The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_006576	Synechococcus elongatus PCC 6301, complete genome	2696255	833658	909367	2696255	plate,terminase,integrase,portal,tRNA,tail,head	Acidithiobacillus_phage(16.22%)	88	860877:860936	909557:909616
WP_011377730.1|833658_834897_+|tRNA	CCA tRNA nucleotidyltransferase	tRNA	A0A219YCT8	Aeromonas_phage	39.0	9.6e-19
WP_011243059.1|835159_835588_+	RNA-binding protein	NA	NA	NA	NA	NA
WP_011243060.1|835702_836026_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011243061.1|836121_836916_+	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_011243062.1|836984_837863_-	metallophosphoesterase	NA	NA	NA	NA	NA
WP_011243063.1|837927_838794_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011243064.1|838904_840938_-	PBP1A family penicillin-binding protein	NA	NA	NA	NA	NA
WP_011243065.1|841020_841338_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011243066.1|841623_842280_+	ATP phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_011243067.1|842312_844109_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	28.5	5.1e-53
WP_011243068.1|844348_846913_+	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	37.0	1.4e-173
WP_011243069.1|846909_848283_+	serine/threonine protein kinase	NA	M1PCM5	Moumouvirus	25.8	7.7e-09
WP_155813875.1|848274_850737_-	HDIG domain-containing protein	NA	NA	NA	NA	NA
WP_041676948.1|850829_851300_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011377721.1|851329_852199_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	39.9	3.3e-34
WP_011243072.1|852241_853147_+	polyprenyl synthetase family protein	NA	NA	NA	NA	NA
WP_011243073.1|853146_853626_+	divergent PAP2 family protein	NA	NA	NA	NA	NA
WP_011243074.1|853764_854652_-	alpha/beta hydrolase	NA	E0YQD5	Mycobacterium_phage	33.3	3.9e-06
WP_041676949.1|854727_855276_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_011243076.1|855290_855884_+	chromophore lyase CpcT/CpeT	NA	NA	NA	NA	NA
WP_011243077.1|856013_857228_+	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_041676950.1|857224_858709_-	bifunctional metallophosphatase/5'-nucleotidase	NA	S4W5J5	Pandoravirus	24.7	6.5e-22
WP_011377718.1|858739_859642_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011377717.1|859689_860346_-	hypothetical protein	NA	NA	NA	NA	NA
WP_126146781.1|860420_860618_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155813880.1|860728_860905_-	hypothetical protein	NA	NA	NA	NA	NA
860877:860936	attL	GTGATGGGCAAGGTGGGACTCGAACCCACACACTATCGCTAGCGGCAGATTTTGAGTCTG	NA	NA	NA	NA
WP_011377716.1|861020_861455_-	Rho termination factor N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_039755816.1|861613_861820_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011243082.1|861830_862478_-	DNA damage-inducible protein	NA	H6U5J3	Mycobacterium_phage	50.0	7.7e-20
WP_039755818.1|862540_862819_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071818112.1|862962_863181_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_011243083.1|863272_863512_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_041677097.1|863549_863879_+	helix-turn-helix domain-containing protein	NA	A0A2H4PAP1	Aphanizomenon_phage	41.0	1.0e-07
WP_011243085.1|864306_864858_+	SocA family protein	NA	NA	NA	NA	NA
WP_011243086.1|865360_866089_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081422172.1|866446_866710_-	restriction endonuclease	NA	NA	NA	NA	NA
WP_155813882.1|866916_867414_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011243088.1|867613_868297_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011377710.1|868489_868912_-	DUF488 domain-containing protein	NA	NA	NA	NA	NA
WP_049749325.1|868913_869729_-	hypothetical protein	NA	A0A142KAR9	Gordonia_phage	29.9	2.6e-28
WP_011243089.1|870000_870465_-	chain A, D20c mutant of T4 lysozyme	NA	A0A1J0GVQ7	Pseudoalteromonas_phage	50.4	4.1e-31
WP_155813884.1|870461_870638_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039755822.1|870667_870862_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011243090.1|870861_871440_-	DUF882 domain-containing protein	NA	A0A2I7R851	Vibrio_phage	35.5	5.1e-07
WP_011243091.1|871709_873152_-	late control protein D	NA	D4HTW7	Vibrio_phage	33.7	1.4e-40
WP_011243092.1|873148_873361_-|tail	tail protein X	tail	A0A1S6KZY4	Salmonella_phage	46.7	1.1e-12
WP_011243093.1|873360_874281_-|tail	phage tail protein	tail	A0A193GYE0	Enterobacter_phage	50.8	2.6e-29
WP_011243094.1|874280_877133_-|tail	phage tail tape measure protein	tail	A0A097P6S4	Vibrio_phage	61.4	1.3e-05
WP_011377704.1|877256_877547_-|tail	phage tail assembly protein	tail	Q75QK8	Wolbachia_phage	32.4	6.3e-06
WP_011243095.1|877550_878054_-|tail	phage major tail tube protein	tail	K4I1G5	Acidithiobacillus_phage	54.8	1.2e-49
WP_011243096.1|878050_879475_-|tail	phage tail sheath subtilisin-like domain-containing protein	tail	A0A193GYC3	Enterobacter_phage	61.2	8.2e-139
WP_011243097.1|879582_880089_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011243098.1|880092_881256_-|tail	phage tail protein	tail	E5E3V2	Burkholderia_phage	50.4	1.3e-25
WP_011243099.1|881260_882712_-	hypothetical protein	NA	A0A1B2LRR4	Wolbachia_phage	36.9	1.8e-69
WP_011243100.1|882715_884731_-	DUF4815 domain-containing protein	NA	K4ICQ5	Acidithiobacillus_phage	44.1	5.7e-154
WP_011243101.1|884734_885220_-	hypothetical protein	NA	K4I002	Acidithiobacillus_phage	34.5	7.1e-26
WP_011243102.1|885318_886158_-|tail	phage tail protein	tail	K4I1F8	Acidithiobacillus_phage	39.4	1.3e-38
WP_011243103.1|886154_886994_-|plate	baseplate J/gp47 family protein	plate	K4HZB7	Acidithiobacillus_phage	48.7	2.9e-59
WP_011243104.1|886990_887335_-	GPW/gp25 family protein	NA	A0A088FV58	Escherichia_phage	58.0	8.0e-32
WP_039756023.1|887334_887586_-	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_011377697.1|887600_888161_-|plate	phage baseplate assembly protein V	plate	Q9JML8	Wolbachia_phage	33.9	2.7e-21
WP_041676952.1|888141_888384_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041676954.1|888494_889133_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011243107.1|889125_889437_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011243108.1|889442_889772_-	DUF2190 family protein	NA	A0A2I7S8N5	Vibrio_phage	39.7	4.5e-08
WP_011243109.1|889819_891694_-|head	Mu-like prophage major head subunit gpT family protein	head	B7SYD7	Stenotrophomonas_phage	32.1	8.4e-75
WP_011243110.1|891716_893180_-|portal	phage portal protein	portal	Q75QM9	Wolbachia_phage	39.9	1.5e-82
WP_011243111.1|893179_893389_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011243112.1|893516_895397_-|terminase	phage terminase large subunit family protein	terminase	A0A1B2LRQ2	Wolbachia_phage	52.1	4.3e-188
WP_011243113.1|895705_896245_-	hypothetical protein	NA	K4ICN8	Acidithiobacillus_phage	35.9	1.1e-16
WP_011243114.1|896459_897065_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011243115.1|897089_897635_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011377695.1|897904_900448_-	hypothetical protein	NA	G8EY43	Synechococcus_phage	41.5	2.8e-113
WP_011243117.1|900440_900803_-	VRR-NUC domain-containing protein	NA	A0A2I5ARE6	Synechococcus_phage	56.8	6.9e-26
WP_011243118.1|900795_902205_-	DEAD/DEAH box helicase	NA	A0A2I5ARD8	Synechococcus_phage	51.6	2.8e-115
WP_011243119.1|902423_902867_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041674884.1|903484_903733_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011243121.1|903844_904927_+	hypothetical protein	NA	J7HXB6	Pseudomonas_phage	47.3	2.8e-54
WP_011377693.1|904987_905278_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039755827.1|905280_905484_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011243122.1|905480_905819_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039755828.1|905815_906046_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011243123.1|906038_906542_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011243124.1|906538_907192_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011243125.1|907218_907743_+	2'-deoxycytidine 5'-triphosphate deaminase	NA	D6PIK2	uncultured_phage	51.2	2.4e-43
WP_041674883.1|907742_907964_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039755830.1|908129_908348_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011243126.1|908323_909367_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
909557:909616	attR	GTGATGGGCAAGGTGGGACTCGAACCCACACACTATCGCTAGCGGCAGATTTTGAGTCTG	NA	NA	NA	NA
