2070724_+	hypothetical protein	NA	G9L680	Escherichia_phage	47.1	1.1e-13
WP_011410799.1|2072153_2072591_+	recombination protein NinB	NA	G8C7V3	Escherichia_phage	66.4	1.8e-49
WP_041867442.1|2073290_2073752_+	hypothetical protein	NA	C6ZR60	Salmonella_phage	75.7	1.9e-65
WP_158302357.1|2073748_2073907_+	hypothetical protein	NA	A0A219UQU1	Bacillus_phage	44.0	3.8e-05
WP_083764738.1|2074571_2074787_-	hypothetical protein	NA	NA	NA	NA	NA
WP_173340371.1|2074945_2075128_+|holin	holin	holin	B6SD41	Bacteriophage	72.4	3.1e-19
WP_148203468.1|2076067_2076280_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041866910.1|2076493_2076862_+	hypothetical protein	NA	B6SCY9	Bacteriophage	63.1	5.2e-29
WP_083764740.1|2076755_2077019_+	hypothetical protein	NA	B6SCZ0	Bacteriophage	72.8	5.0e-26
WP_011411061.1|2077310_2077850_+	DUF1441 family protein	NA	A5LH26	Enterobacteria_phage	61.0	4.0e-46
WP_041867503.1|2079927_2080140_+	hypothetical protein	NA	A5LH28	Enterobacteria_phage	56.2	4.5e-09
WP_041866912.1|2080785_2081748_+	DUF1983 domain-containing protein	NA	Q5G8W0	Enterobacteria_phage	38.7	1.0e-52
>prophage 14
NC_007712	Sodalis glossinidius str. 'morsitans', complete genome	4171146	2249861	2257031	4171146	tail	Edwardsiella_phage(62.5%)	12	NA	NA
WP_011411180.1|2249861_2250191_+	hypothetical protein	NA	A0A077KC03	Edwardsiella_phage	53.4	6.1e-21
WP_148203478.1|2250786_2250975_+	transcription elongation factor GreA	NA	NA	NA	NA	NA
WP_011411181.1|2250961_2252032_+	hypothetical protein	NA	A0A077KC92	Edwardsiella_phage	31.2	2.3e-29
WP_011411182.1|2252076_2252787_+	hypothetical protein	NA	T1SBJ1	Salmonella_phage	48.1	3.4e-21
WP_011411183.1|2252797_2253592_+	hypothetical protein	NA	A0A077KGW3	Edwardsiella_phage	47.3	9.4e-44
WP_158302381.1|2253591_2253738_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041866938.1|2253730_2254060_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050747600.1|2254022_2254319_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050747601.1|2254275_2254713_+	hypothetical protein	NA	A0A077KAY0	Edwardsiella_phage	45.8	5.6e-30
WP_041866939.1|2254715_2255075_+	hypothetical protein	NA	B7X9X8	uncultured_phage	32.2	1.7e-08
WP_011411185.1|2255071_2255545_+	hypothetical protein	NA	A0A077KGW9	Edwardsiella_phage	56.9	1.2e-09
WP_011411186.1|2256134_2257031_+|tail	tail fiber protein	tail	H9C0Y2	Aeromonas_phage	41.3	1.2e-15
>prophage 15
NC_007712	Sodalis glossinidius str. 'morsitans', complete genome	4171146	2306694	2313356	4171146	capsid	uncultured_Caudovirales_phage(42.86%)	9	NA	NA
WP_011411210.1|2306694_2307357_+|capsid	minor capsid protein	capsid	A0A2H4J8F5	uncultured_Caudovirales_phage	54.2	5.4e-61
WP_050747606.1|2307360_2307786_+	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	58.6	1.2e-24
WP_050747607.1|2307829_2308228_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148203485.1|2308184_2308565_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011411211.1|2308510_2309008_+	hypothetical protein	NA	A0A0P0I8F3	Acinetobacter_phage	37.4	1.7e-19
WP_011411212.1|2310343_2310784_+	DUF3277 family protein	NA	A0A2H4J619	uncultured_Caudovirales_phage	79.5	6.8e-60
WP_011411213.1|2311475_2312057_+	hypothetical protein	NA	A0A0M3ULD5	Salmonella_phage	63.4	6.4e-58
WP_041866951.1|2312043_2312343_+	hypothetical protein	NA	A0A0M4R5B7	Salmonella_phage	50.5	2.7e-20
WP_011411214.1|2312375_2313356_+	hypothetical protein	NA	A0A2H4J1B2	uncultured_Caudovirales_phage	47.6	7.2e-94
>prophage 16
NC_007712	Sodalis glossinidius str. 'morsitans', complete genome	4171146	2654116	2681335	4171146	tail,terminase,plate,holin	Bacteriophage(30.43%)	30	NA	NA
WP_011411374.1|2654116_2655157_-	DUF2213 domain-containing protein	NA	E5AGA6	Erwinia_phage	38.5	8.5e-53
WP_050747693.1|2655318_2656032_-	hypothetical protein	NA	M4T3R2	Psychrobacter_phage	34.2	7.0e-14
WP_011411376.1|2656024_2656747_-|terminase	PBSX family phage terminase large subunit	terminase	A0A191ZDJ9	Acinetobacter_phage	68.5	2.4e-78
WP_011411377.1|2656739_2657132_-	hypothetical protein	NA	B6SD20	Bacteriophage	73.1	7.9e-44
WP_083764824.1|2657109_2657370_-	hypothetical protein	NA	B6SCZ0	Bacteriophage	78.9	2.4e-28
WP_041867026.1|2657263_2657650_-	hypothetical protein	NA	B6SD03	Bacteriophage	63.5	8.1e-33
WP_041867577.1|2659144_2659723_-	lytic polysaccharide monooxygenase	NA	A0A0K1Y848	Apis_mellifera_filamentous_virus	32.6	1.4e-12
WP_011411379.1|2660231_2660717_-	lysozyme	NA	B6SD42	Bacteriophage	70.6	1.3e-59
WP_041867027.1|2660713_2660893_-|holin	holin	holin	B6SD41	Bacteriophage	67.2	3.4e-18
WP_083764826.1|2661057_2661273_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041867028.1|2662327_2662606_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041867029.1|2662623_2662827_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011411380.1|2663340_2663742_-	DUF1640 domain-containing protein	NA	Q3LZN5	Bacteriophage	78.0	4.5e-18
WP_011411381.1|2666250_2666565_+	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	57.4	2.3e-22
WP_148203520.1|2666557_2666806_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041867580.1|2666965_2667187_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_011411382.1|2667183_2667567_+	type II toxin-antitoxin system death-on-curing family toxin	NA	A0A222YZ88	Escherichia_phage	54.1	2.5e-26
WP_173340362.1|2667836_2668154_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011411384.1|2673330_2674230_+|plate	baseplate J/gp47 family protein	plate	A0A0A7NPY5	Enterobacteria_phage	64.2	1.2e-95
WP_083764828.1|2674683_2674968_+|tail	phage tail protein	tail	Q9B027	Phage_GMSE-1	89.8	4.1e-26
WP_011411385.1|2675028_2675466_+|tail	tail fiber assembly protein	tail	B6SCW7	Bacteriophage	45.2	5.4e-25
WP_166506704.1|2676296_2676812_-	hypothetical protein	NA	A0A0A7NRZ9	Enterobacteria_phage	47.4	1.2e-28
WP_166506705.1|2676921_2677422_-	hypothetical protein	NA	A0A0A7NRZ9	Enterobacteria_phage	54.6	1.7e-30
WP_166506322.1|2677442_2677649_-	hypothetical protein	NA	B9A7B3	Serratia_phage	66.7	1.1e-12
WP_166506706.1|2677662_2678580_-|tail	phage tail tape measure protein	tail	B9A7B3	Serratia_phage	74.8	2.7e-87
WP_166506707.1|2678604_2678844_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166506908.1|2678998_2679220_-|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	64.1	1.5e-07
WP_011411387.1|2679189_2679507_-|tail	tail protein	tail	B9A7B2	Serratia_phage	59.6	1.4e-22
WP_011411388.1|2679554_2680070_-|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	59.4	5.5e-53
WP_050747698.1|2681005_2681335_+	hypothetical protein	NA	B9A7A9	Serratia_phage	52.2	3.5e-21
>prophage 17
NC_007712	Sodalis glossinidius str. 'morsitans', complete genome	4171146	2774910	2838925	4171146	integrase,tRNA,plate,transposase,holin,tail	Salmonella_phage(25.0%)	58	2781666:2781681	2803970:2803985
WP_041867589.1|2774910_2775699_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_011411448.1|2775764_2776778_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_011411449.1|2776921_2778055_-	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	28.5	3.2e-13
WP_011411450.1|2778346_2779276_+	flagella biosynthesis regulator Flk	NA	NA	NA	NA	NA
WP_011411451.1|2780069_2781281_-	beta-ketoacyl-ACP synthase I	NA	NA	NA	NA	NA
2781666:2781681	attL	GGCATGCCTTTGATAC	NA	NA	NA	NA
WP_166506910.1|2782514_2783216_+	FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	NA	NA	NA	NA	NA
WP_011411452.1|2783407_2783683_-	YfcL family protein	NA	NA	NA	NA	NA
WP_011411453.1|2783710_2784265_-	elongation factor P hydroxylase	NA	NA	NA	NA	NA
WP_011411455.1|2785919_2787005_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	46.8	8.5e-88
WP_011411456.1|2787073_2788006_-	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_011411458.1|2788949_2789426_-	phosphohistidine phosphatase SixA	NA	NA	NA	NA	NA
WP_011411459.1|2789798_2790095_-	YfcZ/YiiS family protein	NA	NA	NA	NA	NA
WP_011411460.1|2790554_2791313_-	phospholipid-binding lipoprotein MlaA	NA	NA	NA	NA	NA
WP_083764832.1|2792518_2792872_-	cytochrome c-type biogenesis protein CcmH	NA	NA	NA	NA	NA
WP_011411463.1|2795219_2795456_-	heme exporter protein CcmD	NA	NA	NA	NA	NA
WP_011411464.1|2795455_2796097_-	cytochrome c biogenesis protein CcsA	NA	NA	NA	NA	NA
WP_011411465.1|2796574_2797210_-	cytochrome c biogenesis heme-transporting ATPase CcmA	NA	NA	NA	NA	NA
WP_011411466.1|2798986_2800255_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	42.2	1.3e-74
WP_148203530.1|2800731_2801091_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050747719.1|2801664_2802141_+	DUF4065 domain-containing protein	NA	NA	NA	NA	NA
WP_158302407.1|2802723_2803134_-|tail	tail fiber domain-containing protein	tail	I6XHA6	Vibriophage	41.1	2.6e-13
WP_011411468.1|2803186_2803870_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q687E7	Enterobacteria_phage	31.7	1.3e-17
WP_011411063.1|2804029_2804731_-	hypothetical protein	NA	NA	NA	NA	NA
2803970:2803985	attR	GGCATGCCTTTGATAC	NA	NA	NA	NA
WP_011410950.1|2806594_2807191_-|tail	tail assembly protein	tail	K7PH59	Enterobacterial_phage	51.2	1.1e-52
WP_050747721.1|2807174_2807372_-	C40 family peptidase	NA	M9NZD8	Enterobacteria_phage	78.7	2.5e-22
WP_011411469.1|2807830_2808169_-	HNH endonuclease	NA	A0A2I6PIG1	Escherichia_phage	64.8	6.6e-39
WP_162010784.1|2808165_2808408_-	hypothetical protein	NA	B6SCZ0	Bacteriophage	73.1	8.7e-25
WP_011411470.1|2808413_2808863_-	lysozyme	NA	B6SD42	Bacteriophage	70.7	7.2e-57
WP_041867027.1|2808859_2809039_-|holin	holin	holin	B6SD41	Bacteriophage	67.2	3.4e-18
WP_083764826.1|2809203_2809419_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011411471.1|2809624_2810335_-	phage antiterminator Q protein	NA	NA	NA	NA	NA
WP_158302409.1|2810331_2810490_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148203532.1|2811008_2811548_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070108805.1|2814673_2815012_-	hypothetical protein	NA	A0A1B5FPL8	Escherichia_phage	57.5	5.3e-28
WP_050747725.1|2815523_2815874_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041867057.1|2815866_2816067_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158302410.1|2816059_2816608_-	ORF6N domain-containing protein	NA	H6WRU9	Salmonella_phage	40.3	5.7e-24
WP_011411474.1|2816647_2816857_-	ORF6N domain-containing protein	NA	Q9B022	Phage_GMSE-1	100.0	3.1e-31
WP_041867058.1|2816867_2817368_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083764838.1|2818428_2818725_-	ORF6N domain-containing protein	NA	Q9B022	Phage_GMSE-1	34.7	2.2e-06
WP_166506720.1|2818735_2818888_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148203533.1|2819551_2820115_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041867598.1|2820218_2820416_-	AlpA family transcriptional regulator	NA	G8DCP6	Silicibacter_phage	40.4	1.6e-05
WP_011411476.1|2821081_2821666_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041867061.1|2821680_2821992_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011411477.1|2824157_2825078_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	73.0	5.5e-128
WP_050747727.1|2825023_2825725_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011409961.1|2826947_2827601_-	DUF2612 domain-containing protein	NA	A9YX13	Burkholderia_phage	43.7	1.2e-49
WP_011411480.1|2827597_2828788_-|plate	baseplate J/gp47 family protein	plate	A0A0M4RD32	Salmonella_phage	53.7	1.3e-108
WP_011411481.1|2829841_2830822_-	hypothetical protein	NA	A0A2H4J1B2	uncultured_Caudovirales_phage	47.6	7.2e-94
WP_011411483.1|2833177_2833585_-	hypothetical protein	NA	A0A2H4J2V6	uncultured_Caudovirales_phage	56.6	2.5e-32
WP_011411484.1|2833588_2834029_-	DUF3277 family protein	NA	A0A2H4J619	uncultured_Caudovirales_phage	76.7	2.4e-57
WP_011411485.1|2834041_2835520_-	DUF3383 domain-containing protein	NA	A0A0P0I492	Acinetobacter_phage	51.1	1.0e-131
WP_011411486.1|2835523_2836087_-	hypothetical protein	NA	A0A0M4R331	Salmonella_phage	58.3	2.4e-62
WP_011411487.1|2836061_2836451_-	hypothetical protein	NA	A0A0M3ULK0	Salmonella_phage	79.8	8.4e-54
WP_011411488.1|2836437_2836986_-	hypothetical protein	NA	A0A0M4S631	Salmonella_phage	65.2	4.6e-58
WP_011411489.1|2836982_2837390_-	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	74.8	1.2e-50
WP_011411490.1|2838400_2838925_-	hypothetical protein	NA	A0A0M4QWZ6	Salmonella_phage	57.2	3.1e-43
>prophage 18
NC_007712	Sodalis glossinidius str. 'morsitans', complete genome	4171146	2842270	2907516	4171146	terminase,integrase,tRNA,holin,head,tail	uncultured_Caudovirales_phage(21.43%)	56	2875540:2875558	2907622:2907640
WP_011411492.1|2842270_2843512_-|terminase	terminase	terminase	H6WRS9	Salmonella_phage	70.4	5.8e-173
WP_011411493.1|2843504_2843909_-	hypothetical protein	NA	B6SD32	Bacteriophage	75.7	4.3e-37
WP_011411494.1|2844040_2844433_-	hypothetical protein	NA	B6SD43	Bacteriophage	66.7	3.0e-35
WP_041867064.1|2844429_2845119_-	Rha family transcriptional regulator	NA	A0A192Y918	Salmonella_phage	75.5	7.8e-95
WP_011411496.1|2845291_2845825_-	lysozyme	NA	Q71TF3	Escherichia_phage	62.5	4.4e-53
WP_041867065.1|2845814_2846006_-	hypothetical protein	NA	B6SD41	Bacteriophage	62.1	8.3e-15
WP_148203535.1|2846069_2846360_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158302411.1|2847171_2847654_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011411497.1|2850652_2850973_+	multidrug transporter	NA	NA	NA	NA	NA
WP_162010785.1|2851246_2851627_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083765126.1|2853535_2854171_+	aldo/keto reductase	NA	NA	NA	NA	NA
WP_011411500.1|2855635_2856820_+	NupC/NupG family nucleoside CNT transporter	NA	NA	NA	NA	NA
WP_011411501.1|2857118_2858540_-|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_158302412.1|2866167_2866641_+	ATP-binding cassette domain-containing protein	NA	NA	NA	NA	NA
WP_158302413.1|2866872_2867610_+	ATP-binding cassette domain-containing protein	NA	NA	NA	NA	NA
WP_070108775.1|2867816_2868158_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_070108776.1|2868191_2868701_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_041867601.1|2871154_2871298_-	DUF3820 family protein	NA	NA	NA	NA	NA
WP_011411503.1|2871308_2873345_-	NAD-dependent DNA ligase LigA	NA	A0A289ZTZ3	Serratia_phage	49.2	1.5e-138
WP_011411504.1|2873557_2874547_-	cell division protein ZipA	NA	NA	NA	NA	NA
WP_041867069.1|2874782_2875541_+	sulfate transporter CysZ	NA	NA	NA	NA	NA
2875540:2875558	attL	AAAAACTTATTTCTTAATA	NA	NA	NA	NA
WP_041867070.1|2875888_2876227_-	hypothetical protein	NA	R9TPM9	Aeromonas_phage	39.4	2.9e-10
WP_011411506.1|2876236_2876764_-	lysozyme	NA	H9C184	Pectobacterium_phage	74.9	1.4e-75
WP_011411029.1|2876767_2876974_-|holin	class II holin family protein	holin	A5LH82	Enterobacteria_phage	63.6	3.9e-18
WP_083764848.1|2877074_2877194_-|tail	tail fiber assembly protein	tail	Q2A0A8	Sodalis_phage	84.2	1.6e-11
WP_148203537.1|2877638_2877851_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041867072.1|2878211_2878817_-	hypothetical protein	NA	A0A2H4J3Z5	uncultured_Caudovirales_phage	36.4	2.2e-21
WP_041867073.1|2878832_2880383_-|terminase	phage terminase large subunit	terminase	A0A2H4JCA3	uncultured_Caudovirales_phage	64.0	5.3e-200
WP_011411509.1|2883273_2884746_-	hypothetical protein	NA	A0A0F6TJQ3	Escherichia_coli_O157_typing_phage	44.2	5.0e-83
WP_083765128.1|2884742_2885381_-	hypothetical protein	NA	T1SBJ1	Salmonella_phage	56.6	1.2e-57
WP_050747736.1|2886292_2887276_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011411510.1|2887787_2888240_-	GNAT family N-acetyltransferase	NA	A0A2H4J9Z5	uncultured_Caudovirales_phage	42.0	2.0e-22
WP_041867074.1|2889419_2889983_-	hypothetical protein	NA	A0A2H4JCY7	uncultured_Caudovirales_phage	46.3	1.3e-42
WP_041867075.1|2890037_2890949_-	hypothetical protein	NA	A0A2H4JC66	uncultured_Caudovirales_phage	39.0	1.2e-42
WP_011411513.1|2892064_2893618_-|head,tail	head-tail connector protein	head,tail	A0A2H4J3N6	uncultured_Caudovirales_phage	56.4	2.0e-167
WP_041867076.1|2893621_2893840_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041867077.1|2893850_2894279_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025246086.1|2894369_2894636_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011411515.1|2895290_2895839_+	DUF1640 domain-containing protein	NA	Q3LZN5	Bacteriophage	73.4	2.3e-17
WP_041867078.1|2896099_2896303_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011411516.1|2896329_2896704_-	RusA family crossover junction endodeoxyribonuclease	NA	K7PKN5	Enterobacterial_phage	54.5	3.8e-35
WP_083764850.1|2896700_2897141_-	Rha family transcriptional regulator	NA	S5MQL6	Escherichia_phage	50.0	2.0e-11
WP_158302414.1|2897125_2897563_-	ash family protein	NA	A0A0P0ZG86	Escherichia_phage	43.7	3.3e-06
WP_011411517.1|2897574_2898336_-	hypothetical protein	NA	A0A0P0ZDC0	Stx2-converting_phage	54.2	4.3e-62
WP_011411518.1|2898504_2899038_-	phage N-6-adenine-methyltransferase	NA	Q9MCP3	Enterobacteria_phage	62.9	2.1e-55
WP_041867080.1|2899006_2899249_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_148203675.1|2899251_2899446_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148203539.1|2899796_2900150_-	hypothetical protein	NA	G8C7U6	Escherichia_phage	57.9	2.2e-21
WP_050747739.1|2900447_2900897_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158302415.1|2902312_2902480_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158302416.1|2902678_2902972_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011411521.1|2902971_2903847_+	phage recombination protein Bet	NA	A0A1I9KF88	Aeromonas_phage	56.8	1.6e-65
WP_041867084.1|2904657_2904861_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041867085.1|2904876_2905398_+	DUF551 domain-containing protein	NA	NA	NA	NA	NA
WP_041867087.1|2906165_2906408_+	excisionase	NA	NA	NA	NA	NA
WP_011411523.1|2906391_2907516_+|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	Q77Z02	Phage_21	53.0	1.9e-114
2907622:2907640	attR	AAAAACTTATTTCTTAATA	NA	NA	NA	NA
>prophage 19
NC_007712	Sodalis glossinidius str. 'morsitans', complete genome	4171146	3071115	3109786	4171146	integrase,plate,holin,transposase,capsid,tail	Salmonella_phage(26.47%)	48	3072001:3072027	3109893:3109919
WP_011411628.1|3071115_3071598_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	47.4	2.0e-28
3072001:3072027	attL	CGGGTTCAAATCCCGCCAGCTCCACCA	NA	NA	NA	NA
WP_011411629.1|3072574_3073552_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	79.0	9.9e-120
WP_083764863.1|3073647_3073977_+	acyltransferase	NA	A0A2H4JA46	uncultured_Caudovirales_phage	44.9	2.0e-11
WP_041867110.1|3074409_3074733_+	acyltransferase	NA	NA	NA	NA	NA
WP_011411630.1|3074970_3075399_-|tail	tail fiber assembly protein	tail	U5P083	Shigella_phage	49.3	1.3e-26
WP_050747761.1|3075411_3076065_-	hypothetical protein	NA	A0A1B0V7G4	Salmonella_phage	35.4	5.4e-21
WP_011409961.1|3076495_3077149_-	DUF2612 domain-containing protein	NA	A9YX13	Burkholderia_phage	43.7	1.2e-49
WP_011411480.1|3077145_3078336_-|plate	baseplate J/gp47 family protein	plate	A0A0M4RD32	Salmonella_phage	53.7	1.3e-108
WP_011411481.1|3079389_3080370_-	hypothetical protein	NA	A0A2H4J1B2	uncultured_Caudovirales_phage	47.6	7.2e-94
WP_011411632.1|3082631_3083030_-	hypothetical protein	NA	A0A0M3ULK0	Salmonella_phage	81.0	2.9e-49
WP_011411633.1|3083016_3083565_-	hypothetical protein	NA	A0A0M4S631	Salmonella_phage	69.1	2.0e-61
WP_148203550.1|3083561_3083966_-	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	68.1	1.9e-45
WP_011411635.1|3083981_3084935_-	DUF2184 domain-containing protein	NA	A0A2H4J191	uncultured_Caudovirales_phage	52.6	9.5e-91
WP_011411636.1|3084949_3085447_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011411637.1|3085443_3086685_-	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	46.9	7.2e-91
WP_011411638.1|3086687_3087350_-|capsid	minor capsid protein	capsid	A0A2H4J8F5	uncultured_Caudovirales_phage	55.6	1.3e-62
WP_011411639.1|3087351_3088776_-	DUF1073 domain-containing protein	NA	A0A0M4S6U1	Salmonella_phage	59.1	8.1e-163
WP_011411641.1|3090132_3090531_-	hypothetical protein	NA	B6SCV4	Bacteriophage	66.7	1.7e-38
WP_011411494.1|3090662_3091055_-	hypothetical protein	NA	B6SD43	Bacteriophage	66.7	3.0e-35
WP_041867064.1|3091051_3091741_-	Rha family transcriptional regulator	NA	A0A192Y918	Salmonella_phage	75.5	7.8e-95
WP_173340372.1|3092398_3092584_-|holin	holin	holin	B6SD41	Bacteriophage	69.0	3.5e-18
WP_148203551.1|3092742_3092958_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011411642.1|3093228_3094017_-	ORF6N domain-containing protein	NA	G9L689	Escherichia_phage	53.0	1.0e-42
WP_041867112.1|3094338_3094683_+	hypothetical protein	NA	Q2A0A2	Sodalis_phage	73.7	1.4e-20
WP_041867113.1|3094685_3095024_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041867114.1|3095020_3095398_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A1V0E5J0	Salmonella_phage	39.2	2.0e-15
WP_041867115.1|3095420_3095627_-	NinE family protein	NA	A0A0P0ZDL7	Stx2-converting_phage	47.4	2.6e-06
WP_011411643.1|3097842_3098304_-	helix-turn-helix domain-containing protein	NA	H9C164	Pectobacterium_phage	72.9	6.9e-39
WP_158302417.1|3098300_3098450_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041867118.1|3098486_3098771_-	hypothetical protein	NA	G8C7M0	Escherichia_phage	41.1	3.5e-09
WP_041867119.1|3098912_3099143_-	helix-turn-helix domain-containing protein	NA	A0A0N7C1T6	Escherichia_phage	52.8	1.9e-13
WP_148203552.1|3099268_3099997_+	helix-turn-helix domain-containing protein	NA	A0A0N7C1P9	Escherichia_phage	52.9	2.0e-64
WP_148203553.1|3100754_3100961_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041866683.1|3101000_3101243_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041867121.1|3101235_3101607_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166506757.1|3101659_3101827_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041867122.1|3101826_3102138_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011411645.1|3102137_3103043_+	ATP-binding protein	NA	Q7Y5X1	Haemophilus_phage	49.5	1.4e-75
WP_011411646.1|3103042_3103681_+	PD-(D/E)XK nuclease family protein	NA	Q7Y5X2	Haemophilus_phage	53.4	2.1e-57
WP_011411647.1|3103749_3104346_+	hypothetical protein	NA	G9L666	Escherichia_phage	49.5	8.1e-48
WP_011411648.1|3104499_3104832_-	hypothetical protein	NA	Q3LZQ4	Bacteriophage	75.9	1.9e-14
WP_041867123.1|3104897_3105092_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011411649.1|3105122_3105803_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050747764.1|3105870_3106071_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050747765.1|3106430_3107021_+	Rha family transcriptional regulator	NA	A0A0P0ZGC2	Escherichia_phage	47.1	2.9e-29
WP_083764867.1|3107903_3108107_+	hypothetical protein	NA	A0A286S1P6	Klebsiella_phage	49.2	1.9e-09
WP_148203554.1|3108139_3108298_+	ANR family transcriptional regulator	NA	NA	NA	NA	NA
WP_083764869.1|3108688_3109786_+|integrase	site-specific integrase	integrase	I6PDJ1	Cronobacter_phage	61.5	2.0e-132
3109893:3109919	attR	CGGGTTCAAATCCCGCCAGCTCCACCA	NA	NA	NA	NA
>prophage 20
NC_007712	Sodalis glossinidius str. 'morsitans', complete genome	4171146	3387075	3398446	4171146		Escherichia_phage(33.33%)	14	NA	NA
WP_011410980.1|3387075_3387489_-	recombination protein NinB	NA	G8C7V3	Escherichia_phage	63.9	1.6e-39
WP_158302435.1|3389560_3389701_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041867171.1|3389740_3390025_-	hypothetical protein	NA	G8C7M0	Escherichia_phage	41.1	3.5e-09
WP_011411697.1|3390498_3390969_+	helix-turn-helix transcriptional regulator	NA	A0A0U2QW76	Escherichia_phage	38.4	6.4e-16
WP_083764903.1|3391790_3392027_-	helix-turn-helix domain-containing protein	NA	A0A0M4QX15	Salmonella_phage	57.1	2.4e-19
WP_083764905.1|3392129_3392546_+	helix-turn-helix domain-containing protein	NA	K7PM35	Enterobacteria_phage	39.2	7.2e-19
WP_011411698.1|3392945_3393341_+	hypothetical protein	NA	Q9B030	Phage_GMSE-1	65.3	6.8e-35
WP_041867174.1|3393642_3393921_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041867175.1|3394138_3394396_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011411699.1|3394636_3395077_-	DUF1640 domain-containing protein	NA	Q3LZN5	Bacteriophage	75.9	7.1e-17
WP_158302436.1|3395122_3395374_+	ash family protein	NA	NA	NA	NA	NA
WP_050747808.1|3396236_3396974_+	Rha family transcriptional regulator	NA	A0A1I9SEU7	Klebsiella_phage	43.4	5.1e-36
WP_041867177.1|3397076_3397310_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011411701.1|3397660_3398446_+	KilA-N domain-containing protein	NA	B6SD53	Bacteriophage	58.4	1.0e-82
>prophage 21
NC_007712	Sodalis glossinidius str. 'morsitans', complete genome	4171146	3996436	4045498	4171146	protease,transposase,capsid,head,tail	Shigella_phage(42.86%)	37	NA	NA
WP_011412134.1|3996436_3997285_-|protease	rhomboid family intramembrane serine protease GlpG	protease	NA	NA	NA	NA
WP_011412135.1|3997577_3997901_-	thiosulfate sulfurtransferase GlpE	NA	NA	NA	NA	NA
WP_011412136.1|3998205_3999789_+	glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_011412137.1|4005062_4006169_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_011412138.1|4006372_4006966_+	YhgN family NAAT transporter	NA	NA	NA	NA	NA
WP_011412139.1|4007118_4008435_-	gluconate transporter	NA	NA	NA	NA	NA
WP_011412140.1|4008726_4009722_-	gluconate operon transcriptional repressor GntR	NA	NA	NA	NA	NA
WP_011412142.1|4010746_4011553_-	sugar/pyridoxal phosphate phosphatase YigL	NA	NA	NA	NA	NA
WP_011412144.1|4013054_4014932_-	ATP-dependent DNA helicase RecQ	NA	F2NZ48	Diadromus_pulchellus_ascovirus	40.3	3.9e-72
WP_011412145.1|4014995_4015865_-	phospholipase A	NA	NA	NA	NA	NA
WP_011412146.1|4016070_4016541_+	thioesterase family protein	NA	NA	NA	NA	NA
WP_011412147.1|4016544_4017441_+	EamA family transporter RarD	NA	NA	NA	NA	NA
WP_158302465.1|4018115_4018289_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011412148.1|4018377_4019328_-	magnesium/cobalt transporter CorA	NA	NA	NA	NA	NA
WP_011412149.1|4019656_4021819_-	DNA helicase II	NA	A7KV33	Bacillus_phage	37.1	6.0e-117
WP_011412150.1|4021897_4022608_-	5-amino-6-(5-phospho-D-ribitylamino)uracil phosphatase YigB	NA	NA	NA	NA	NA
WP_011412151.1|4022607_4023519_-	tyrosine recombinase XerC	NA	A0A1B3B212	Gordonia_phage	32.1	4.7e-15
WP_011412152.1|4023515_4024217_-	DUF484 domain-containing protein	NA	NA	NA	NA	NA
WP_011412153.1|4024213_4025038_-	diaminopimelate epimerase	NA	NA	NA	NA	NA
WP_041867712.1|4025107_4025317_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011412154.1|4025443_4027996_-	class I adenylate cyclase	NA	NA	NA	NA	NA
WP_148203486.1|4029409_4029709_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050747719.1|4030282_4030759_+	DUF4065 domain-containing protein	NA	I6R0L8	Salmonella_phage	47.1	9.4e-23
WP_011412157.1|4032808_4033297_-	YmfQ family protein	NA	A0A192Y5V3	Salmonella_phage	53.4	4.9e-51
WP_041867280.1|4036433_4037756_-	DNA circularization N-terminal domain-containing protein	NA	Q8W619	Enterobacteria_phage	51.1	9.3e-121
WP_041867281.1|4037817_4038072_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041867282.1|4038077_4038329_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050747897.1|4038497_4039505_-|tail	phage tail tape measure protein	tail	U5P420	Shigella_phage	39.5	2.3e-42
WP_050747898.1|4039520_4039883_-	hypothetical protein	NA	U5P0H3	Shigella_phage	47.5	1.3e-24
WP_050747899.1|4039858_4040233_-	hypothetical protein	NA	U5P0H3	Shigella_phage	63.3	2.8e-30
WP_041867283.1|4040229_4040475_-	DUF2635 domain-containing protein	NA	NA	NA	NA	NA
WP_011412159.1|4040474_4041023_-	hypothetical protein	NA	Q8HAC7	Salmonella_phage	50.0	1.2e-42
WP_011412160.1|4041345_4042581_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_011412161.1|4042864_4043269_-|head	phage head closure protein	head	A0A192Y6C2	Salmonella_phage	46.9	2.4e-27
WP_011412162.1|4043265_4043589_-|head,tail	phage gp6-like head-tail connector protein	head,tail	Q8SBH7	Shigella_phage	54.2	2.9e-28
WP_011412163.1|4043671_4044889_-|capsid	phage major capsid protein	capsid	Q8SBH8	Shigella_phage	68.3	4.8e-156
WP_011412164.1|4044898_4045498_-|head,protease	HK97 family phage prohead protease	head,protease	Q8SBH9	Shigella_phage	75.4	8.6e-82
