The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_007705	Xanthomonas oryzae pv. oryzae MAFF 311018, complete genome	4940217	7730	56302	4940217	protease,transposase	Ralstonia_phage(33.33%)	40	NA	NA
WP_011407164.1|7730_8567_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_011407165.1|8753_9560_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_011257013.1|9836_11030_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_075240306.1|11297_11855_+	energy transducer TonB	NA	NA	NA	NA	NA
WP_011257015.1|11939_12701_+	TonB-system energizer ExbB	NA	NA	NA	NA	NA
WP_010364790.1|12747_13170_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_011257016.1|13173_13587_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_011407166.1|13882_14650_-	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_019301610.1|14660_14930_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407167.1|15004_16465_-	cardiolipin synthase	NA	NA	NA	NA	NA
WP_011257020.1|17111_18122_-	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	37.8	9.5e-49
WP_011257021.1|18393_19596_-	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_011407169.1|19737_21876_+	TonB-dependent receptor	NA	A0A1B0VCF0	Salmonella_phage	40.9	5.3e-65
WP_012443560.1|22086_22380_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153296734.1|22411_22909_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407171.1|23155_24136_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	55.8	9.1e-89
WP_011257025.1|24183_25350_-	FMN-dependent L-lactate dehydrogenase LldD	NA	NA	NA	NA	NA
WP_011257026.1|25496_26063_-	phosphatidylethanolamine N-methyltransferase family protein	NA	NA	NA	NA	NA
WP_011407173.1|27537_28746_+	trans-2-enoyl-CoA reductase family protein	NA	NA	NA	NA	NA
WP_011257029.1|29373_30396_-	sugar kinase	NA	NA	NA	NA	NA
WP_011407175.1|31218_32187_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	59.7	5.6e-99
WP_011407176.1|32674_33811_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129215536.1|33807_34515_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	22.6	2.6e-05
WP_011407178.1|35116_36493_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	55.5	3.0e-77
WP_012443643.1|39505_39748_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012443642.1|39689_40013_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011257128.1|40478_41459_-|transposase	IS5-like element ISXoo7 family transposase	transposase	A0A077K814	Ralstonia_phage	55.9	5.3e-89
WP_011407184.1|42077_43367_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.2	2.1e-40
WP_011407185.1|43806_44142_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407187.1|44416_44848_-	VirK family protein	NA	NA	NA	NA	NA
WP_024743401.1|45196_46606_-	FAD/NAD(P)-binding protein	NA	NA	NA	NA	NA
WP_041181902.1|46883_47099_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257122.1|47923_48184_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027704081.1|48200_48533_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080256644.1|48532_48991_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407913.1|49350_50565_-|transposase	IS4-like element ISXo14 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	33.4	1.8e-54
WP_094187731.1|51085_51883_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_109182053.1|53598_54564_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_125168734.1|54560_54839_-	RHS repeat protein	NA	NA	NA	NA	NA
WP_011407196.1|54982_56302_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NC_007705	Xanthomonas oryzae pv. oryzae MAFF 311018, complete genome	4940217	109371	135587	4940217	transposase	Ralstonia_phage(50.0%)	25	NA	NA
WP_011258529.1|109371_110340_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	8.7e-100
WP_011407218.1|110552_111872_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011407219.1|112060_113044_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	61.2	7.5e-99
WP_011407220.1|113765_116138_+	HPr kinase	NA	NA	NA	NA	NA
WP_012443591.1|116496_116634_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257061.1|117013_118642_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011407223.1|119199_119583_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407224.1|119579_120065_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407225.1|120068_120431_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407226.1|120547_121984_-	Do family serine endopeptidase	NA	W5SAB9	Pithovirus	30.7	1.5e-10
WP_011407227.1|122225_123077_+	histidine biosynthesis protein HisIE	NA	NA	NA	NA	NA
WP_011257053.1|123536_123854_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_011257052.1|124159_125047_-	TIGR01777 family protein	NA	NA	NA	NA	NA
WP_011407229.1|125753_126704_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	61.9	3.0e-97
WP_125168735.1|126817_127027_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407230.1|127094_127355_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011257048.1|127407_127689_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407231.1|127827_128886_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_011407232.1|129026_129974_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.7	6.6e-44
WP_011407233.1|130228_130540_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011257044.1|131714_131891_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027704036.1|132006_132477_+	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_011257042.1|132646_133339_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257041.1|133430_133829_+	host attachment protein	NA	NA	NA	NA	NA
WP_011407237.1|134630_135587_+|transposase	IS30-like element IS1112a family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.2	2.1e-42
>prophage 3
NC_007705	Xanthomonas oryzae pv. oryzae MAFF 311018, complete genome	4940217	226082	368430	4940217	transposase,holin,tRNA	Bacillus_phage(21.43%)	86	NA	NA
WP_011257198.1|226082_227987_-|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG	tRNA	NA	NA	NA	NA
WP_075239321.1|228247_228427_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407290.1|228560_229028_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011257199.1|229185_230145_+	pyridoxal-phosphate dependent enzyme	NA	NA	NA	NA	NA
WP_011407291.1|230129_230747_+	YdcF family protein	NA	NA	NA	NA	NA
WP_011257200.1|230789_231209_+	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_011257201.1|231461_232367_-	lipid A hydroxylase LpxO	NA	H8ZJK8	Ostreococcus_tauri_virus	39.2	4.4e-37
WP_011257202.1|232615_233500_-	malonyl-ACP O-methyltransferase BioC	NA	NA	NA	NA	NA
WP_011257203.1|233563_234346_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_011407292.1|234390_235152_-	pimeloyl-ACP methyl ester esterase BioH	NA	NA	NA	NA	NA
WP_011257206.1|235315_235645_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407293.1|235963_237055_+	DUF4380 domain-containing protein	NA	NA	NA	NA	NA
WP_011407294.1|237123_238722_+	glucan biosynthesis protein D	NA	NA	NA	NA	NA
WP_011407295.1|238886_240131_-	GAF domain-containing sensor histidine kinase	NA	NA	NA	NA	NA
WP_011257210.1|240582_241212_-	thymidine kinase	NA	A0A023W530	Serratia_phage	55.0	3.3e-52
WP_011257211.1|241418_243395_+	UvrD-helicase domain-containing protein	NA	A7KV33	Bacillus_phage	37.2	1.1e-112
WP_011407298.1|244781_245447_-	YceH family protein	NA	NA	NA	NA	NA
WP_011257215.1|246734_247466_+	orotidine-5'-phosphate decarboxylase	NA	NA	NA	NA	NA
WP_011257216.1|247819_249349_-	tryptophan 7-halogenase	NA	M4T1E3	Cyanophage	28.7	1.0e-46
WP_011407300.1|249458_252491_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_011257218.1|252789_255828_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_011257219.1|255992_257045_-	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_075240491.1|257213_257459_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407301.1|257457_258423_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257221.1|258422_261083_+	glycerol-3-phosphate 1-O-acyltransferase PlsB	NA	NA	NA	NA	NA
WP_008573820.1|262901_263105_-	YdcH family protein	NA	NA	NA	NA	NA
WP_011257226.1|266744_267389_-	DUF4375 domain-containing protein	NA	NA	NA	NA	NA
WP_011257227.1|267529_268420_-	phenylalanine 4-monooxygenase	NA	NA	NA	NA	NA
WP_011407307.1|268547_269030_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_011257232.1|272065_272599_-	lipocalin family protein	NA	NA	NA	NA	NA
WP_011407313.1|275414_276473_-	NAD(P)-dependent alcohol dehydrogenase	NA	A0A2K9L339	Tupanvirus	45.7	3.0e-77
WP_011257237.1|276780_277854_+	glycoside hydrolase family 5 protein	NA	NA	NA	NA	NA
WP_011257238.1|278616_279669_+	glycoside hydrolase family 5 protein	NA	NA	NA	NA	NA
WP_011257239.1|280316_281447_+	glycoside hydrolase family 5 protein	NA	NA	NA	NA	NA
WP_011257241.1|282763_283153_+	YchJ family protein	NA	NA	NA	NA	NA
WP_011407316.1|283360_283567_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011407317.1|283798_284767_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	5.6e-99
WP_011257243.1|285020_287183_+	lytic murein transglycosylase	NA	NA	NA	NA	NA
WP_011407318.1|287730_289035_+	tetracycline resistance MFS efflux pump	NA	NA	NA	NA	NA
WP_011407319.1|289094_289697_+	biliverdin-producing heme oxygenase	NA	NA	NA	NA	NA
WP_011257245.1|289693_291598_+	GAF domain-containing protein	NA	Q6XLU9	Feldmannia_irregularis_virus	27.7	3.9e-19
WP_011407325.1|300916_301732_+	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	A0A127AWE5	Bacillus_phage	27.3	6.3e-19
WP_011407326.1|302078_303041_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_011257253.1|305707_306766_-	VacJ family lipoprotein	NA	NA	NA	NA	NA
WP_011257254.1|306776_307067_-	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_011257255.1|307056_307719_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_012446379.1|307715_308267_-	outer membrane lipid asymmetry maintenance protein MlaD	NA	NA	NA	NA	NA
WP_011257257.1|308278_309028_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_011407332.1|309027_309822_-	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	27.8	1.7e-08
WP_011257259.1|310206_310494_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027703982.1|310512_311070_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_109182061.1|311087_312053_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_011407336.1|312896_313853_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	34.4	2.9e-39
WP_109182062.1|314726_315525_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011407338.1|315656_316871_+|transposase	IS4 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	33.4	4.1e-54
WP_109182063.1|316930_317761_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011257271.1|320555_320984_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011407344.1|320994_321444_+	3-dehydroquinate dehydratase	NA	NA	NA	NA	NA
WP_011257273.1|321424_321652_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011407346.1|321959_323714_-	PQQ-binding-like beta-propeller repeat protein	NA	A0A0M4JT37	Mollivirus	35.6	7.3e-81
WP_027703800.1|325471_326056_-	gluconokinase	NA	NA	NA	NA	NA
WP_011407349.1|326213_327596_+	MFS transporter	NA	NA	NA	NA	NA
WP_011407350.1|327598_329998_+	NdvB protein	NA	NA	NA	NA	NA
WP_011407351.1|330101_332744_-	glycosyl hydrolase 115 family protein	NA	NA	NA	NA	NA
WP_011407352.1|333488_336941_+	hybrid sensor histidine kinase/response regulator	NA	NA	NA	NA	NA
WP_011407353.1|337133_337718_-	manganese efflux pump MntP family protein	NA	NA	NA	NA	NA
WP_011407354.1|338194_338971_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_011407355.1|339151_340453_+	L-fucose:H+ symporter permease	NA	NA	NA	NA	NA
WP_011257283.1|340455_340815_+	L-fucose mutarotase	NA	NA	NA	NA	NA
WP_011257284.1|341251_342733_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	66.0	2.7e-100
WP_109182027.1|342925_343891_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_011407357.1|344717_346880_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042464365.1|347006_349175_-	peptidyl-dipeptidase Dcp	NA	NA	NA	NA	NA
WP_011407359.1|349812_350442_-|holin	lysophosphatidylcholine acyltransferase	holin	NA	NA	NA	NA
WP_011407360.1|350444_350876_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_011407361.1|350932_351511_+	DUF2059 domain-containing protein	NA	NA	NA	NA	NA
WP_171970795.1|351606_352440_-	pseudouridylate synthase	NA	NA	NA	NA	NA
WP_011257292.1|352583_352973_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_011257293.1|353086_354760_-	ubiquinone biosynthesis regulatory protein kinase UbiB	NA	E5EQY1	Bathycoccus_sp._RCC1105_virus	28.6	3.1e-28
WP_011257294.1|354756_355401_-	SCP2 sterol-binding domain-containing protein	NA	NA	NA	NA	NA
WP_011257296.1|355635_356739_+	D-alanine--D-alanine ligase	NA	NA	NA	NA	NA
WP_011407366.1|359085_359370_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109182066.1|359721_360520_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011407371.1|363894_365214_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_128896918.1|365297_366263_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_042464374.1|367323_368430_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 4
NC_007705	Xanthomonas oryzae pv. oryzae MAFF 311018, complete genome	4940217	571507	620995	4940217	integrase,tRNA,transposase	Sinorhizobium_phage(14.29%)	43	579655:579671	617783:617799
WP_109181928.1|571507_572473_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_011407489.1|572940_574260_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011257475.1|574789_575305_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_011407490.1|575707_577930_-	primosomal protein N'	NA	NA	NA	NA	NA
WP_011257477.1|578395_579421_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012443959.1|579404_580007_+	DUF3106 domain-containing protein	NA	NA	NA	NA	NA
579655:579671	attL	GCGTAGTGCTGCGTCAT	NA	NA	NA	NA
WP_162013039.1|581242_581740_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011407493.1|581806_583183_+	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_011407494.1|583267_585169_+	signal peptide peptidase SppA	NA	A0A291AUM2	Sinorhizobium_phage	28.3	8.1e-09
WP_011257482.1|585354_585570_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407495.1|585676_586453_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_171970790.1|586614_587262_-	DUF4124 domain-containing protein	NA	NA	NA	NA	NA
WP_011407497.1|587285_588059_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011257486.1|588282_588846_-	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_011257487.1|588856_591349_-	DNA topoisomerase I	NA	A0A0G2YA05	Acanthamoeba_polyphaga_mimivirus	35.1	1.9e-114
WP_011257488.1|591531_592806_-	RDD family protein	NA	NA	NA	NA	NA
WP_011257490.1|593597_594071_-	DUF494 domain-containing protein	NA	NA	NA	NA	NA
WP_011257491.1|594113_595256_-	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_011407499.1|595327_596464_-	LysM peptidoglycan-binding domain-containing protein	NA	G3MBQ1	Bacillus_virus	57.1	1.7e-09
WP_011257493.1|596596_597109_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	43.0	2.6e-18
WP_011257494.1|597502_598426_+|tRNA	methionyl-tRNA formyltransferase	tRNA	NA	NA	NA	NA
WP_011407500.1|598425_599739_+	16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB	NA	NA	NA	NA	NA
WP_011257496.1|599789_601511_+	glycosyltransferase family 39 protein	NA	NA	NA	NA	NA
WP_011257497.1|601675_602953_+	O-antigen ligase family protein	NA	NA	NA	NA	NA
WP_011257498.1|603150_603975_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_011257499.1|603975_605034_+	UDP-N-acetylglucosamine 2-epimerase	NA	NA	NA	NA	NA
WP_011257500.1|605199_606666_-	PH domain-containing protein	NA	NA	NA	NA	NA
WP_042465436.1|606662_607166_-	PH domain-containing protein	NA	NA	NA	NA	NA
WP_011257502.1|607275_608409_-	GTP cyclohydrolase II RibA	NA	A0A2H4PQS2	Staphylococcus_phage	44.2	6.1e-28
WP_011407503.1|608651_609173_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_011257504.1|609372_610389_-	lauroyl acyltransferase	NA	NA	NA	NA	NA
WP_011257505.1|610387_610828_+|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
WP_011407505.1|610936_612811_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	35.5	1.8e-37
WP_011407506.1|613003_613324_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069960144.1|613475_613694_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407507.1|613952_615140_-|integrase	integrase	integrase	V9IQN0	Stenotrophomonas_phage	50.3	1.0e-110
WP_011257520.1|615360_615567_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011257521.1|615563_615836_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407508.1|615832_616078_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011257523.1|616221_616350_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_011407512.1|618013_619249_-|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
617783:617799	attR	ATGACGCAGCACTACGC	NA	NA	NA	NA
WP_011407513.1|619317_619707_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109181928.1|620029_620995_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
>prophage 5
NC_007705	Xanthomonas oryzae pv. oryzae MAFF 311018, complete genome	4940217	768431	810723	4940217	tRNA,transposase	Enterobacteria_phage(33.33%)	34	NA	NA
WP_011407608.1|768431_769751_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011407609.1|770066_771251_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	45.4	1.0e-41
WP_011407610.1|771780_773094_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.6	3.8e-13
WP_011407611.1|773083_773902_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_011257674.1|774124_775066_-	electron transfer flavoprotein subunit alpha/FixB family protein	NA	NA	NA	NA	NA
WP_011257675.1|775065_775812_-	electron transfer flavoprotein subunit beta/FixA family protein	NA	NA	NA	NA	NA
WP_011407612.1|776037_777093_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	48.0	4.3e-84
WP_011407613.1|777148_778036_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	58.2	2.2e-94
WP_011407614.1|778032_778590_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	47.5	2.3e-44
WP_011407615.1|778586_779495_+	dTDP-4-dehydrorhamnose reductase	NA	I7HXC9	Enterobacteria_phage	35.1	1.8e-27
WP_011257680.1|779611_781015_-	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	29.6	2.5e-47
WP_011407616.1|781061_782408_-	phosphomannomutase/phosphoglucomutase	NA	A0A127AWJ1	Bacillus_phage	26.9	2.6e-33
WP_011407617.1|782541_783273_+	CoA transferase subunit A	NA	NA	NA	NA	NA
WP_011257683.1|783272_783902_+	CoA transferase subunit B	NA	NA	NA	NA	NA
WP_011407618.1|783959_786047_-	glycoside hydrolase family 99-like domain-containing protein	NA	NA	NA	NA	NA
WP_012446093.1|786043_787693_-	electron transfer flavoprotein-ubiquinone oxidoreductase	NA	NA	NA	NA	NA
WP_011257686.1|787808_788417_+	alpha-ketoglutarate-dependent dioxygenase AlkB	NA	A0A2K9L0M4	Tupanvirus	31.4	1.8e-23
WP_011257687.1|788967_789612_-	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_011257688.1|789608_790535_-	MCE family protein	NA	NA	NA	NA	NA
WP_011257689.1|790537_791380_-	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	30.1	9.1e-13
WP_011407620.1|791465_792578_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_011257691.1|792747_794007_+	threonine/serine exporter	NA	NA	NA	NA	NA
WP_011407621.1|794068_794530_-	H-NS histone family protein	NA	NA	NA	NA	NA
WP_011257693.1|794672_796367_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_011257694.1|796478_796883_-	DUF4124 domain-containing protein	NA	NA	NA	NA	NA
WP_011407623.1|797014_797788_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_171970793.1|797822_798266_+	alanine acetyltransferase	NA	NA	NA	NA	NA
WP_011407624.1|798262_798745_+	ribosomal protein S18-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_011407625.1|799303_800623_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011407626.1|800780_802100_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011407627.1|802312_803281_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	9.6e-99
WP_027704044.1|805055_807029_+	transglycosylase SLT domain-containing protein	NA	A0A0H3V0Q1	Geobacillus_virus	36.7	7.9e-15
WP_011257702.1|807295_808336_-	pectate lyase	NA	NA	NA	NA	NA
WP_094187731.1|809925_810723_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 6
NC_007705	Xanthomonas oryzae pv. oryzae MAFF 311018, complete genome	4940217	869239	913298	4940217	protease,transposase	Ralstonia_phage(25.0%)	37	NA	NA
WP_115892985.1|869239_870205_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_011257750.1|870595_871171_-	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_011407659.1|871283_871793_+	DUF177 domain-containing protein	NA	NA	NA	NA	NA
WP_010368401.1|871891_872086_+	50S ribosomal protein L32	NA	NA	NA	NA	NA
WP_011257752.1|872175_873153_+	ketoacyl-ACP synthase III	NA	NA	NA	NA	NA
WP_011257753.1|873382_873823_+	MEKHLA domain-containing protein	NA	NA	NA	NA	NA
WP_011257754.1|874100_875045_+	ACP S-malonyltransferase	NA	NA	NA	NA	NA
WP_011407660.1|875127_875871_+	3-oxoacyl-ACP reductase FabG	NA	Q06VL0	Trichoplusia_ni_ascovirus	29.7	5.2e-12
WP_010368407.1|876075_876315_+	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	44.6	5.9e-10
WP_011407661.1|876456_877692_+	beta-ketoacyl-ACP synthase II	NA	NA	NA	NA	NA
WP_011407662.1|877862_879218_+	aminodeoxychorismate synthase component I	NA	NA	NA	NA	NA
WP_011257758.1|879278_880352_+	endolytic transglycosylase MltG	NA	NA	NA	NA	NA
WP_011257759.1|880348_881308_+	DNA polymerase III subunit delta'	NA	NA	NA	NA	NA
WP_011257760.1|881304_881658_+	PilZ domain-containing protein	NA	NA	NA	NA	NA
WP_173340380.1|882088_882655_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011407665.1|883675_884002_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041181972.1|884237_885836_-	propionate catabolism operon regulatory protein PrpR	NA	NA	NA	NA	NA
WP_011257763.1|885981_886878_+	methylisocitrate lyase	NA	NA	NA	NA	NA
WP_011407667.1|886953_888108_+	2-methylcitrate synthase	NA	NA	NA	NA	NA
WP_011257765.1|888288_890880_+	Fe/S-dependent 2-methylisocitrate dehydratase AcnD	NA	NA	NA	NA	NA
WP_012446043.1|890963_891131_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011407670.1|891612_892812_+	2-methylaconitate cis-trans isomerase PrpF	NA	NA	NA	NA	NA
WP_011407671.1|893261_894230_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	6.6e-100
WP_011407672.1|894471_896688_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_011407673.1|896766_897765_+	nucleoside hydrolase	NA	NA	NA	NA	NA
WP_042464512.1|899036_902024_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_041181973.1|902198_903146_+	glycerophosphodiester phosphodiesterase family protein	NA	M1HTS7	Paramecium_bursaria_Chlorella_virus	28.5	4.9e-07
WP_011407676.1|903650_904187_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011407677.1|904257_905577_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011407678.1|905921_906884_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.1	1.7e-42
WP_011257778.1|907017_907578_-	bacterioferritin	NA	NA	NA	NA	NA
WP_011257779.1|907620_908103_-	peroxiredoxin	NA	A0A1D8KSL1	Synechococcus_phage	36.2	3.1e-21
WP_011407679.1|908265_908742_+	Hsp20/alpha crystallin family protein	NA	NA	NA	NA	NA
WP_011257781.1|909152_910052_+	DnaJ domain-containing protein	NA	A0A2L0UZR4	Agrobacterium_phage	27.7	5.9e-18
WP_011257782.1|910291_910678_+	twitching motility response regulator PilH	NA	W8CYM9	Bacillus_phage	31.8	9.6e-10
WP_011407680.1|911307_912435_+|protease	FtsH protease activity modulator HflK	protease	NA	NA	NA	NA
WP_011257784.1|912434_913298_+|protease	protease modulator HflC	protease	NA	NA	NA	NA
>prophage 7
NC_007705	Xanthomonas oryzae pv. oryzae MAFF 311018, complete genome	4940217	919492	1076329	4940217	integrase,protease,transposase	Ralstonia_phage(20.83%)	106	1008725:1008743	1073440:1073458
WP_011407683.1|919492_920869_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	54.8	1.7e-77
WP_011257791.1|921112_921748_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_103057263.1|922374_922908_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257793.1|923033_923231_+	zinc-finger domain-containing protein	NA	NA	NA	NA	NA
WP_011407685.1|923240_924353_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_011257795.1|924333_925668_+	O-antigen ligase family protein	NA	NA	NA	NA	NA
WP_011257796.1|925901_926822_-	LpxL/LpxP family Kdo(2)-lipid IV(A) lauroyl/palmitoleoyl acyltransferase	NA	NA	NA	NA	NA
WP_011257797.1|926898_928215_+	lipid IV(A) 3-deoxy-D-manno-octulosonic acid transferase	NA	NA	NA	NA	NA
WP_011257798.1|928487_929867_-	TolC family outer membrane protein	NA	NA	NA	NA	NA
WP_011407686.1|929887_930544_-	protein-L-isoaspartate O-methyltransferase	NA	NA	NA	NA	NA
WP_011257800.1|930672_931326_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011407687.1|931596_932058_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027703665.1|933117_934002_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011257806.1|934122_935571_+	3-isopropylmalate dehydratase large subunit	NA	NA	NA	NA	NA
WP_011257807.1|935638_936286_+	3-isopropylmalate dehydratase small subunit	NA	NA	NA	NA	NA
WP_011257808.1|937102_938176_+	3-isopropylmalate dehydrogenase	NA	NA	NA	NA	NA
WP_011407690.1|938506_940069_-	2-isopropylmalate synthase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	24.4	4.3e-08
WP_011407691.1|940065_941190_-	threonine dehydratase	NA	NA	NA	NA	NA
WP_011257810.1|941265_941523_-	acetolactate synthase	NA	NA	NA	NA	NA
WP_011257811.1|941506_943228_-	acetolactate synthase 2 catalytic subunit	NA	E4WLQ6	Ostreococcus_tauri_virus	32.9	6.1e-64
WP_011257812.1|943271_944273_-	ketol-acid reductoisomerase	NA	NA	NA	NA	NA
WP_011407693.1|945549_947427_+	phosphomethylpyrimidine synthase ThiC	NA	NA	NA	NA	NA
WP_011407694.1|947852_950204_+	PD40 domain-containing protein	NA	NA	NA	NA	NA
WP_011407695.1|950314_951208_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_011407696.1|951256_954223_+	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	24.9	8.7e-42
WP_011257817.1|954837_955986_-	HDOD domain-containing protein	NA	NA	NA	NA	NA
WP_011257818.1|956099_956636_-	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	53.6	3.6e-47
WP_011407697.1|956832_957315_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109182067.1|959590_960556_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_109182120.1|960552_960726_-	sodium/proton-translocating pyrophosphatase	NA	NA	NA	NA	NA
WP_011257823.1|960977_961502_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257827.1|963182_964439_-	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_011257828.1|964598_965162_+	adenylate kinase	NA	A0A1B4XWI3	Tenacibaculum_phage	31.4	3.6e-13
WP_171970794.1|965519_966887_+	UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl- meso-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_027703752.1|966886_967483_+	LON peptidase substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_011257831.1|967629_968514_+	membrane protein	NA	NA	NA	NA	NA
WP_011257834.1|970495_971110_+	glutathione S-transferase C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_011257835.1|971192_972179_-	malate dehydrogenase	NA	NA	NA	NA	NA
WP_011257836.1|972294_972789_-	peptidylprolyl isomerase	NA	A0A1V0SCU1	Indivirus	52.3	5.5e-26
WP_011257837.1|973033_974863_+	translational GTPase TypA	NA	NA	NA	NA	NA
WP_011257838.1|974932_975352_+	DUF2127 domain-containing protein	NA	NA	NA	NA	NA
WP_011257840.1|976274_977402_-	mechanosensitive ion channel	NA	NA	NA	NA	NA
WP_011257841.1|977502_978885_-	3-deoxy-7-phosphoheptulonate synthase class II	NA	NA	NA	NA	NA
WP_011257842.1|979132_981256_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_011407706.1|981784_982303_-	disulfide bond formation protein B	NA	NA	NA	NA	NA
WP_115801872.1|983009_984111_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.4	1.6e-41
WP_011407710.1|986474_987365_-|protease	trypsin-like serine protease	protease	NA	NA	NA	NA
WP_012445986.1|987454_987595_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_109181928.1|988797_989763_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_011407713.1|991155_992391_-|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_012445996.1|997309_998860_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257031.1|1002356_1003325_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	4.3e-99
WP_011407721.1|1003585_1004047_-	cell wall hydrolase	NA	NA	NA	NA	NA
WP_011257866.1|1004595_1004838_-	glycerophosphodiester phosphodiesterase	NA	NA	NA	NA	NA
WP_049756327.1|1005628_1006360_-	glycerophosphodiester phosphodiesterase family protein	NA	A0A0S2MYI4	Enterococcus_phage	37.5	1.1e-06
WP_109182091.1|1008179_1008932_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
1008725:1008743	attL	GCGACAGCGGCTACACCGG	NA	NA	NA	NA
WP_109181928.1|1008933_1009899_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_011257874.1|1010162_1011170_+	isocitrate dehydrogenase	NA	NA	NA	NA	NA
WP_011257875.1|1011313_1012075_-	Bax inhibitor-1/YccA family protein	NA	NA	NA	NA	NA
WP_011407726.1|1015392_1016685_+	trigger factor	NA	NA	NA	NA	NA
WP_002806026.1|1016777_1017404_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	57.4	1.0e-56
WP_011257881.1|1017528_1018815_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	59.9	9.0e-137
WP_002806049.1|1021642_1021915_+	HU family DNA-binding protein	NA	A7KV42	Bacillus_phage	64.0	2.2e-21
WP_011407728.1|1022746_1024717_+	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_011407729.1|1025422_1026601_-	lytic transglycosylase domain-containing protein	NA	NA	NA	NA	NA
WP_011257886.1|1026597_1027365_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_011257887.1|1027377_1028034_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257888.1|1028061_1028514_+	ribonuclease HI	NA	A0A1Q2U2R0	Vibrio_phage	55.4	2.8e-40
WP_011257889.1|1028522_1029257_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	40.4	8.7e-36
WP_011257891.1|1029692_1030397_-	serine/threonine-protein phosphatase	NA	NA	NA	NA	NA
WP_011407730.1|1031222_1031852_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012445927.1|1032744_1032945_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011407734.1|1036130_1038281_+	DUF3274 domain-containing protein	NA	A0A077K801	Ralstonia_phage	27.9	2.2e-26
WP_011407735.1|1038277_1039975_+	DUF2875 family protein	NA	NA	NA	NA	NA
WP_041181914.1|1039971_1040235_+	PAAR domain-containing protein	NA	A4JWV5	Burkholderia_virus	43.4	4.4e-06
WP_011407736.1|1040296_1042504_+	DUF3274 domain-containing protein	NA	A0A077K801	Ralstonia_phage	28.2	2.0e-19
WP_011407737.1|1042500_1044180_+	DUF2875 family protein	NA	NA	NA	NA	NA
WP_075239641.1|1044176_1044440_+	PAAR domain-containing protein	NA	A4JWV5	Burkholderia_virus	43.4	7.5e-06
WP_011257899.1|1044501_1045059_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109182094.1|1045141_1046107_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_011257901.1|1046205_1046961_-|integrase	site-specific integrase	integrase	A0A077KET4	Ralstonia_phage	52.2	2.1e-61
WP_011257902.1|1047002_1047407_+	hypothetical protein	NA	A0A1C9C5K8	Heterosigma_akashiwo_virus	35.9	5.0e-17
WP_011407740.1|1047617_1048667_-	glycosyltransferase family 9 protein	NA	NA	NA	NA	NA
WP_011257904.1|1048687_1049437_+	3-deoxy-D-manno-octulosonic acid kinase	NA	NA	NA	NA	NA
WP_011257905.1|1049436_1050186_+	MBL fold metallo-hydrolase	NA	A0A0A0RUN7	Bacillus_phage	26.0	2.4e-09
WP_011407741.1|1050185_1051217_+	GTP 3',8-cyclase MoaA	NA	NA	NA	NA	NA
WP_011257907.1|1051234_1051594_+	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_011407742.1|1051618_1052116_+	cyclic pyranopterin monophosphate synthase MoaC	NA	NA	NA	NA	NA
WP_011257909.1|1052112_1052358_+	MoaD/ThiS family protein	NA	NA	NA	NA	NA
WP_011257910.1|1052354_1052801_+	molybdenum cofactor biosynthesis protein MoaE	NA	NA	NA	NA	NA
WP_011257911.1|1053362_1055459_+	DNA polymerase III subunit gamma/tau	NA	E7DN81	Pneumococcus_phage	40.7	4.1e-46
WP_011257912.1|1055465_1055786_+	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_011257913.1|1055883_1056477_+	recombination protein RecR	NA	NA	NA	NA	NA
WP_011407744.1|1056578_1056929_+	histidine triad nucleotide-binding protein	NA	NA	NA	NA	NA
WP_011257915.1|1057048_1057582_-	Slp family lipoprotein	NA	NA	NA	NA	NA
WP_011257916.1|1057578_1059531_-	DUF3488 domain-containing transglutaminase family protein	NA	NA	NA	NA	NA
WP_011257917.1|1059523_1060480_-	DUF58 domain-containing protein	NA	NA	NA	NA	NA
WP_011407746.1|1060485_1061439_-	MoxR family ATPase	NA	NA	NA	NA	NA
WP_012445908.1|1061477_1063346_+	glycosyltransferase family 39 protein	NA	NA	NA	NA	NA
WP_011407749.1|1064861_1065377_+	peptide deformylase	NA	NA	NA	NA	NA
WP_041182379.1|1067124_1067871_+	cellulase	NA	NA	NA	NA	NA
WP_011407751.1|1068487_1070089_-	rhamnogalacturonase B	NA	NA	NA	NA	NA
WP_011257570.1|1071077_1072313_+|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_011258802.1|1073141_1074110_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
1073440:1073458	attR	CCGGTGTAGCCGCTGTCGC	NA	NA	NA	NA
WP_075241901.1|1074577_1074928_-	DUF4433 domain-containing protein	NA	NA	NA	NA	NA
WP_011407756.1|1075009_1076329_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
>prophage 8
NC_007705	Xanthomonas oryzae pv. oryzae MAFF 311018, complete genome	4940217	1136133	1204098	4940217	transposase	Orpheovirus(14.29%)	54	NA	NA
WP_099051298.1|1136133_1136931_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011407791.1|1137079_1137379_+	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_011257986.1|1137507_1139679_+	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	A0A2I2L310	Orpheovirus	38.8	2.8e-13
WP_011257987.1|1139758_1140139_+	RidA family protein	NA	NA	NA	NA	NA
WP_011407792.1|1140159_1142313_+	ATP-dependent DNA helicase RecG	NA	NA	NA	NA	NA
WP_011257989.1|1142438_1143377_+	nucleoside hydrolase	NA	NA	NA	NA	NA
WP_005911911.1|1143448_1143691_+	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_011407793.1|1143904_1145194_+	citrate synthase	NA	NA	NA	NA	NA
WP_011407794.1|1145571_1146222_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011257992.1|1146531_1148961_-	penicillin-binding protein 1A	NA	NA	NA	NA	NA
WP_027703769.1|1149152_1150235_+	type IV pilus assembly protein PilM	NA	NA	NA	NA	NA
WP_011257994.1|1150234_1150993_+	PilN domain-containing protein	NA	NA	NA	NA	NA
WP_011257995.1|1150989_1151655_+	type 4a pilus biogenesis protein PilO	NA	NA	NA	NA	NA
WP_011257996.1|1151651_1152185_+	pilus assembly protein PilP	NA	NA	NA	NA	NA
WP_011407796.1|1152204_1154154_+	type IV pilus secretin PilQ family protein	NA	NA	NA	NA	NA
WP_094187763.1|1154224_1155023_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011407798.1|1155165_1156401_+|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_011407799.1|1156471_1157506_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_011258000.1|1158128_1159148_+	MoxR family ATPase	NA	NA	NA	NA	NA
WP_011258001.1|1159168_1160131_+	DUF58 domain-containing protein	NA	NA	NA	NA	NA
WP_011407801.1|1160133_1160595_+	DUF4381 domain-containing protein	NA	NA	NA	NA	NA
WP_011407802.1|1160591_1161599_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_011407803.1|1161595_1163398_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_011407804.1|1163394_1165152_+	BatD family protein	NA	NA	NA	NA	NA
WP_033013273.1|1165447_1165765_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027703585.1|1165962_1167243_+	dicarboxylate/amino acid:cation symporter	NA	NA	NA	NA	NA
WP_011407806.1|1167462_1169463_+	transketolase	NA	NA	NA	NA	NA
WP_011258009.1|1170281_1170998_-	M23 family metallopeptidase	NA	A0A0M5M794	Arthrobacter_phage	34.2	2.7e-05
WP_042464572.1|1171000_1171930_-	murein L,D-transpeptidase	NA	NA	NA	NA	NA
WP_042464574.1|1172312_1175027_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_011407810.1|1175146_1176322_-	phosphatidylinositol-specific phospholipase C1-like protein	NA	NA	NA	NA	NA
WP_042464577.1|1176456_1178415_-	acetyl-CoA hydrolase	NA	NA	NA	NA	NA
WP_069960293.1|1178590_1179238_+	thermostable hemolysin	NA	NA	NA	NA	NA
WP_011407813.1|1179234_1180734_+	AMP-binding protein	NA	NA	NA	NA	NA
WP_011407814.1|1180730_1181405_+	iron-containing redox enzyme family protein	NA	NA	NA	NA	NA
WP_011407815.1|1181404_1182244_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_011407818.1|1182910_1183609_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	35.0	9.8e-29
WP_041182938.1|1183626_1184988_+	two-component sensor histidine kinase	NA	NA	NA	NA	NA
WP_011407820.1|1185087_1185453_+	BlaI/MecI/CopY family transcriptional regulator	NA	NA	NA	NA	NA
WP_011407821.1|1185442_1186759_+	TonB family protein	NA	NA	NA	NA	NA
WP_011407822.1|1186755_1187340_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011407823.1|1187682_1188297_-	molybdenum ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.0	2.1e-19
WP_027703578.1|1188296_1188983_-	molybdate ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_011407824.1|1188999_1189776_-	molybdate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_011258028.1|1189846_1190677_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_012445839.1|1190690_1191464_-	S1/P1 nuclease	NA	NA	NA	NA	NA
WP_153296750.1|1194537_1194678_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011407830.1|1195334_1196336_+	type I glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_115801876.1|1197575_1198541_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_027704076.1|1198650_1199970_-	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_011407833.1|1200432_1201110_-	response regulator transcription factor	NA	Q6XM27	Feldmannia_irregularis_virus	27.4	7.4e-05
WP_027704066.1|1201189_1201579_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012445833.1|1201792_1202710_-	30S ribosomal protein S6--L-glutamate ligase	NA	A0A1D7SR78	Cyanophage	32.7	1.3e-31
WP_113081219.1|1203113_1204098_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.8	6.3e-98
>prophage 9
NC_007705	Xanthomonas oryzae pv. oryzae MAFF 311018, complete genome	4940217	1310325	1396798	4940217	tRNA,transposase	Acinetobacter_phage(33.33%)	56	NA	NA
WP_115858605.1|1310325_1311382_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_011407897.1|1311702_1313196_-	M20 family metallopeptidase	NA	NA	NA	NA	NA
WP_011258127.1|1313320_1313728_+	helix-hairpin-helix domain-containing protein	NA	NA	NA	NA	NA
WP_128896923.1|1315439_1316537_+	HutD family protein	NA	NA	NA	NA	NA
WP_128896924.1|1317226_1318192_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_011258133.1|1318689_1320273_-	alpha-L-arabinofuranosidase	NA	NA	NA	NA	NA
WP_027704032.1|1320520_1321570_+	galactose mutarotase	NA	NA	NA	NA	NA
WP_011407903.1|1321857_1322649_-	cytochrome c biogenesis protein CcsA	NA	NA	NA	NA	NA
WP_115892986.1|1322864_1323830_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_011407905.1|1324131_1325508_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_011407907.1|1327080_1328151_+	nitronate monooxygenase	NA	NA	NA	NA	NA
WP_011407908.1|1328141_1328939_+	aminotransferase class IV family protein	NA	NA	NA	NA	NA
WP_011258141.1|1329048_1329306_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_011407909.1|1329349_1329862_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_011407910.1|1329927_1330707_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_005989873.1|1330830_1331238_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_011407911.1|1331863_1333354_-	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_011407912.1|1333694_1334102_+	RNA-binding S4 domain-containing protein	NA	NA	NA	NA	NA
WP_011407913.1|1334521_1335736_+|transposase	IS4-like element ISXo14 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	33.4	1.8e-54
WP_011407915.1|1337061_1337337_-	glutathione transferase	NA	NA	NA	NA	NA
WP_011258151.1|1337366_1337672_-	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
WP_011407916.1|1338117_1340703_+	ATP-dependent chaperone ClpB	NA	A0A1C3S747	Escherichia_phage	35.4	3.8e-126
WP_011407917.1|1340827_1341739_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109181892.1|1341769_1341919_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011258158.1|1344981_1346859_+	TonB-dependent vitamin B12 receptor	NA	A0A0P0I887	Acinetobacter_phage	29.5	4.9e-06
WP_011258160.1|1348631_1349225_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027703819.1|1349224_1349824_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011258162.1|1349820_1350432_+	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_011258163.1|1350945_1351467_+	bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase	NA	NA	NA	NA	NA
WP_011407923.1|1351463_1352510_+	nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_011258165.1|1352506_1353097_+	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_011258166.1|1353093_1353828_+	adenosylcobinamide-GDP ribazoletransferase	NA	NA	NA	NA	NA
WP_011407924.1|1354002_1355199_-	type III PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_011407925.1|1355195_1356965_-	iron transporter	NA	NA	NA	NA	NA
WP_011407926.1|1356942_1358139_-	MFS transporter	NA	NA	NA	NA	NA
WP_011258170.1|1358135_1359938_-	IucA/IucC family siderophore biosynthesis protein	NA	NA	NA	NA	NA
WP_011258171.1|1359934_1361161_-	siderophore biosynthesis protein PvsA	NA	NA	NA	NA	NA
WP_011407927.1|1361396_1363538_-	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_011258173.1|1363538_1364300_-	4-hydroxy-2-oxovalerate aldolase	NA	NA	NA	NA	NA
WP_162013048.1|1364444_1365545_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.4	4.7e-41
WP_011407928.1|1365709_1367407_-	Kef family K(+) transporter	NA	NA	NA	NA	NA
WP_011407930.1|1368501_1370901_-	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	33.3	6.4e-11
WP_011258178.1|1371233_1373621_-	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	32.9	9.2e-10
WP_011258179.1|1373894_1374335_-	VOC family protein	NA	NA	NA	NA	NA
WP_011407931.1|1374798_1377186_-	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	35.7	7.1e-10
WP_011407932.1|1377361_1379278_+	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L0W2	Tupanvirus	30.5	1.2e-65
WP_011407933.1|1379549_1379975_+	YcxB family protein	NA	NA	NA	NA	NA
WP_011407934.1|1379998_1380874_-	LysR family transcriptional regulator AmpR	NA	Q6JIH3	Burkholderia_virus	28.4	2.0e-15
WP_011407935.1|1380974_1381916_+	class A beta-lactamase	NA	A0A1B0VBP7	Salmonella_phage	45.4	6.5e-60
WP_042464613.1|1381983_1382802_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_011407938.1|1385410_1386202_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_012445725.1|1386657_1386828_+	hypothetical protein	NA	NA	NA	NA	NA
WP_173340392.1|1387038_1388394_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_011407939.1|1388606_1390475_+	ATP-binding protein	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	21.0	9.7e-15
WP_011407940.1|1390499_1392824_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011407943.1|1395613_1396798_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	44.8	5.0e-41
>prophage 10
NC_007705	Xanthomonas oryzae pv. oryzae MAFF 311018, complete genome	4940217	1450173	1599220	4940217	tRNA,transposase	Ralstonia_phage(24.0%)	110	NA	NA
WP_109181897.1|1450173_1451139_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_041182392.1|1451491_1452196_+	HAD family hydrolase	NA	NA	NA	NA	NA
WP_005926176.1|1452733_1452958_-	putative selenoprotein	NA	NA	NA	NA	NA
WP_011407979.1|1452957_1455030_-	carbon starvation protein A	NA	NA	NA	NA	NA
WP_011407980.1|1455261_1456119_+	pirin family protein	NA	NA	NA	NA	NA
WP_011407981.1|1456734_1459557_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	28.7	1.6e-53
WP_027704078.1|1459611_1460472_+	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_075241467.1|1460540_1461119_+	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_011258802.1|1462110_1463079_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_175576423.1|1463291_1463681_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011258248.1|1466110_1467058_+	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_158645225.1|1467273_1467657_+	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_041182394.1|1468051_1468600_+	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_075245366.1|1469810_1470368_+	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_011407990.1|1470417_1472526_+	DUF2235 domain-containing protein	NA	NA	NA	NA	NA
WP_011407991.1|1472547_1474449_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	32.6	2.9e-30
WP_075251795.1|1475431_1476010_+	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_011258251.1|1476473_1476707_+	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_011258252.1|1476703_1476856_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011407994.1|1476927_1477494_+	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_012444346.1|1477490_1477643_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011407995.1|1477696_1478284_+	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_154583424.1|1478280_1478433_+	hypothetical protein	NA	NA	NA	NA	NA
WP_173340393.1|1478501_1479071_+	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_011407999.1|1481819_1482281_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408000.1|1482527_1483418_-	pirin family protein	NA	NA	NA	NA	NA
WP_125168744.1|1483595_1484114_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042465484.1|1484185_1484899_-	deoxyribonuclease V	NA	NA	NA	NA	NA
WP_011258259.1|1485002_1485752_+	2,3-diphosphoglycerate-dependent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_042465485.1|1486111_1486363_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408003.1|1486695_1488753_+	M13 family peptidase	NA	A0A1V0SHG2	Klosneuvirus	28.6	1.2e-79
WP_173340382.1|1490698_1491838_-	chemotaxis-specific protein-glutamate methyltransferase CheB	NA	NA	NA	NA	NA
WP_012444362.1|1491834_1492641_-	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_011408007.1|1493954_1494470_-	purine-binding chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_011408008.1|1494480_1496634_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	62.1	2.9e-10
WP_011408009.1|1496701_1498699_-	chemotaxis protein CheA	NA	NA	NA	NA	NA
WP_011258268.1|1498717_1499047_-	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_125168745.1|1499086_1499305_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408010.1|1499536_1503001_-	transcription-repair coupling factor	NA	NA	NA	NA	NA
WP_011258270.1|1503403_1503946_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_011408011.1|1504357_1505266_-	23S rRNA (adenine(2030)-N(6))-methyltransferase RlmJ	NA	NA	NA	NA	NA
WP_094187763.1|1505611_1506410_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_042464653.1|1506553_1507273_+	two-component sensor histidine kinase	NA	NA	NA	NA	NA
WP_109181900.1|1507428_1508463_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_011258276.1|1508483_1509296_-	C1 family peptidase	NA	NA	NA	NA	NA
WP_011408014.1|1510031_1510415_+	inner membrane CreD family protein	NA	NA	NA	NA	NA
WP_011408015.1|1510537_1511707_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.5	1.1e-96
WP_011408016.1|1511701_1512760_-|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	42.6	4.1e-71
WP_011408017.1|1512820_1513633_-	C1 family peptidase	NA	NA	NA	NA	NA
WP_011408018.1|1514148_1514532_+	inner membrane CreD family protein	NA	NA	NA	NA	NA
WP_011408019.1|1514654_1515818_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	61.2	2.6e-98
WP_011408020.1|1515848_1516661_-	C1 family peptidase	NA	NA	NA	NA	NA
WP_011408021.1|1516891_1517479_+	GNAT family acetyltransferase	NA	NA	NA	NA	NA
WP_011407237.1|1517777_1518734_-|transposase	IS30-like element IS1112a family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.2	2.1e-42
WP_075242217.1|1518807_1519539_+	nitrilase	NA	NA	NA	NA	NA
WP_011258289.1|1520728_1522132_+|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_011408024.1|1522145_1522652_+	transcriptional repressor	NA	NA	NA	NA	NA
WP_011408025.1|1523057_1523516_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_011258291.1|1524293_1524497_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408029.1|1526058_1526544_-	DUF456 domain-containing protein	NA	NA	NA	NA	NA
WP_011258294.1|1526771_1526987_+	cold-shock protein	NA	A0A1X9IGI9	Lactococcus_phage	59.7	6.5e-16
WP_011408030.1|1527237_1527717_-	glycine zipper 2TM domain-containing protein	NA	NA	NA	NA	NA
WP_011408031.1|1527848_1528277_-	cytochrome c	NA	NA	NA	NA	NA
WP_011258297.1|1528349_1529180_+|tRNA	tRNA threonylcarbamoyladenosine dehydratase	tRNA	NA	NA	NA	NA
WP_011408032.1|1529241_1530009_-	TatD family hydrolase	NA	NA	NA	NA	NA
WP_011258299.1|1530008_1530224_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408033.1|1530369_1531161_+	glycine zipper 2TM domain-containing protein	NA	NA	NA	NA	NA
WP_011258301.1|1531306_1532482_+	acyl-CoA dehydrogenase family protein	NA	NA	NA	NA	NA
WP_011408036.1|1534714_1535353_+	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_011258305.1|1535528_1537469_+	asparagine synthase (glutamine-hydrolyzing)	NA	A0A1B1ISV2	uncultured_Mediterranean_phage	30.5	4.4e-26
WP_011258306.1|1537685_1538240_+	NAD(P)H-dependent oxidoreductase	NA	A0A2P0ZL77	Lactobacillus_phage	35.3	1.1e-19
WP_011408037.1|1538461_1539892_+	replicative DNA helicase	NA	O80281	Escherichia_phage	53.4	8.5e-120
WP_012444398.1|1539994_1541413_+	deoxyribodipyrimidine photo-lyase	NA	A0A1V0S949	Catovirus	31.7	3.3e-47
WP_011258309.1|1541829_1542555_+	OmpA family protein	NA	G3M9Z0	Bacillus_virus	33.9	1.4e-09
WP_011408038.1|1542653_1543064_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_011408040.1|1544316_1546698_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_011258314.1|1549395_1549806_+	MerC domain-containing protein	NA	NA	NA	NA	NA
WP_011408042.1|1550105_1550288_+	30S ribosomal protein THX	NA	NA	NA	NA	NA
WP_011258316.1|1550420_1551461_-	zinc-dependent alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_011258317.1|1551533_1552979_-	chloride channel protein	NA	A0A1X9I5Z9	Streptococcus_phage	31.5	4.9e-14
WP_011258802.1|1554509_1555478_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_011408046.1|1555828_1556374_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	A0A1S5V092	Saudi_moumouvirus	51.9	4.1e-14
WP_011408047.1|1556370_1557834_-	DNA-3-methyladenine glycosylase 2 family protein	NA	NA	NA	NA	NA
WP_011258323.1|1559295_1559550_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011258324.1|1559952_1560486_+	DUF4019 domain-containing protein	NA	NA	NA	NA	NA
WP_011258325.1|1560511_1560913_+	MAPEG family protein	NA	NA	NA	NA	NA
WP_011408050.1|1560881_1561262_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011258326.1|1561258_1561501_-	RNA-binding S4 domain-containing protein	NA	NA	NA	NA	NA
WP_011258329.1|1562869_1564774_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	35.7	2.5e-58
WP_011408052.1|1565037_1567434_+	EAL domain-containing protein	NA	G3MA91	Bacillus_virus	30.2	3.8e-11
WP_011408053.1|1567583_1568306_+	pseudouridine synthase	NA	NA	NA	NA	NA
WP_011258334.1|1571225_1571726_+	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_075241746.1|1571667_1573344_+	serine hydrolase	NA	NA	NA	NA	NA
WP_011258336.1|1573490_1574756_+	cation:proton antiporter	NA	NA	NA	NA	NA
WP_011408056.1|1574814_1576008_-	HAMP domain-containing protein	NA	W8CYF6	Bacillus_phage	23.9	5.2e-22
WP_011408057.1|1576004_1576694_-	response regulator transcription factor	NA	Q6XM27	Feldmannia_irregularis_virus	28.3	3.6e-07
WP_011408058.1|1576799_1578269_+	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_011258340.1|1578288_1579125_+	MipA/OmpV family protein	NA	NA	NA	NA	NA
WP_011408059.1|1579150_1580254_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_011408060.1|1580250_1583307_+	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_011258343.1|1583372_1583963_+	plasmid pRiA4b ORF-3 family protein	NA	NA	NA	NA	NA
WP_011258344.1|1584094_1585927_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.3	1.2e-30
WP_011408061.1|1586808_1588128_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011408063.1|1589425_1593916_+	type IV secretion protein Rhs	NA	NA	NA	NA	NA
WP_125168746.1|1593912_1594404_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011258803.1|1594455_1595424_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	1.5e-99
WP_125168747.1|1595572_1595872_+	hypothetical protein	NA	NA	NA	NA	NA
WP_125168748.1|1595868_1596198_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408064.1|1597713_1598082_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011258802.1|1598251_1599220_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
>prophage 11
NC_007705	Xanthomonas oryzae pv. oryzae MAFF 311018, complete genome	4940217	1654819	1793742	4940217	plate,tRNA,head,terminase,transposase,capsid,integrase,tail,portal,holin	Stenotrophomonas_phage(43.75%)	112	1696077:1696097	1753252:1753272
WP_011258399.1|1654819_1657651_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A1V0SGW1	Hokovirus	22.2	4.1e-41
WP_011408096.1|1657965_1658466_+	signal peptidase II	NA	NA	NA	NA	NA
WP_011258401.1|1658554_1659505_+	4-hydroxy-3-methylbut-2-enyl diphosphate reductase	NA	NA	NA	NA	NA
WP_011258402.1|1660018_1660954_+	ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_011408097.1|1660953_1662954_+	cytochrome o ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_011258404.1|1662950_1663583_+	cytochrome o ubiquinol oxidase subunit III	NA	NA	NA	NA	NA
WP_010365831.1|1663582_1663918_+	cytochrome o ubiquinol oxidase subunit IV	NA	NA	NA	NA	NA
WP_162013044.1|1664084_1665965_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_012444470.1|1666189_1668436_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	31.3	4.4e-54
WP_011408100.1|1668459_1670079_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408101.1|1670222_1674806_+	type IV secretion protein Rhs	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	43.7	4.2e-19
WP_041182049.1|1674798_1675395_+	SUKH-4 family immunity protein	NA	NA	NA	NA	NA
WP_109181910.1|1677130_1678232_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.0	1.2e-41
WP_011258414.1|1680164_1682786_-	DNA mismatch repair protein MutS	NA	A0A1V0SGG8	Hokovirus	22.8	1.4e-30
WP_011258418.1|1685691_1687083_-	DNA repair protein RadA	NA	NA	NA	NA	NA
WP_011258422.1|1688473_1690030_+	glycosyltransferase family 39 protein	NA	NA	NA	NA	NA
WP_011408111.1|1692613_1693852_-	MFS transporter	NA	NA	NA	NA	NA
WP_011408112.1|1694292_1694586_+	zinc ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_011258426.1|1695083_1695860_-	DUF3011 domain-containing protein	NA	NA	NA	NA	NA
WP_011408113.1|1696017_1697784_+|tRNA	aspartate--tRNA ligase	tRNA	NA	NA	NA	NA
1696077:1696097	attL	CGCCGGCTGGACCGACGTGGC	NA	NA	NA	NA
WP_011258428.1|1698295_1698823_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_027703718.1|1698922_1699600_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_011258430.1|1699689_1700418_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_011258431.1|1700532_1701057_+	crossover junction endodeoxyribonuclease RuvC	NA	NA	NA	NA	NA
WP_011258432.1|1701214_1701799_+	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_011258433.1|1701998_1703906_+	potassium transporter Kup	NA	M1IBC2	Acanthocystis_turfacea_Chlorella_virus	34.1	3.4e-79
WP_010363979.1|1704034_1705072_+	Holliday junction branch migration DNA helicase RuvB	NA	B3GAM6	uncultured_virus	28.2	2.7e-06
WP_011258434.1|1705124_1705583_+	tol-pal system-associated acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_011258435.1|1705594_1706374_+	protein TolQ	NA	NA	NA	NA	NA
WP_011408114.1|1706530_1706980_+	protein TolR	NA	NA	NA	NA	NA
WP_011258437.1|1706969_1708010_+	cell envelope integrity protein TolA	NA	NA	NA	NA	NA
WP_011408115.1|1708269_1709589_+	Tol-Pal system beta propeller repeat protein TolB	NA	NA	NA	NA	NA
WP_011408116.1|1709646_1710165_+	peptidoglycan-associated lipoprotein Pal	NA	NA	NA	NA	NA
WP_011258440.1|1710171_1710990_+	tol-pal system protein YbgF	NA	NA	NA	NA	NA
WP_011408117.1|1711032_1711716_+	7-carboxy-7-deazaguanine synthase QueE	NA	J9PV61	Bacillus_phage	39.5	1.5e-37
WP_011408120.1|1712949_1713660_-	rRNA pseudouridine synthase	NA	NA	NA	NA	NA
WP_011408121.1|1713894_1714101_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103057327.1|1715894_1716473_-	amino acid transporter	NA	NA	NA	NA	NA
WP_011408127.1|1719012_1720248_+|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_008578058.1|1722884_1723559_+	7-cyano-7-deazaguanine synthase QueC	NA	A0A088F6S9	Vibrio_phage	34.7	6.4e-25
WP_011258445.1|1723803_1724988_-|integrase	integrase	integrase	V9IQN0	Stenotrophomonas_phage	57.2	2.0e-122
WP_041182055.1|1724987_1725209_-	hypothetical protein	NA	V9IQX6	Stenotrophomonas_phage	58.3	1.9e-18
WP_011408130.1|1725205_1725412_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408131.1|1725408_1725681_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041182407.1|1725677_1725923_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161795300.1|1725919_1726165_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053503014.1|1726187_1726364_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010364106.1|1726356_1726767_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011258448.1|1726992_1727271_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408133.1|1727267_1727486_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408134.1|1727794_1730491_-	toprim domain-containing protein	NA	V9IQW5	Stenotrophomonas_phage	69.9	0.0e+00
WP_011258450.1|1730500_1730713_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408135.1|1730709_1730988_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408136.1|1730998_1731319_-	hypothetical protein	NA	V9IQW3	Stenotrophomonas_phage	57.6	7.4e-24
WP_053503015.1|1731321_1731579_-	DNA-binding protein	NA	A0A2H4JE67	uncultured_Caudovirales_phage	46.4	6.6e-07
WP_011258452.1|1731650_1732088_+	helix-turn-helix transcriptional regulator	NA	E5E3P4	Burkholderia_phage	32.0	5.4e-09
WP_011258453.1|1732748_1733735_-	phage late control D family protein	NA	V9IQM7	Stenotrophomonas_phage	54.8	2.5e-94
WP_011258454.1|1733731_1734133_-|tail	phage tail protein	tail	V9IQX3	Stenotrophomonas_phage	62.3	6.0e-39
WP_011408137.1|1734145_1737016_-|tail	phage tail tape measure protein	tail	V9IQL1	Stenotrophomonas_phage	49.1	4.1e-206
WP_011258456.1|1737048_1737162_-|tail	GpE family phage tail protein	tail	A0A0M4R2P3	Salmonella_phage	68.6	4.2e-06
WP_011258457.1|1737170_1737473_-|tail	phage tail assembly protein	tail	A4PE51	Ralstonia_virus	62.6	6.3e-25
WP_011258458.1|1737518_1738028_-|tail	phage major tail tube protein	tail	V9IQX1	Stenotrophomonas_phage	79.9	1.8e-72
WP_011258459.1|1738058_1739225_-|tail	phage tail sheath subtilisin-like domain-containing protein	tail	E5FFG9	Burkholderia_phage	62.4	4.6e-132
WP_011258460.1|1739236_1739596_-	GPW/gp25 family protein	NA	V9IQW0	Stenotrophomonas_phage	65.3	1.2e-35
WP_011408138.1|1739592_1740156_-|plate	phage baseplate assembly protein V	plate	Q9ZXL0	Pseudomonas_virus	44.3	8.2e-26
WP_011408139.1|1740216_1740795_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408140.1|1740802_1742308_-|tail	tail fiber protein	tail	V9IQX0	Stenotrophomonas_phage	48.2	6.6e-54
WP_011408141.1|1742317_1742863_-|tail	phage tail protein I	tail	V9IQK7	Stenotrophomonas_phage	54.7	2.1e-50
WP_011408142.1|1742855_1743746_-|plate	baseplate J/gp47 family protein	plate	V9IQV9	Stenotrophomonas_phage	53.0	6.8e-83
WP_011408143.1|1743876_1745046_-	DUF3800 domain-containing protein	NA	NA	NA	NA	NA
WP_011258467.1|1745537_1745984_-	phage virion morphogenesis protein	NA	V9IQH0	Stenotrophomonas_phage	56.1	1.8e-36
WP_011408144.1|1745971_1746391_-|tail	phage tail protein	tail	A0A2H4J906	uncultured_Caudovirales_phage	63.0	1.4e-38
WP_011408145.1|1746387_1746876_-	hypothetical protein	NA	V9IQW8	Stenotrophomonas_phage	50.7	1.2e-25
WP_011408146.1|1746875_1747514_-	glycoside hydrolase family 19 protein	NA	V9IQK6	Stenotrophomonas_phage	60.9	7.8e-49
WP_011408147.1|1747513_1747789_-|holin	phage holin family protein	holin	V9IQV8	Stenotrophomonas_phage	58.6	1.1e-20
WP_011408148.1|1747781_1748138_-	membrane protein	NA	V9IQG9	Stenotrophomonas_phage	55.3	1.7e-21
WP_011258473.1|1748142_1748352_-|tail	tail protein X	tail	K4PAW7	Burkholderia_phage	58.0	3.5e-14
WP_011408149.1|1748351_1748819_-|head	head completion/stabilization protein	head	V9IQW6	Stenotrophomonas_phage	49.0	2.0e-30
WP_011408150.1|1748918_1749638_-|terminase	terminase endonuclease subunit	terminase	Q9ZXM2	Pseudomonas_virus	62.9	3.4e-69
WP_011408151.1|1749641_1750658_-|capsid	phage major capsid protein, P2 family	capsid	Q9ZXM3	Pseudomonas_virus	70.5	4.2e-137
WP_011408152.1|1750704_1751547_-|capsid	GPO family capsid scaffolding protein	capsid	A0A2H4J928	uncultured_Caudovirales_phage	52.9	2.0e-68
WP_173340394.1|1751689_1753453_+|terminase	terminase ATPase subunit family protein	terminase	V9IQL5	Stenotrophomonas_phage	76.0	1.0e-268
1753252:1753272	attR	CGCCGGCTGGACCGACGTGGC	NA	NA	NA	NA
WP_011408154.1|1753452_1754475_+|portal	phage portal protein	portal	A0A2H4J922	uncultured_Caudovirales_phage	71.5	2.6e-139
WP_075251737.1|1754500_1754746_+	Com family DNA-binding transcriptional regulator	NA	V9IQK2	Stenotrophomonas_phage	50.0	7.7e-13
WP_011408155.1|1754663_1755365_+	site-specific DNA-methyltransferase	NA	V9IQV5	Stenotrophomonas_phage	76.2	3.2e-104
WP_011408156.1|1755431_1756178_-	immunity 52 family protein	NA	NA	NA	NA	NA
WP_011408157.1|1756174_1756882_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408158.1|1756895_1757237_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052285781.1|1757217_1757775_-	DUF4123 domain-containing protein	NA	A4PE24	Ralstonia_virus	34.4	5.3e-09
WP_011408160.1|1757723_1758125_-	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_011408161.1|1759263_1760550_-	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	42.2	1.4e-81
WP_011408162.1|1760777_1761113_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408164.1|1761819_1762224_-	response regulator	NA	NA	NA	NA	NA
WP_011408165.1|1762302_1762800_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011258487.1|1762938_1764735_-	DNA helicase RecQ	NA	L7RCS0	Acanthamoeba_polyphaga_moumouvirus	35.5	1.5e-81
WP_011408166.1|1765291_1765837_-	DNA starvation/stationary phase protection protein	NA	A0A2H4N7L5	Lake_Baikal_phage	32.4	1.5e-16
WP_011258489.1|1765938_1770060_+	ATP-dependent RNA helicase HrpA	NA	A0A1V0SDF7	Indivirus	28.5	1.9e-47
WP_011408167.1|1770280_1772923_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_041182063.1|1774364_1775879_-	PhoPQ-regulated protein	NA	NA	NA	NA	NA
WP_011408171.1|1777123_1777636_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408172.1|1777698_1778817_-	pyrroloquinoline quinone biosynthesis protein PqqE	NA	NA	NA	NA	NA
WP_011408173.1|1778813_1779092_-	pyrroloquinoline quinone biosynthesis peptide chaperone PqqD	NA	NA	NA	NA	NA
WP_011408174.1|1779088_1779841_-	pyrroloquinoline-quinone synthase PqqC	NA	NA	NA	NA	NA
WP_011258497.1|1779837_1780737_-	pyrroloquinoline quinone biosynthesis protein PqqB	NA	NA	NA	NA	NA
WP_002812057.1|1780820_1780901_-	pyrroloquinoline quinone precursor peptide PqqA	NA	NA	NA	NA	NA
WP_042464698.1|1781190_1783377_+	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_042465507.1|1783680_1785123_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408177.1|1785455_1787558_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_011258501.1|1787799_1790244_+	penicillin-binding protein 1B	NA	NA	NA	NA	NA
WP_011408178.1|1790257_1790782_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408179.1|1790981_1793009_+	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	33.2	4.6e-95
WP_011408180.1|1793022_1793742_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
>prophage 12
NC_007705	Xanthomonas oryzae pv. oryzae MAFF 311018, complete genome	4940217	2006104	2065229	4940217	protease,transposase,coat,tRNA	Acidithiobacillus_phage(25.0%)	45	NA	NA
WP_011258663.1|2006104_2008189_-|tRNA	methionine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_011408302.1|2008413_2008863_-	DUF2147 domain-containing protein	NA	NA	NA	NA	NA
WP_011408304.1|2009626_2010685_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_011408305.1|2010955_2012353_+	S-methylmethionine permease	NA	NA	NA	NA	NA
WP_011408306.1|2012349_2013327_+	homocysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_011408307.1|2013508_2015446_-	DUF885 family protein	NA	NA	NA	NA	NA
WP_011258669.1|2015866_2016643_-	queuosine precursor transporter	NA	R4TNY5	Halovirus	27.2	1.9e-09
WP_011258670.1|2016647_2017322_-	DUF502 domain-containing protein	NA	A0A2I7S9X1	Vibrio_phage	24.5	1.9e-08
WP_082323429.1|2018952_2020329_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	55.1	2.0e-78
WP_011408311.1|2020368_2020764_-	type I toxin-antitoxin system SymE family toxin	NA	NA	NA	NA	NA
WP_011408312.1|2020806_2022282_-|transposase	IS5-like element ISXoo5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	67.5	2.2e-102
WP_128415338.1|2023044_2023497_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080256646.1|2023510_2023681_-	adenylyl-sulfate kinase	NA	NA	NA	NA	NA
WP_012445197.1|2028405_2029749_-	polyhydroxyalkanoate depolymerase	NA	NA	NA	NA	NA
WP_011408316.1|2029889_2030492_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_011408317.1|2030565_2031012_+	CopD family protein	NA	NA	NA	NA	NA
WP_075244058.1|2031089_2031320_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075244057.1|2031309_2031561_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408319.1|2032177_2033467_-	DUF3526 domain-containing protein	NA	NA	NA	NA	NA
WP_011258681.1|2033457_2034870_-	DUF3526 domain-containing protein	NA	NA	NA	NA	NA
WP_011258682.1|2034866_2035604_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	27.6	3.5e-08
WP_042464756.1|2035603_2037784_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_011258685.1|2038623_2039583_-	acetyl-CoA carboxylase carboxyltransferase subunit alpha	NA	NA	NA	NA	NA
WP_011408321.1|2039758_2043349_-	DNA polymerase III subunit alpha	NA	A0A291AVA6	Streptomyces_phage	36.6	4.4e-181
WP_011408322.1|2043806_2044547_-	ribonuclease HII	NA	G9E3X7	Emiliania_huxleyi_virus	38.0	1.6e-24
WP_027703356.1|2044543_2045800_-	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
WP_011258689.1|2045838_2046630_-	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
WP_011258690.1|2046653_2047115_-	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_011408323.1|2047111_2048125_-	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_012445188.1|2048524_2050891_-	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
WP_011408324.1|2050974_2052321_-|protease	RIP metalloprotease RseP	protease	NA	NA	NA	NA
WP_011258694.1|2052347_2053538_-	1-deoxy-D-xylulose-5-phosphate reductoisomerase	NA	NA	NA	NA	NA
WP_011258695.1|2053540_2054368_-	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_027703358.1|2054364_2055126_-	di-trans,poly-cis-decaprenylcistransferase	NA	R9W0U9	Flavobacterium_phage	32.6	3.6e-16
WP_011258697.1|2055143_2055701_-	ribosome recycling factor	NA	NA	NA	NA	NA
WP_011258698.1|2055881_2056604_-	UMP kinase	NA	NA	NA	NA	NA
WP_011408325.1|2056660_2057038_-	HDOD domain-containing protein	NA	NA	NA	NA	NA
WP_011258700.1|2057165_2058044_-	elongation factor Ts	NA	NA	NA	NA	NA
WP_011258701.1|2058213_2059017_-	30S ribosomal protein S2	NA	NA	NA	NA	NA
WP_011408326.1|2059392_2060118_-	molecular chaperone	NA	NA	NA	NA	NA
WP_041182086.1|2060120_2060453_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011258703.1|2060499_2061534_-|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
WP_011258704.1|2061530_2063882_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_011408330.1|2063898_2064669_-	molecular chaperone	NA	NA	NA	NA	NA
WP_099051284.1|2064677_2065229_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
>prophage 13
NC_007705	Xanthomonas oryzae pv. oryzae MAFF 311018, complete genome	4940217	2116365	2243147	4940217	tRNA,transposase	Ralstonia_phage(18.18%)	90	NA	NA
WP_011408357.1|2116365_2117685_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011408358.1|2118019_2118946_-	TolC family protein	NA	NA	NA	NA	NA
WP_011258748.1|2119075_2119681_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011408359.1|2120019_2121789_-	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	30.7	8.0e-59
WP_027703751.1|2121785_2122388_-	YigZ family protein	NA	A0A1X9I5T8	Streptococcus_phage	41.2	4.8e-16
WP_011258751.1|2122646_2123240_-	TIGR00730 family Rossman fold protein	NA	A0A2I2L3F0	Orpheovirus	27.5	3.5e-11
WP_011258752.1|2123438_2124875_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.1	1.3e-38
WP_011258753.1|2125116_2126319_-	dihydrolipoyllysine-residue succinyltransferase	NA	NA	NA	NA	NA
WP_011258754.1|2126361_2129190_-	2-oxoglutarate dehydrogenase E1 component	NA	NA	NA	NA	NA
WP_011408361.1|2129370_2130303_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_011408362.1|2130299_2131799_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_041182090.1|2132136_2132400_+	PDZ domain-containing protein	NA	NA	NA	NA	NA
WP_011258758.1|2132679_2133180_-	DUF3060 domain-containing protein	NA	NA	NA	NA	NA
WP_011258759.1|2133421_2134789_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	48.6	3.3e-113
WP_011408367.1|2140027_2141431_+	class II fumarate hydratase	NA	NA	NA	NA	NA
WP_042464794.1|2141553_2141976_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011258770.1|2142608_2143445_-	DUF4097 family beta strand repeat protein	NA	NA	NA	NA	NA
WP_011408370.1|2143454_2144441_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011258772.1|2144437_2145313_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.9	3.3e-13
WP_011408371.1|2145309_2145672_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_042464800.1|2145674_2145923_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408372.1|2146058_2146616_+	glutathione peroxidase	NA	NA	NA	NA	NA
WP_027703707.1|2146707_2147673_+	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_011408374.1|2147698_2149048_+	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	40.4	2.4e-79
WP_011258777.1|2149040_2149277_+	protein SlyX	NA	NA	NA	NA	NA
WP_042464803.1|2149277_2150030_+	DUF2058 family protein	NA	NA	NA	NA	NA
WP_042464805.1|2150363_2151209_+	transporter	NA	NA	NA	NA	NA
WP_041182423.1|2151349_2152525_+	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_011408378.1|2152538_2153849_+	L-fucose:H+ symporter permease	NA	NA	NA	NA	NA
WP_011408379.1|2153845_2154832_+	carbohydrate kinase	NA	NA	NA	NA	NA
WP_011408380.1|2154828_2156034_+	AGE family epimerase/isomerase	NA	NA	NA	NA	NA
WP_011408381.1|2156420_2159174_-	methionine synthase	NA	NA	NA	NA	NA
WP_011408382.1|2159316_2160456_-	homocysteine S-methyltransferase family protein	NA	A0A140XBC7	Dickeya_phage	66.7	2.2e-17
WP_011258786.1|2160452_2161448_-	metalloregulator ArsR/SmtB family transcription factor	NA	A0A2H4J145	uncultured_Caudovirales_phage	46.9	3.7e-05
WP_011408383.1|2161536_2162718_+	acyl-CoA dehydrogenase family protein	NA	NA	NA	NA	NA
WP_042464808.1|2162717_2162858_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_173340384.1|2163151_2164675_+	acetylhydrolase	NA	M1HKG7	Acanthocystis_turfacea_Chlorella_virus	25.8	1.9e-08
WP_011258790.1|2165241_2167770_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	34.0	4.0e-64
WP_109181926.1|2167980_2168779_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011258793.1|2169849_2170617_+	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_011408388.1|2170618_2170966_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011258802.1|2171124_2172093_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_128896926.1|2172360_2173171_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_109181970.1|2173396_2174362_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_011258802.1|2175714_2176683_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_109181932.1|2177715_2178681_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_109181948.1|2180910_2181876_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_011408397.1|2182320_2183505_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	44.8	5.0e-41
WP_011408398.1|2183559_2185035_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	66.8	2.9e-99
WP_011258799.1|2185356_2185539_-	cold shock domain-containing protein	NA	NA	NA	NA	NA
WP_011258800.1|2185687_2186887_-	homoserine O-acetyltransferase	NA	NA	NA	NA	NA
WP_011258802.1|2187747_2188716_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_109181933.1|2189892_2190995_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.2	1.2e-36
WP_027704061.1|2191181_2191649_-	energy transducer TonB	NA	NA	NA	NA	NA
WP_011408403.1|2192009_2192669_-	energy transducer TonB	NA	NA	NA	NA	NA
WP_011258822.1|2192780_2194130_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	51.6	4.5e-94
WP_094187728.1|2194279_2195078_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011408404.1|2195517_2196837_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011407175.1|2197049_2198018_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	59.7	5.6e-99
WP_011408405.1|2198081_2198666_-	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_011258825.1|2198765_2199779_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_153296745.1|2200469_2200742_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082336051.1|2201148_2204748_-	TAL effector repeat-containing protein	NA	NA	NA	NA	NA
WP_011408408.1|2204887_2205187_-	hypothetical protein	NA	A0A1W6DY99	Xanthomonas_phage	92.4	6.4e-46
WP_042464821.1|2205190_2205385_-	hypothetical protein	NA	A0A1W6DXV7	Xanthomonas_phage	82.3	3.9e-20
WP_115840167.1|2205653_2209460_-	TAL effector repeat-containing protein	NA	NA	NA	NA	NA
WP_011408411.1|2212643_2216771_-	TAL effector protein PthXo1	NA	NA	NA	NA	NA
WP_011408412.1|2217059_2218379_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_042464827.1|2220210_2221296_-	peptidase C13	NA	NA	NA	NA	NA
WP_011408416.1|2221623_2222322_-	acireductone synthase	NA	NA	NA	NA	NA
WP_011408417.1|2222324_2222891_-	acireductone dioxygenase	NA	NA	NA	NA	NA
WP_011408418.1|2222902_2223580_-	methylthioribulose 1-phosphate dehydratase	NA	NA	NA	NA	NA
WP_011408419.1|2223668_2225099_-	amino acid permease	NA	NA	NA	NA	NA
WP_033013325.1|2225175_2226648_-	amino acid permease	NA	NA	NA	NA	NA
WP_011258841.1|2226793_2227381_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_011408423.1|2228973_2230392_+	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_011408424.1|2230426_2230726_+	DUF2388 domain-containing protein	NA	NA	NA	NA	NA
WP_011408425.1|2230722_2232594_+	DUF4105 domain-containing protein	NA	NA	NA	NA	NA
WP_041182103.1|2232883_2233897_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_011258848.1|2233896_2234328_-	cytochrome c-type biogenesis protein CcmH	NA	NA	NA	NA	NA
WP_011258849.1|2234324_2234927_-	DsbE family thiol:disulfide interchange protein	NA	NA	NA	NA	NA
WP_011408426.1|2234919_2236857_-	heme lyase CcmF/NrfE family subunit	NA	NA	NA	NA	NA
WP_011258851.1|2237025_2237496_-	cytochrome c maturation protein CcmE	NA	NA	NA	NA	NA
WP_011258852.1|2237492_2237663_-	heme exporter protein CcmD	NA	NA	NA	NA	NA
WP_011408427.1|2237659_2238412_-	cytochrome c biogenesis protein CcsA	NA	NA	NA	NA	NA
WP_011258853.1|2238506_2239202_-	heme exporter protein CcmB	NA	NA	NA	NA	NA
WP_011408428.1|2239198_2239843_-	heme ABC exporter ATP-binding protein CcmA	NA	G3M9Y6	Bacillus_virus	25.9	3.1e-13
WP_011408429.1|2240069_2241218_+	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_011408430.1|2241357_2242161_+	amidohydrolase	NA	NA	NA	NA	NA
WP_109181928.1|2242181_2243147_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
>prophage 14
NC_007705	Xanthomonas oryzae pv. oryzae MAFF 311018, complete genome	4940217	2341104	2397310	4940217	transposase,coat,tRNA	Xanthomonas_phage(77.78%)	52	NA	NA
WP_011408486.1|2341104_2342547_+|tRNA	histidine--tRNA ligase	tRNA	A0A2K9L6G5	Tupanvirus	28.4	1.0e-40
WP_094187798.1|2343023_2343822_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011258940.1|2344135_2344462_+	trp operon repressor	NA	NA	NA	NA	NA
WP_011258941.1|2344471_2345386_+	ATP phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_011258942.1|2345382_2346678_+	histidinol dehydrogenase	NA	NA	NA	NA	NA
WP_011408488.1|2346674_2347766_+	histidinol-phosphate transaminase	NA	NA	NA	NA	NA
WP_011258944.1|2347762_2348890_+	bifunctional histidinol-phosphatase/imidazoleglycerol-phosphate dehydratase HisB	NA	NA	NA	NA	NA
WP_011258945.1|2348886_2349489_+	imidazole glycerol phosphate synthase subunit HisH	NA	NA	NA	NA	NA
WP_011258946.1|2349485_2350220_+	1-(5-phosphoribosyl)-5-[(5- phosphoribosylamino)methylideneamino]imidazole-4- carboxamide isomerase	NA	NA	NA	NA	NA
WP_011258947.1|2350213_2350990_+	imidazole glycerol phosphate synthase subunit HisF	NA	NA	NA	NA	NA
WP_011258948.1|2350979_2351600_+	bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE	NA	NA	NA	NA	NA
WP_011408490.1|2352185_2356040_-	TAL effector repeat-containing protein	NA	NA	NA	NA	NA
WP_011408491.1|2356264_2356564_-	hypothetical protein	NA	A0A1W6DY99	Xanthomonas_phage	91.3	1.9e-45
WP_042464821.1|2356567_2356762_-	hypothetical protein	NA	A0A1W6DXV7	Xanthomonas_phage	82.3	3.9e-20
WP_145973245.1|2357029_2360413_-	avirulence protein	NA	NA	NA	NA	NA
WP_075239627.1|2361691_2361790_+	SEC-C domain-containing protein	NA	NA	NA	NA	NA
WP_041182117.1|2362543_2362729_+	hypothetical protein	NA	A0A1W6DXV6	Xanthomonas_phage	93.4	8.6e-25
WP_012444935.1|2362728_2362932_+	hypothetical protein	NA	A0A1W6DXK4	Xanthomonas_phage	70.3	6.1e-16
WP_011258952.1|2363067_2364141_+	replication initiation factor domain-containing protein	NA	S0F3F7	Stenotrophomonas_phage	40.9	5.0e-64
WP_011408494.1|2364245_2364545_+	single-stranded DNA-binding protein	NA	S0F3B2	Stenotrophomonas_phage	54.2	3.4e-23
WP_011408495.1|2364908_2365148_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103057497.1|2365254_2366739_+	hypothetical protein	NA	A0A1D6ZIU5	Xanthomonas_phage	40.2	1.4e-40
WP_041182119.1|2366740_2367061_+	DUF2523 domain-containing protein	NA	NA	NA	NA	NA
WP_011408497.1|2367057_2368242_+	hypothetical protein	NA	A0A1W6DXR3	Xanthomonas_phage	37.4	5.2e-54
WP_080493496.1|2368296_2368467_+	hypothetical protein	NA	A0A1D6ZIU7	Xanthomonas_phage	56.0	2.5e-10
WP_075240059.1|2369575_2369836_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408500.1|2370035_2370419_+	hypothetical protein	NA	A0A1D6ZIV0	Xanthomonas_phage	100.0	1.7e-70
WP_011408501.1|2370590_2371238_-	conjugal transfer protein TrbP	NA	A0A1D6ZIU7	Xanthomonas_phage	100.0	3.0e-120
WP_011408502.1|2371239_2372427_-	hypothetical protein	NA	A0A1D6ZIU8	Xanthomonas_phage	100.0	2.8e-217
WP_011408503.1|2372426_2372756_-	DUF2523 domain-containing protein	NA	A0A1D6ZIU0	Xanthomonas_phage	100.0	3.8e-55
WP_042464851.1|2372755_2374162_-	hypothetical protein	NA	A0A1D6ZIU5	Xanthomonas_phage	100.0	6.4e-245
WP_011408505.1|2374298_2374529_-|coat	phage coat protein	coat	A0A1D6ZIT7	Xanthomonas_phage	100.0	1.7e-30
WP_042464854.1|2374540_2374744_-	hypothetical protein	NA	A0A1D6ZIU2	Xanthomonas_phage	100.0	9.8e-30
WP_011408506.1|2374747_2375044_-	DNA-binding protein	NA	A0A1D6ZIU6	Xanthomonas_phage	100.0	3.6e-49
WP_042464857.1|2375040_2375982_-	inovirus-type Gp2 protein	NA	A0A1D6ZIT9	Xanthomonas_phage	100.0	1.0e-182
WP_134953795.1|2376067_2376253_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408508.1|2376233_2376446_-	hypothetical protein	NA	A0A1D6ZIV2	Xanthomonas_phage	100.0	1.6e-27
WP_011408509.1|2376445_2376631_-	hypothetical protein	NA	A0A1D6ZIV1	Xanthomonas_phage	100.0	1.4e-27
WP_069970101.1|2376758_2377388_+	hypothetical protein	NA	A0A1W6DY99	Xanthomonas_phage	80.6	2.5e-71
WP_011408511.1|2377512_2377695_-	hypothetical protein	NA	NA	NA	NA	NA
WP_125168751.1|2377816_2378128_-	hypothetical protein	NA	NA	NA	NA	NA
WP_125168752.1|2379464_2379788_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408516.1|2380401_2380914_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082325281.1|2383030_2386828_+	TAL effector repeat-containing protein	NA	NA	NA	NA	NA
WP_041182100.1|2387096_2387291_+	hypothetical protein	NA	A0A1W6DXV7	Xanthomonas_phage	80.6	2.5e-19
WP_011408491.1|2387294_2387594_+	hypothetical protein	NA	A0A1W6DY99	Xanthomonas_phage	91.3	1.9e-45
WP_128896928.1|2387607_2392653_+	TAL effector repeat-containing protein	NA	NA	NA	NA	NA
WP_012444927.1|2392871_2393048_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_011408520.1|2393044_2393716_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	38.9	5.2e-27
WP_125168753.1|2394741_2394987_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407237.1|2394970_2395927_-|transposase	IS30-like element IS1112a family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.2	2.1e-42
WP_011258802.1|2396341_2397310_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
>prophage 15
NC_007705	Xanthomonas oryzae pv. oryzae MAFF 311018, complete genome	4940217	2558826	2609971	4940217	integrase,transposase,tRNA	Moumouvirus(16.67%)	44	2580057:2580075	2615479:2615497
WP_011408598.1|2558826_2560221_+|tRNA	asparagine--tRNA ligase	tRNA	A0A2P1EMB4	Moumouvirus	39.5	7.6e-81
WP_011259080.1|2560222_2560480_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408599.1|2560476_2560782_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408600.1|2560778_2561105_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408603.1|2561831_2562494_+	carbonate dehydratase	NA	NA	NA	NA	NA
WP_024744799.1|2562582_2563113_+	3-hydroxyanthranilate 3,4-dioxygenase	NA	NA	NA	NA	NA
WP_011408606.1|2565336_2566608_+	kynureninase	NA	NA	NA	NA	NA
WP_011408607.1|2566779_2568147_+	FAD-dependent monooxygenase	NA	NA	NA	NA	NA
WP_011259089.1|2568450_2569896_+	exodeoxyribonuclease I	NA	NA	NA	NA	NA
WP_011259090.1|2569892_2570579_+	DUF2461 domain-containing protein	NA	NA	NA	NA	NA
WP_011259091.1|2570551_2571571_+	aldo/keto reductase	NA	NA	NA	NA	NA
WP_011259092.1|2571612_2572173_+	DUF2939 domain-containing protein	NA	NA	NA	NA	NA
WP_011259093.1|2572193_2573150_-	5'-nucleotidase	NA	NA	NA	NA	NA
WP_011408609.1|2573317_2574094_-	NAD kinase	NA	NA	NA	NA	NA
WP_011408610.1|2574577_2576713_-	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
WP_027703372.1|2576709_2576901_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259098.1|2578675_2579182_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_011259099.1|2579222_2579750_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_011408612.1|2579746_2580238_-	MOSC domain-containing protein	NA	NA	NA	NA	NA
2580057:2580075	attL	CGCTTGCCGCTGCCGCCCT	NA	NA	NA	NA
WP_011408613.1|2580261_2580837_+	N-acetylmuramoyl-L-alanine amidase	NA	NA	NA	NA	NA
WP_011259101.1|2580913_2581867_-	DUF1684 domain-containing protein	NA	NA	NA	NA	NA
WP_011408615.1|2581955_2582828_-	sulfurtransferase	NA	NA	NA	NA	NA
WP_011408616.1|2582824_2583670_-	CoA pyrophosphatase	NA	NA	NA	NA	NA
WP_011408617.1|2583782_2584481_-	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_011408618.1|2584644_2585427_+	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_011408619.1|2585435_2585816_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011259107.1|2585812_2586523_+	endonuclease III	NA	NA	NA	NA	NA
WP_011408621.1|2587833_2588382_-	carbonate dehydratase	NA	NA	NA	NA	NA
WP_011257031.1|2588553_2589522_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	4.3e-99
WP_011408623.1|2590126_2591362_+|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_041182144.1|2591925_2592246_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259109.1|2592585_2593836_+	OprO/OprP family phosphate-selective porin	NA	NA	NA	NA	NA
WP_011408625.1|2594024_2595044_+	phosphate ABC transporter substrate-binding protein PstS	NA	M4SNR3	Cyanophage	38.7	1.6e-48
WP_011408626.1|2595231_2596323_+	phosphate ABC transporter substrate-binding protein PstS	NA	E3SKK5	Synechococcus_phage	39.7	1.1e-47
WP_011408627.1|2596435_2597410_+	phosphate ABC transporter permease subunit PstC	NA	NA	NA	NA	NA
WP_011408628.1|2597409_2598279_+	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_011259114.1|2598301_2599132_+	phosphate ABC transporter ATP-binding protein PstB	NA	W8CYL7	Bacillus_phage	32.6	5.5e-18
WP_011408630.1|2599260_2599971_+	phosphate signaling complex protein PhoU	NA	NA	NA	NA	NA
WP_011259116.1|2600103_2600511_+	RcnB family protein	NA	NA	NA	NA	NA
WP_011259117.1|2600794_2601430_+	ribonuclease T	NA	NA	NA	NA	NA
WP_011408631.1|2601500_2602820_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_042464912.1|2603056_2604118_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011408522.1|2604168_2605353_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	44.8	5.0e-41
WP_011408636.1|2609608_2609971_+|integrase	phage integrase N-terminal SAM-like domain-containing protein	integrase	NA	NA	NA	NA
2615479:2615497	attR	AGGGCGGCAGCGGCAAGCG	NA	NA	NA	NA
>prophage 16
NC_007705	Xanthomonas oryzae pv. oryzae MAFF 311018, complete genome	4940217	2613640	2685912	4940217	protease,transposase,tRNA	uncultured_Mediterranean_phage(33.33%)	51	NA	NA
WP_011259125.1|2613640_2614786_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	46.2	2.2e-86
WP_027703908.1|2614855_2615926_-|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_011259127.1|2616119_2616551_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_011408638.1|2616674_2618171_+	aminotransferase class III-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_011408639.1|2618130_2618445_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259129.1|2618515_2619223_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408645.1|2622548_2623670_-	phytase	NA	NA	NA	NA	NA
WP_011259142.1|2626548_2627181_+	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_011259143.1|2628620_2629652_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_011408648.1|2629658_2631452_-	gamma-glutamyltransferase	NA	NA	NA	NA	NA
WP_011408649.1|2631448_2631733_-	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	57.0	1.4e-18
WP_027703974.1|2631964_2632462_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259147.1|2632508_2633015_-	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	41.1	4.8e-25
WP_012444764.1|2633011_2633698_-	16S rRNA (guanine(966)-N(2))-methyltransferase RsmD	NA	NA	NA	NA	NA
WP_011408651.1|2633872_2635777_+	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	36.8	1.0e-112
WP_109181955.1|2635864_2636922_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_011408654.1|2637019_2638339_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_075239722.1|2638572_2639730_+	molybdopterin-synthase adenylyltransferase MoeB	NA	NA	NA	NA	NA
WP_109181957.1|2640006_2640972_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_109181958.1|2640949_2642425_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	54.8	1.2e-76
WP_011258802.1|2644241_2645210_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_011257031.1|2646124_2647093_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	4.3e-99
WP_075245207.1|2647360_2647594_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_011259163.1|2649474_2650695_-	molybdopterin molybdotransferase MoeA	NA	NA	NA	NA	NA
WP_011259164.1|2651009_2652407_-	ribosome biogenesis GTPase Der	NA	NA	NA	NA	NA
WP_011408657.1|2652417_2653635_-	outer membrane protein assembly factor BamB	NA	NA	NA	NA	NA
WP_011259166.1|2653634_2654273_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_011259167.1|2654343_2655204_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_011408658.1|2655200_2655989_-	type IV pilus biogenesis/stability protein PilW	NA	NA	NA	NA	NA
WP_012445041.1|2655999_2657181_-	23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN	NA	NA	NA	NA	NA
WP_002812972.1|2657223_2657649_-	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	41.7	1.1e-19
WP_011259170.1|2657868_2658501_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011259171.1|2658525_2660898_+	3-hydroxyacyl-CoA dehydrogenase/enoyl-CoA hydratase family protein	NA	NA	NA	NA	NA
WP_011259172.1|2661055_2662261_+	acetyl-CoA C-acyltransferase	NA	NA	NA	NA	NA
WP_011259173.1|2662581_2663913_+	voltage-gated chloride channel family protein	NA	A0A1X9I5Z9	Streptococcus_phage	35.2	1.5e-41
WP_011408659.1|2663909_2664260_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408660.1|2664291_2664699_+	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	49.1	5.7e-21
WP_011259175.1|2664695_2665022_+	DUF190 domain-containing protein	NA	NA	NA	NA	NA
WP_011259176.1|2665053_2666430_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	38.3	6.8e-74
WP_042465563.1|2666666_2670833_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027703232.1|2670945_2671617_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_011259179.1|2671681_2673610_-	DUF3857 and transglutaminase domain-containing protein	NA	NA	NA	NA	NA
WP_011259180.1|2673772_2676133_-	DNA translocase FtsK	NA	G1D482	Mycobacterium_virus	45.8	2.5e-84
WP_011259181.1|2676416_2677385_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.5	5.9e-64
WP_011408662.1|2677442_2678564_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_042465566.1|2679991_2680744_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_002813418.1|2680824_2681043_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_011408664.1|2681323_2683606_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	44.5	4.3e-174
WP_005914463.1|2683749_2684070_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	1.0e-12
WP_011408665.1|2684320_2684779_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_011408666.1|2684775_2685912_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
>prophage 17
NC_007705	Xanthomonas oryzae pv. oryzae MAFF 311018, complete genome	4940217	2766168	2792874	4940217	transposase	Ralstonia_phage(66.67%)	13	NA	NA
WP_011408694.1|2766168_2767488_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011258529.1|2767635_2768604_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	8.7e-100
WP_128896930.1|2768698_2769235_-	DUF3828 domain-containing protein	NA	NA	NA	NA	NA
WP_042464958.1|2769267_2774508_-	type IV secretion protein Rhs	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	39.8	1.6e-09
WP_011407175.1|2776020_2776989_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	59.7	5.6e-99
WP_011408697.1|2777188_2778508_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_125168757.1|2778614_2779094_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408702.1|2787218_2787611_+	c-type cytochrome	NA	NA	NA	NA	NA
WP_042464967.1|2787619_2788081_+	cytochrome c	NA	NA	NA	NA	NA
WP_162013045.1|2788501_2788900_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408705.1|2789634_2789811_-	hypothetical protein	NA	NA	NA	NA	NA
WP_128896931.1|2790603_2791569_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_011408707.1|2791575_2792874_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
>prophage 18
NC_007705	Xanthomonas oryzae pv. oryzae MAFF 311018, complete genome	4940217	2797060	2833641	4940217	tRNA,transposase	Streptococcus_phage(28.57%)	31	NA	NA
WP_042465572.1|2797060_2798017_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.0	4.0e-41
WP_011259267.1|2798819_2799083_+	cytochrome ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_115840191.1|2799224_2800190_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_011259269.1|2800527_2800638_+	cytochrome bd-I oxidase subunit CydX	NA	NA	NA	NA	NA
WP_173340397.1|2800897_2802124_+	MFS transporter	NA	NA	NA	NA	NA
WP_011259272.1|2802104_2804018_-	CocE/NonD family hydrolase	NA	NA	NA	NA	NA
WP_011408714.1|2804385_2805630_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	45.1	2.5e-91
WP_011408715.1|2805794_2806949_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	37.8	1.2e-47
WP_011259275.1|2806962_2807223_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408716.1|2807222_2807588_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_011408717.1|2807587_2808883_-	argininosuccinate lyase	NA	NA	NA	NA	NA
WP_011408718.1|2809006_2809957_-	N-acetyl-gamma-glutamyl-phosphate reductase	NA	NA	NA	NA	NA
WP_011408720.1|2810569_2811913_-	acetylglutamate kinase	NA	NA	NA	NA	NA
WP_011408721.1|2811952_2813053_-	acetylornithine deacetylase	NA	NA	NA	NA	NA
WP_011408722.1|2813058_2813511_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_011408723.1|2813752_2814994_-	argininosuccinate synthase	NA	NA	NA	NA	NA
WP_011259283.1|2815065_2816091_-	N-acetylornithine carbamoyltransferase	NA	NA	NA	NA	NA
WP_027703614.1|2816403_2816898_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012444736.1|2817074_2818499_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.5	1.1e-42
WP_011408724.1|2818996_2819434_+	SufE family protein	NA	NA	NA	NA	NA
WP_011259287.1|2819430_2820681_+	MFS transporter	NA	NA	NA	NA	NA
WP_011259288.1|2820748_2821810_-	S41 family peptidase	NA	NA	NA	NA	NA
WP_075242610.1|2821952_2822993_-	RNA polymerase-binding protein DksA	NA	NA	NA	NA	NA
WP_011408727.1|2823077_2823365_+	membrane protein insertion efficiency factor YidD	NA	NA	NA	NA	NA
WP_011408728.1|2823361_2824711_+	dihydroorotase	NA	NA	NA	NA	NA
WP_011408729.1|2824710_2825550_+	M23 family metallopeptidase	NA	A0A075BS18	Microcystis_phage	41.2	2.4e-13
WP_011259294.1|2827237_2827501_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407587.1|2828222_2829257_-|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	32.8	8.0e-43
WP_011408733.1|2829700_2831017_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011257031.1|2831216_2832185_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	4.3e-99
WP_011408734.1|2832321_2833641_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
>prophage 19
NC_007705	Xanthomonas oryzae pv. oryzae MAFF 311018, complete genome	4940217	2865473	2925740	4940217	protease,transposase,tRNA	Bacillus_virus(22.22%)	47	NA	NA
WP_011259328.1|2865473_2866352_-|protease	protease HtpX	protease	NA	NA	NA	NA
WP_011259329.1|2866449_2867349_+|tRNA	tRNA glutamyl-Q(34) synthetase GluQRS	tRNA	NA	NA	NA	NA
WP_011408747.1|2867436_2868177_+	beta-ketoacyl-ACP reductase	NA	NA	NA	NA	NA
WP_011259331.1|2868336_2868912_+	polyhydroxyalkanoate synthesis repressor PhaR	NA	NA	NA	NA	NA
WP_011408749.1|2869085_2870057_-	TraB/GumN family protein	NA	NA	NA	NA	NA
WP_011408750.1|2870090_2871032_-	DUF1684 domain-containing protein	NA	NA	NA	NA	NA
WP_011259334.1|2871031_2872909_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	35.2	1.4e-85
WP_027703275.1|2873046_2874762_-	N-acetylmuramoyl-L-alanine amidase	NA	A6XML1	Bacillus_virus	28.4	4.0e-15
WP_011259336.1|2874832_2875333_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
WP_011259337.1|2875329_2876817_-	bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase	NA	NA	NA	NA	NA
WP_011408752.1|2876841_2877909_+|tRNA	tRNA epoxyqueuosine(34) reductase QueG	tRNA	NA	NA	NA	NA
WP_011408753.1|2878054_2879392_+	exodeoxyribonuclease VII large subunit	NA	A0A1V0SD82	Indivirus	36.2	1.3e-37
WP_011259340.1|2879687_2880950_-	virulence factor	NA	NA	NA	NA	NA
WP_094187754.1|2881166_2881914_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_041182165.1|2882230_2884066_-	formylglycine-generating enzyme family protein	NA	A0A075BSL8	Microcystis_phage	33.1	5.6e-23
WP_011408756.1|2884337_2885429_+	ribonuclease D	NA	NA	NA	NA	NA
WP_011259345.1|2886521_2886923_+	H-NS histone family protein	NA	NA	NA	NA	NA
WP_015463309.1|2887786_2887966_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027703932.1|2888567_2888858_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_011408759.1|2888845_2889124_-	CopG family ribbon-helix-helix protein	NA	NA	NA	NA	NA
WP_027703931.1|2889608_2889809_-	ribbon-helix-helix protein, CopG family	NA	NA	NA	NA	NA
WP_011408760.1|2890569_2891754_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	45.4	1.0e-41
WP_109181928.1|2892334_2893300_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_042465594.1|2897864_2898209_+	DUF3301 domain-containing protein	NA	NA	NA	NA	NA
WP_011408764.1|2898419_2898746_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259352.1|2898778_2899219_-|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	46.2	9.3e-25
WP_011259353.1|2899297_2899933_-	glutathione S-transferase N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_011259354.1|2900326_2901085_-	cytochrome c1	NA	NA	NA	NA	NA
WP_011259355.1|2901077_2902337_-	cytochrome bc complex cytochrome b subunit	NA	NA	NA	NA	NA
WP_011259356.1|2902336_2902981_-	ubiquinol-cytochrome c reductase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_011259357.1|2903510_2904497_-	lytic transglycosylase domain-containing protein	NA	A0A0H3V0Q1	Geobacillus_virus	56.0	1.3e-29
WP_011408766.1|2906424_2907879_+|tRNA	tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB	tRNA	NA	NA	NA	NA
WP_011408767.1|2908302_2909289_+	PhoH family protein	NA	W8D063	Erwinia_phage	47.7	2.5e-46
WP_011259362.1|2909700_2910363_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011259363.1|2910417_2910903_+	rRNA maturation RNase YbeY	NA	NA	NA	NA	NA
WP_011408769.1|2910902_2911421_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408770.1|2911515_2912394_+	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_011259366.1|2912390_2913671_+	DUF4105 domain-containing protein	NA	NA	NA	NA	NA
WP_011259367.1|2913686_2914688_+	magnesium and cobalt transport protein CorA	NA	NA	NA	NA	NA
WP_011408772.1|2914839_2916204_-	NAD-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_011408773.1|2916458_2916869_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408774.1|2917024_2917855_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_011408776.1|2918168_2919416_-	polyamine ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	35.3	1.2e-24
WP_011408777.1|2919561_2921055_-	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_011408778.1|2921059_2922646_-	multidrug efflux MFS transporter	NA	NA	NA	NA	NA
WP_011408779.1|2922642_2923845_-	HlyD family secretion protein	NA	NA	NA	NA	NA
WP_115892987.1|2924288_2925740_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
>prophage 20
NC_007705	Xanthomonas oryzae pv. oryzae MAFF 311018, complete genome	4940217	2953198	3035863	4940217	transposase	Ralstonia_phage(41.67%)	57	NA	NA
WP_011408791.1|2953198_2954182_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.5	1.4e-97
WP_011408792.1|2954630_2959655_-	NAD-glutamate dehydrogenase	NA	NA	NA	NA	NA
WP_011408793.1|2959932_2960592_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011408794.1|2960606_2961911_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_011259395.1|2961923_2965094_+	multidrug efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_115892988.1|2966069_2967026_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_011408798.1|2967732_2968728_-	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_011408799.1|2968888_2971405_+	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	28.5	6.3e-09
WP_011259401.1|2971401_2972358_+	1-phosphofructokinase family hexose kinase	NA	NA	NA	NA	NA
WP_011259402.1|2972516_2974259_+	PTS fructose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_012444645.1|2974436_2975714_+	carbohydrate porin	NA	NA	NA	NA	NA
WP_011258802.1|2976272_2977241_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_011408801.1|2977526_2978420_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.5	1.6e-95
WP_155296181.1|2978534_2978690_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408802.1|2978714_2981060_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041182891.1|2981077_2981809_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408803.1|2981840_2984183_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014503414.1|2984207_2984936_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408804.1|2984964_2987307_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042465604.1|2987331_2988075_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408806.1|2988105_2990448_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041182173.1|2990472_2991210_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408808.1|2991235_2994070_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259405.1|2994066_2994996_-	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_011408809.1|2995004_2997767_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	27.5	6.6e-44
WP_011408811.1|2999332_3001924_-	TAL effector repeat-containing protein	NA	NA	NA	NA	NA
WP_011258529.1|3002092_3003061_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	8.7e-100
WP_011408812.1|3003123_3003513_-	phage late control D family protein	NA	NA	NA	NA	NA
WP_157724569.1|3003673_3004627_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011408814.1|3004559_3004874_+	DUF1153 domain-containing protein	NA	NA	NA	NA	NA
WP_011408815.1|3005101_3006421_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011259409.1|3007525_3007942_-	type I toxin-antitoxin system SymE family toxin	NA	NA	NA	NA	NA
WP_011259410.1|3007938_3008385_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259411.1|3008627_3009263_+	hypothetical protein	NA	NA	NA	NA	NA
WP_175576424.1|3009361_3009955_-	DUF4868 domain-containing protein	NA	NA	NA	NA	NA
WP_011258802.1|3010149_3011118_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_125168758.1|3011774_3012275_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042465618.1|3012583_3015685_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_042465003.1|3016674_3017127_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408823.1|3017381_3019187_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_128415369.1|3019188_3019536_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408824.1|3019611_3020319_+	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	51.2	1.1e-51
WP_011408825.1|3020470_3020863_+	TonB-dependent receptor plug domain-containing protein	NA	NA	NA	NA	NA
WP_075242238.1|3020885_3021401_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_027703781.1|3021397_3021751_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011259417.1|3021839_3022580_+	flagellar motor protein	NA	NA	NA	NA	NA
WP_011408827.1|3022586_3023561_+	flagellar motor protein MotD	NA	NA	NA	NA	NA
WP_011259419.1|3023562_3024345_+	ParA family protein	NA	Q8JL10	Natrialba_phage	37.7	1.0e-13
WP_042465006.1|3024341_3025364_+	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_011259421.1|3025464_3025773_+	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_002806565.1|3025769_3026135_+	response regulator	NA	W8CYM9	Bacillus_phage	39.3	2.7e-14
WP_011408829.1|3026168_3028178_+	chemotaxis protein CheA	NA	NA	NA	NA	NA
WP_011408830.1|3028345_3028600_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_075242680.1|3030278_3030968_+	chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	33.3	8.3e-12
WP_011408833.1|3031283_3032045_+	transporter	NA	NA	NA	NA	NA
WP_011408834.1|3032058_3034401_+	chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	63.2	4.5e-09
WP_115840174.1|3034897_3035863_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
>prophage 21
NC_007705	Xanthomonas oryzae pv. oryzae MAFF 311018, complete genome	4940217	3134774	3146550	4940217	tRNA	Escherichia_phage(22.22%)	12	NA	NA
WP_011259503.1|3134774_3135074_-	endolysin	NA	A0A1W6JT17	Escherichia_phage	66.7	1.5e-15
WP_011259504.1|3135116_3135347_-	endolysin	NA	D5LH07	Escherichia_phage	63.8	4.7e-20
WP_011259505.1|3135590_3136340_-	isopentenyl transferase	NA	NA	NA	NA	NA
WP_011408881.1|3136344_3137040_-	hypothetical protein	NA	E5DV83	Deep-sea_thermophilic_phage	41.0	5.6e-16
WP_012444559.1|3137225_3137525_-	hypothetical protein	NA	NA	NA	NA	NA
WP_103057240.1|3137912_3138317_-	helix-turn-helix domain-containing protein	NA	A0A1W6JTD5	Pseudomonas_phage	56.6	1.1e-32
WP_003481884.1|3139042_3139255_-	carbon storage regulator CsrA	NA	J7I430	Pseudomonas_phage	76.5	1.3e-13
WP_011259507.1|3139394_3142043_-|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	39.6	3.7e-84
WP_011408883.1|3142151_3142634_-	recombination regulator RecX	NA	NA	NA	NA	NA
WP_011408884.1|3142936_3143971_-	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	60.7	6.2e-112
WP_011408885.1|3144143_3144785_-	transcriptional repressor LexA	NA	A0A1W6JNS2	Morganella_phage	40.2	2.4e-13
WP_011408886.1|3144873_3146550_-	2-polyprenylphenol 6-hydroxylase	NA	E5EQ95	Micromonas_sp._RCC1109_virus	27.2	3.3e-38
>prophage 22
NC_007705	Xanthomonas oryzae pv. oryzae MAFF 311018, complete genome	4940217	3268613	3349218	4940217	plate,transposase	Ralstonia_phage(66.67%)	60	NA	NA
WP_011408949.1|3268613_3269951_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_011408950.1|3269947_3271339_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_011408951.1|3271335_3271875_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012444497.1|3271883_3273821_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	28.6	3.4e-39
WP_011408952.1|3274085_3274544_-	hypothetical protein	NA	NA	NA	NA	NA
WP_125168760.1|3274930_3275425_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027703476.1|3275490_3275988_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408953.1|3276176_3278882_-	type VI secretion system ATPase TssH	NA	H6X3M6	Enterobacteria_phage	29.3	4.3e-80
WP_011408954.1|3278914_3279925_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_011259602.1|3279888_3281766_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_011259603.1|3281769_3282273_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_011259604.1|3282260_3283094_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259605.1|3283129_3283633_-	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_027703472.1|3283732_3285247_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_024711387.1|3285239_3285746_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_011257031.1|3287104_3288073_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	4.3e-99
WP_011408959.1|3289339_3290575_+|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_011258802.1|3290760_3291729_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_011408960.1|3291780_3293697_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259611.1|3293721_3294459_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408961.1|3294489_3296832_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042465640.1|3296849_3297596_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042465052.1|3297624_3300459_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042465054.1|3301116_3302946_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408965.1|3302959_3303559_-	NfuA family Fe-S biogenesis protein	NA	NA	NA	NA	NA
WP_011408966.1|3303647_3304004_+	4a-hydroxytetrahydrobiopterin dehydratase	NA	NA	NA	NA	NA
WP_011259617.1|3304000_3304423_+	energy transducer TonB	NA	NA	NA	NA	NA
WP_011408967.1|3304438_3304672_+	ZIP family metal transporter	NA	NA	NA	NA	NA
WP_011408968.1|3304698_3304959_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011259618.1|3305274_3307098_+	DUF3300 domain-containing protein	NA	NA	NA	NA	NA
WP_011259619.1|3307130_3308117_-	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
WP_042465057.1|3308527_3312241_+	Rne/Rng family ribonuclease	NA	NA	NA	NA	NA
WP_011408972.1|3313633_3314281_-	response regulator	NA	NA	NA	NA	NA
WP_011408973.1|3314502_3315264_-	sulfurtransferase	NA	NA	NA	NA	NA
WP_011258802.1|3315421_3316390_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_011408974.1|3316523_3316889_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408975.1|3316947_3317379_+	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_011259625.1|3317390_3318653_+	TIGR03862 family flavoprotein	NA	NA	NA	NA	NA
WP_011408976.1|3318636_3319929_-	nucleotide sugar dehydrogenase	NA	NA	NA	NA	NA
WP_027703968.1|3320415_3321069_+	4'-phosphopantetheinyl transferase superfamily protein	NA	NA	NA	NA	NA
WP_011259629.1|3321825_3323061_-|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_011408979.1|3324360_3324618_-	stress-induced protein	NA	NA	NA	NA	NA
WP_011408980.1|3325057_3326041_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	61.2	7.5e-99
WP_011257031.1|3326356_3327325_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	4.3e-99
WP_011408981.1|3327453_3328416_+|transposase	IS1595-like element ISXo2 family transposase	transposase	NA	NA	NA	NA
WP_153296740.1|3328665_3328824_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041182195.1|3328855_3329035_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109181928.1|3329399_3330365_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_011408984.1|3330930_3331182_-	ANTAR domain-containing protein	NA	NA	NA	NA	NA
WP_042465067.1|3331240_3331432_-	response regulator	NA	NA	NA	NA	NA
WP_011408985.1|3331572_3332550_+	siroheme synthase	NA	NA	NA	NA	NA
WP_042465070.1|3333358_3333553_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408987.1|3334946_3335309_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408988.1|3335292_3335862_-	molybdenum cofactor guanylyltransferase	NA	NA	NA	NA	NA
WP_173340398.1|3335899_3337174_-	molybdopterin molybdotransferase MoeA	NA	NA	NA	NA	NA
WP_011408989.1|3337358_3337736_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408991.1|3339664_3340900_+|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_011407587.1|3341737_3342772_+|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	32.8	8.0e-43
WP_011408994.1|3343447_3345823_-	glycoside hydrolase family 127 protein	NA	NA	NA	NA	NA
WP_011408998.1|3348033_3349218_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	45.4	1.7e-41
>prophage 23
NC_007705	Xanthomonas oryzae pv. oryzae MAFF 311018, complete genome	4940217	3497086	3570939	4940217	protease,transposase,tRNA	Paramecium_bursaria_Chlorella_virus(12.5%)	56	NA	NA
WP_011259765.1|3497086_3497860_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_075241401.1|3498433_3500386_-	ferrous iron transporter B	NA	NA	NA	NA	NA
WP_011259769.1|3501066_3502092_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_011409070.1|3502176_3503250_-	D-glycerate dehydrogenase	NA	M1HTA3	Paramecium_bursaria_Chlorella_virus	23.2	2.1e-14
WP_011259771.1|3503242_3504346_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	40.4	1.6e-73
WP_011259772.1|3504356_3505283_-	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_011259773.1|3505363_3506014_+	SCO family protein	NA	NA	NA	NA	NA
WP_011409071.1|3506010_3506859_+	phosphatidylserine decarboxylase	NA	NA	NA	NA	NA
WP_041182211.1|3507409_3508993_-	transglycosylase SLT domain-containing protein	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	31.5	4.2e-11
WP_011409076.1|3511991_3512498_+	transcription elongation factor GreB	NA	NA	NA	NA	NA
WP_011259780.1|3512619_3514020_-	30S ribosomal protein S12 methylthiotransferase RimO	NA	NA	NA	NA	NA
WP_011409077.1|3514282_3514858_+	dienelactone hydrolase family protein	NA	NA	NA	NA	NA
WP_011409078.1|3514854_3515289_+	HIT family protein	NA	NA	NA	NA	NA
WP_011259782.1|3515316_3515484_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011259783.1|3516093_3516279_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011259784.1|3516313_3516883_-	dCTP deaminase	NA	S5VM63	Pseudomonas_phage	70.1	2.6e-72
WP_011259785.1|3516975_3517827_-	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_011259787.1|3519214_3521230_+	M13 family metallopeptidase	NA	NA	NA	NA	NA
WP_012445555.1|3521500_3522199_-|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_011409081.1|3522239_3522647_-	MGMT family protein	NA	NA	NA	NA	NA
WP_011409082.1|3523084_3524047_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_011409084.1|3525330_3526581_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_011409085.1|3526588_3527833_-	DUF418 domain-containing protein	NA	NA	NA	NA	NA
WP_011259794.1|3528060_3528540_-	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_027704197.1|3528650_3529187_+	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	40.5	3.2e-19
WP_011259796.1|3529296_3530046_+	C40 family peptidase	NA	A0A0K2SUC1	Clostridium_phage	38.5	1.2e-19
WP_011259797.1|3530253_3530745_-	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_011409088.1|3531858_3533178_-	dicarboxylate/amino acid:cation symporter	NA	NA	NA	NA	NA
WP_011409089.1|3533321_3535028_+	alkaline phosphatase	NA	NA	NA	NA	NA
WP_011409090.1|3535061_3536366_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_011259802.1|3536397_3536658_+	exodeoxyribonuclease VII small subunit	NA	NA	NA	NA	NA
WP_011409091.1|3536659_3537535_+	polyprenyl synthetase family protein	NA	NA	NA	NA	NA
WP_027704198.1|3539369_3539834_-	DUF4870 domain-containing protein	NA	NA	NA	NA	NA
WP_012445570.1|3539885_3540074_-	DUF4870 domain-containing protein	NA	NA	NA	NA	NA
WP_069963878.1|3540046_3540367_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042465665.1|3540363_3541731_-|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
WP_011409095.1|3541876_3542458_+	ribosome-associated protein	NA	NA	NA	NA	NA
WP_011259808.1|3542714_3544160_-|protease	metalloprotease TldD	protease	NA	NA	NA	NA
WP_011409097.1|3545006_3548927_-	TIGR02099 family protein	NA	NA	NA	NA	NA
WP_011259814.1|3549060_3550560_-	ribonuclease G	NA	NA	NA	NA	NA
WP_011409098.1|3550559_3551132_-	Maf-like protein	NA	NA	NA	NA	NA
WP_011409099.1|3551270_3552005_+	SIMPL domain-containing protein	NA	NA	NA	NA	NA
WP_011409100.1|3552476_3555590_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_011409102.1|3557008_3557479_-	23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH	NA	NA	NA	NA	NA
WP_162013046.1|3558063_3558507_+	DUF839 domain-containing protein	NA	NA	NA	NA	NA
WP_011259821.1|3558564_3559680_-	J domain-containing protein	NA	NA	NA	NA	NA
WP_011259822.1|3559691_3560108_-	ribosome silencing factor	NA	NA	NA	NA	NA
WP_011409104.1|3560164_3561064_-	nicotinate-nucleotide adenylyltransferase	NA	NA	NA	NA	NA
WP_011259823.1|3561060_3562089_-	DNA polymerase III subunit delta	NA	NA	NA	NA	NA
WP_011409105.1|3562111_3562747_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409106.1|3563260_3565903_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	39.7	2.7e-172
WP_011259826.1|3565975_3566587_-	DUF998 domain-containing protein	NA	NA	NA	NA	NA
WP_011409107.1|3566791_3567649_+	thioredoxin	NA	A0A1J0GW78	Streptomyces_phage	41.8	1.3e-11
WP_011409108.1|3567904_3568354_+	DUF4442 domain-containing protein	NA	NA	NA	NA	NA
WP_011257570.1|3568710_3569946_+|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_109181928.1|3569973_3570939_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
>prophage 24
NC_007705	Xanthomonas oryzae pv. oryzae MAFF 311018, complete genome	4940217	3574733	3674073	4940217	integrase,tRNA,transposase	Ralstonia_phage(28.57%)	57	3587369:3587428	3604042:3604705
WP_011409112.1|3574733_3576053_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_041182217.1|3576140_3577355_-|transposase	IS4-like element ISXo14 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	33.4	1.1e-54
WP_011259834.1|3577500_3578028_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011409116.1|3580295_3582428_+	glycogen debranching protein GlgX	NA	NA	NA	NA	NA
WP_011258802.1|3582978_3583947_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_011258802.1|3584107_3585076_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_162013047.1|3586176_3586566_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
3587369:3587428	attL	CTAGCATCTACGCGCATCCGCGTGGGGGCTTGAAGAAGGAACTGGTCCAGGCCCTGCGTC	NA	NA	NA	NA
WP_011409118.1|3589029_3589422_-	H-NS histone family protein	NA	NA	NA	NA	NA
WP_027704094.1|3589512_3589905_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075239728.1|3592243_3592663_+|integrase	tyrosine-type recombinase/integrase	integrase	C8CLF4	Xylella_phage	65.2	5.1e-41
WP_012445601.1|3594380_3596165_-	autotransporter domain-containing esterase	NA	NA	NA	NA	NA
WP_011259851.1|3596355_3596556_+	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
WP_011409125.1|3597091_3597886_+	thiazole synthase	NA	NA	NA	NA	NA
WP_011259853.1|3598187_3598946_+|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_011409126.1|3599021_3600884_+	SLC13 family permease	NA	NA	NA	NA	NA
WP_011409127.1|3600941_3601283_-	Rieske (2Fe-2S) protein	NA	NA	NA	NA	NA
WP_011259856.1|3601542_3601818_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011409129.1|3604865_3605579_+	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
3604042:3604705	attR	CTAGCATCTACGCGCATCCGCGTGGGGGCTTGAAGAAGGAACTGGTCCAGGCCCTGCGTCAGCACAAGCCCAAACGCGGATGACGGCGTACAACGGCGGCCACACGCAGCTGGGTGCCGGAGGAGTTGCGGATTGTGCATCGCCCCGAAGAAGTGCAGACGCGCTTGGTCCCAGGTCATTGGGAAGGCGACTTGATCAAGGGCGCATTCAATCGTTCTTGCGTGGGCACGTTGGTGGAACGCAAGACGCGCTTTGTCGTGCTGTGCCGCATGGATGGCTGCACGGCCGCAGATGCGCTGGAAGGGTTTACCCGGCAAATGAAGAAACTGCCGGCCTCAATGCGGACAAGTCTGACCTACGATCGCGGTACCGAGCTCACGTGCTACGCCGAGCTGATGCAAGGATTGAACATCGACGTGTGGTTCGCTGATCCACATGCGCCGTGGCAGCGGGGAAGTAACGAGAACACCAACGGCCTGCTGCGCCAATTCCTGCCCAAGGGCGCCGACCTGTCCACTGTCAGCCAAGAGTATCTCAATCACATCGCACTGCTGATGAATACCCGCCCTCGTCAGACGCTCGGATGGAAGACACCAAGCGAGGCAATGGAGGAAGAAATCGCAGCACTCAAATCACGTGTTGCACTTGAATCTTGAGACTGCCC	NA	NA	NA	NA
WP_011409130.1|3605639_3606062_+	large-conductance mechanosensitive channel protein MscL	NA	NA	NA	NA	NA
WP_011409134.1|3610032_3610944_-	RNA methyltransferase	NA	NA	NA	NA	NA
WP_115801902.1|3612292_3613258_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_042465131.1|3614137_3616807_-	M1 family metallopeptidase	NA	A0A0P0IY26	Acinetobacter_phage	48.5	9.6e-242
WP_011409139.1|3617158_3620284_-	efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	22.8	4.1e-74
WP_011409140.1|3620280_3621351_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_027704223.1|3621785_3623699_-	sulfate adenylyltransferase subunit CysN	NA	A0A1V0SGC3	Hokovirus	30.6	5.4e-29
WP_011259870.1|3623761_3624670_-	sulfate adenylyltransferase subunit CysD	NA	NA	NA	NA	NA
WP_011409142.1|3624850_3626698_+	assimilatory sulfite reductase (NADPH) flavoprotein subunit	NA	NA	NA	NA	NA
WP_011409143.1|3626806_3628528_+	assimilatory sulfite reductase (NADPH) hemoprotein subunit	NA	NA	NA	NA	NA
WP_011259873.1|3628524_3629250_+	phosphoadenylyl-sulfate reductase	NA	NA	NA	NA	NA
WP_011409144.1|3629385_3630978_-	PepSY domain-containing protein	NA	NA	NA	NA	NA
WP_041182223.1|3630977_3632981_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_012445616.1|3633175_3633613_-	DUF2946 family protein	NA	NA	NA	NA	NA
WP_011259877.1|3633935_3635132_+	GAF domain-containing sensor histidine kinase	NA	NA	NA	NA	NA
WP_011259878.1|3636202_3636484_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259879.1|3636494_3637478_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011259880.1|3637646_3638852_+	uroporphyrinogen-III C-methyltransferase	NA	NA	NA	NA	NA
WP_011259881.1|3638868_3639828_+	cysteine synthase A	NA	A0A1X9I5F1	Streptococcus_phage	49.0	3.8e-79
WP_041182224.1|3639851_3640103_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011259882.1|3640127_3640634_+	isoprenylcysteine carboxylmethyltransferase family protein	NA	NA	NA	NA	NA
WP_041182225.1|3640829_3641369_+	O-acetyl-ADP-ribose deacetylase	NA	A0A0K1L687	Scale_drop_disease_virus	42.6	9.9e-29
WP_011259884.1|3641570_3642575_-	fructose-bisphosphate aldolase class I	NA	A0A0K0KVJ8	Prochlorococcus_phage	48.2	3.9e-79
WP_011409145.1|3643157_3644624_-	pyruvate kinase	NA	NA	NA	NA	NA
WP_011259886.1|3644880_3645525_-	HAD family hydrolase	NA	NA	NA	NA	NA
WP_011259887.1|3645521_3646697_-	phosphoglycerate kinase	NA	NA	NA	NA	NA
WP_011409146.1|3647030_3648389_-	DUF3999 domain-containing protein	NA	NA	NA	NA	NA
WP_042465134.1|3648385_3651241_-	DUF2339 domain-containing protein	NA	NA	NA	NA	NA
WP_075242205.1|3653016_3653190_+	oxidoreductase	NA	NA	NA	NA	NA
WP_011409150.1|3653407_3655513_+	catalase	NA	A0A2K9L572	Tupanvirus	47.7	4.3e-136
WP_042465674.1|3656338_3657577_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042465136.1|3657804_3659946_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407175.1|3660708_3661677_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	59.7	5.6e-99
WP_011407587.1|3662697_3663732_+|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	32.8	8.0e-43
WP_011259895.1|3664115_3664841_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_011409154.1|3664972_3665434_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027704153.1|3668880_3671001_-	S9 family peptidase	NA	NA	NA	NA	NA
WP_027704154.1|3671267_3672113_-	transporter	NA	NA	NA	NA	NA
WP_011257031.1|3673104_3674073_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	4.3e-99
>prophage 25
NC_007705	Xanthomonas oryzae pv. oryzae MAFF 311018, complete genome	4940217	3686848	3750947	4940217	plate,transposase	Liberibacter_phage(20.0%)	47	NA	NA
WP_094187731.1|3686848_3687646_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011409167.1|3688723_3689503_-	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_011409168.1|3689717_3690347_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_027704159.1|3690407_3691163_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041182227.1|3691491_3692268_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041182229.1|3692676_3694251_+	protein kinase	NA	NA	NA	NA	NA
WP_011409172.1|3694499_3694766_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409173.1|3695044_3698224_-	type I restriction endonuclease subunit R	NA	A0A220A398	Liberibacter_phage	30.3	1.2e-73
WP_011409174.1|3698223_3698898_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409175.1|3698897_3699644_-	abortive infection family protein	NA	NA	NA	NA	NA
WP_128896939.1|3699640_3700231_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_011258803.1|3700341_3701310_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	1.5e-99
WP_113063277.1|3701312_3701624_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_011409177.1|3701675_3702644_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	1.9e-99
WP_011409179.1|3703464_3703899_-	nucleotidyltransferase substrate binding protein	NA	NA	NA	NA	NA
WP_041182476.1|3703909_3705439_-	SAM-dependent DNA methyltransferase	NA	A0A2H4PQP4	Staphylococcus_phage	29.3	2.5e-45
WP_011409181.1|3705741_3706734_-	restriction endonuclease	NA	A0A1B1IUE7	uncultured_Mediterranean_phage	29.2	1.5e-30
WP_011259923.1|3706786_3707095_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_011409182.1|3707101_3707365_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042465160.1|3707674_3711148_+	type I restriction-modification system endonuclease	NA	A0A1B1IW48	uncultured_Mediterranean_phage	21.9	1.9e-08
WP_011409184.1|3711287_3712286_+	Abi family protein	NA	NA	NA	NA	NA
WP_011409185.1|3712332_3713877_+	N-6 DNA methylase	NA	A0A220A2U5	Liberibacter_phage	23.9	2.0e-13
WP_042465683.1|3714775_3715222_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_011259929.1|3715255_3715564_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_011259930.1|3715570_3715834_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042465163.1|3717605_3718628_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409190.1|3718908_3719865_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	34.9	2.4e-41
WP_011409192.1|3722189_3723221_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409193.1|3723229_3725167_-	DUF3784 domain-containing protein	NA	NA	NA	NA	NA
WP_011409194.1|3725078_3726098_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409195.1|3726102_3728046_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409196.1|3727957_3728980_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409198.1|3730944_3731970_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409199.1|3731973_3734841_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042465165.1|3734859_3735705_-	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_011409201.1|3735706_3738469_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	27.4	9.6e-43
WP_011259938.1|3738562_3738916_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259939.1|3738946_3741676_-	type VI secretion system ATPase TssH	NA	A0A223W0B1	Agrobacterium_phage	29.6	7.1e-91
WP_011259940.1|3741761_3742853_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_011409202.1|3742816_3744652_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_011409203.1|3744654_3745143_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_003467612.1|3745290_3745788_-	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_011409204.1|3745929_3747426_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_003467601.1|3747429_3747930_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_011409205.1|3747976_3748591_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409206.1|3748852_3749461_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_011409207.1|3749612_3750947_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
>prophage 26
NC_007705	Xanthomonas oryzae pv. oryzae MAFF 311018, complete genome	4940217	4133179	4158671	4940217	transposase	Ralstonia_phage(60.0%)	17	NA	NA
WP_177313986.1|4133179_4134919_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_075242322.1|4134948_4135212_+	HAMP domain-containing protein	NA	NA	NA	NA	NA
WP_075242321.1|4135216_4135876_+	histidine kinase	NA	W8CYF6	Bacillus_phage	23.4	7.1e-13
WP_011260279.1|4136062_4137427_-	glutamate--cysteine ligase	NA	NA	NA	NA	NA
WP_011409411.1|4137642_4138338_+	VIT family protein	NA	NA	NA	NA	NA
WP_011409413.1|4139284_4139908_-	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_011260283.1|4140052_4140850_+	cytochrome c4	NA	NA	NA	NA	NA
WP_011409415.1|4140943_4141594_+	thiol:disulfide interchange protein DsbA/DsbL	NA	NA	NA	NA	NA
WP_011260284.1|4141685_4142501_+	thiol:disulfide interchange protein DsbA/DsbL	NA	NA	NA	NA	NA
WP_011409416.1|4142550_4143288_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_011409419.1|4145216_4146206_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	61.2	7.5e-99
WP_041182588.1|4146328_4148902_+	pyridoxal-phosphate dependent enzyme	NA	NA	NA	NA	NA
WP_011258802.1|4149930_4150899_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_011257031.1|4151519_4152488_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	4.3e-99
WP_011409421.1|4152792_4153059_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_011260292.1|4156436_4157669_+	multifunctional CCA addition/repair protein	NA	K4IEX3	Salmonella_phage	41.7	2.0e-72
WP_011409423.1|4157708_4158671_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
>prophage 27
NC_007705	Xanthomonas oryzae pv. oryzae MAFF 311018, complete genome	4940217	4326452	4426178	4940217	tRNA,transposase	Leptospira_phage(30.0%)	84	NA	NA
WP_128896941.1|4326452_4327555_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.4	2.1e-41
WP_011409513.1|4327603_4328452_-	amino acid lyase	NA	NA	NA	NA	NA
WP_011409514.1|4328486_4329962_-	anthranilate synthase component I	NA	S4VT78	Pandoravirus	32.5	3.1e-40
WP_011260408.1|4330552_4331482_-	lipid kinase YegS	NA	NA	NA	NA	NA
WP_011260409.1|4331716_4332208_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_011409515.1|4332204_4332906_-	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_011409516.1|4333270_4333600_-	DnaJ domain-containing protein	NA	NA	NA	NA	NA
WP_012444032.1|4333808_4334735_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0M4JBD3	Mollivirus	34.7	3.9e-49
WP_115892996.1|4335523_4336322_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011407587.1|4336469_4337504_-|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	32.8	8.0e-43
WP_011409520.1|4340371_4340857_+	DUF962 domain-containing protein	NA	NA	NA	NA	NA
WP_011409522.1|4341395_4344224_+	monovalent cation/H+ antiporter subunit A	NA	NA	NA	NA	NA
WP_011409523.1|4344223_4344598_+	Na+/H+ antiporter subunit C	NA	NA	NA	NA	NA
WP_011409524.1|4344594_4346145_+	monovalent cation/H+ antiporter subunit D	NA	NA	NA	NA	NA
WP_011409525.1|4346141_4346648_+	Na+/H+ antiporter subunit E	NA	NA	NA	NA	NA
WP_011409526.1|4346644_4346929_+	K+/H+ antiporter subunit F	NA	NA	NA	NA	NA
WP_011260422.1|4346925_4347279_+	Na+/H+ antiporter subunit G	NA	NA	NA	NA	NA
WP_103057261.1|4347726_4348065_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011409528.1|4348488_4349814_-	homogentisate 1,2-dioxygenase	NA	NA	NA	NA	NA
WP_012444023.1|4350178_4351294_-	4-hydroxyphenylpyruvate dioxygenase	NA	NA	NA	NA	NA
WP_011260425.1|4351419_4351908_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011409530.1|4352264_4352855_-	thioredoxin family protein	NA	NA	NA	NA	NA
WP_011409531.1|4352866_4354375_-	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	33.6	2.9e-62
WP_011260428.1|4354817_4355711_-	tryptophan 2,3-dioxygenase	NA	NA	NA	NA	NA
WP_011409533.1|4357111_4357777_+	pyruvate dehydrogenase E1 subunit alpha	NA	NA	NA	NA	NA
WP_128896942.1|4358409_4359375_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_011260435.1|4359907_4360288_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011409536.1|4360490_4361375_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409537.1|4361464_4362760_+	acetyl-CoA C-acetyltransferase	NA	NA	NA	NA	NA
WP_011409538.1|4362889_4363414_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011260439.1|4363839_4365105_-	porphyrin biosynthesis protein	NA	NA	NA	NA	NA
WP_011409539.1|4365101_4366079_-	uroporphyrinogen-III C-methyltransferase	NA	NA	NA	NA	NA
WP_012444011.1|4366182_4366986_-	uroporphyrinogen-III synthase	NA	NA	NA	NA	NA
WP_011260442.1|4367161_4367971_+	glycosyltransferase family 25 protein	NA	NA	NA	NA	NA
WP_109182023.1|4367978_4368777_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_042465763.1|4368819_4369437_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409543.1|4369561_4370137_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409544.1|4370348_4371668_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011409545.1|4371817_4372786_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_011409546.1|4372911_4373664_-	HAD family hydrolase	NA	NA	NA	NA	NA
WP_024712457.1|4373701_4374109_-	EF-hand domain-containing protein	NA	NA	NA	NA	NA
WP_011409547.1|4374348_4374690_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011260449.1|4374915_4375293_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011260450.1|4375503_4375701_-	CPXCG motif-containing cysteine-rich protein	NA	NA	NA	NA	NA
WP_011409548.1|4376007_4376754_-	M15 family metallopeptidase	NA	NA	NA	NA	NA
WP_011409549.1|4376846_4377653_-	N-acetylmuramoyl-L-alanine amidase	NA	NA	NA	NA	NA
WP_011409550.1|4377876_4379289_+	SH3 domain-containing protein	NA	NA	NA	NA	NA
WP_011260454.1|4379285_4380383_+	dipeptide epimerase	NA	NA	NA	NA	NA
WP_094187763.1|4380537_4381336_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_128896943.1|4381389_4382188_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011409552.1|4382407_4383370_+|transposase	IS1595-like element ISXo2 family transposase	transposase	NA	NA	NA	NA
WP_011260456.1|4384862_4385639_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011409554.1|4385635_4386952_+	amino acid permease	NA	NA	NA	NA	NA
WP_011409556.1|4388877_4389840_+|transposase	IS1595-like element ISXo2 family transposase	transposase	NA	NA	NA	NA
WP_011260459.1|4390384_4390666_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011260461.1|4391226_4391661_-	membrane protein	NA	NA	NA	NA	NA
WP_011409559.1|4391835_4393014_+	PQQ-dependent sugar dehydrogenase	NA	NA	NA	NA	NA
WP_011409560.1|4394009_4394972_+|transposase	IS1595-like element ISXo2 family transposase	transposase	NA	NA	NA	NA
WP_128896944.1|4395665_4396631_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_011260467.1|4397305_4399477_-	glycoside hydrolase family 3 C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_011409563.1|4399704_4400061_-	dihydroneopterin aldolase	NA	NA	NA	NA	NA
WP_011260469.1|4400139_4401204_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	57.1	8.6e-101
WP_002808376.1|4401483_4401699_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_011409564.1|4402006_4402453_+	GatB/YqeY domain-containing protein	NA	A0A292GL36	Xanthomonas_phage	45.2	1.0e-23
WP_012443989.1|4403930_4404893_+	YihY/virulence factor BrkB family protein	NA	NA	NA	NA	NA
WP_011260472.1|4404982_4406731_+	DNA primase	NA	A0A1S5RF71	Helicobacter_phage	34.5	4.2e-44
WP_041182298.1|4408058_4408304_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059317500.1|4408303_4408570_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033013369.1|4408794_4409841_+	bile acid:sodium symporter	NA	NA	NA	NA	NA
WP_011409569.1|4410024_4411605_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_011409570.1|4411993_4412890_-	protoheme IX farnesyltransferase	NA	NA	NA	NA	NA
WP_011260477.1|4412892_4414056_-	COX15/CtaA family protein	NA	NA	NA	NA	NA
WP_011260478.1|4414066_4414642_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409571.1|4414669_4415389_-	SURF1 family protein	NA	NA	NA	NA	NA
WP_012443949.1|4415449_4415668_+	twin transmembrane helix small protein	NA	NA	NA	NA	NA
WP_011260481.1|4415767_4416643_-	cytochrome c oxidase subunit 3	NA	NA	NA	NA	NA
WP_011260482.1|4416681_4417278_-	cytochrome c oxidase assembly protein	NA	NA	NA	NA	NA
WP_011409573.1|4417274_4417448_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011260484.1|4417428_4419033_-	cytochrome c oxidase subunit I	NA	NA	NA	NA	NA
WP_011260485.1|4419071_4420025_-	cytochrome c oxidase subunit II	NA	NA	NA	NA	NA
WP_011409574.1|4420041_4420518_-	DUF2244 domain-containing protein	NA	NA	NA	NA	NA
WP_011260487.1|4420794_4423995_+	bifunctional proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase PutA	NA	NA	NA	NA	NA
WP_094187805.1|4424154_4425133_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.4	1.9e-38
WP_115893000.1|4425212_4426178_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
>prophage 28
NC_007705	Xanthomonas oryzae pv. oryzae MAFF 311018, complete genome	4940217	4438416	4531556	4940217	tRNA,transposase	Leptospira_phage(23.08%)	55	NA	NA
WP_128896945.1|4438416_4439518_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.0	1.4e-40
WP_011409585.1|4440122_4442354_-	NADP-dependent isocitrate dehydrogenase	NA	NA	NA	NA	NA
WP_011409586.1|4442543_4444256_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257031.1|4449752_4450721_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	4.3e-99
WP_042465267.1|4450887_4451859_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	34.9	2.1e-37
WP_011409594.1|4452050_4453235_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	44.8	5.0e-41
WP_011260517.1|4453702_4454518_-	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	A0A2I7SAX1	Vibrio_phage	35.8	7.4e-36
WP_011409596.1|4455276_4456593_-	amidohydrolase	NA	NA	NA	NA	NA
WP_011260520.1|4456852_4458097_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_011260521.1|4458189_4461438_+	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_011409597.1|4461571_4464712_+	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_011409598.1|4465001_4466369_-	VOC family protein	NA	NA	NA	NA	NA
WP_128896946.1|4467113_4468079_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_027703675.1|4468541_4469012_+	YiiD C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_011409601.1|4469040_4469463_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011260528.1|4469538_4469973_+	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_011260529.1|4470082_4470598_+	protein-export chaperone SecB	NA	NA	NA	NA	NA
WP_011409602.1|4470613_4471639_+	NAD(P)-dependent glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_011260531.1|4471961_4472558_-	Ax21 family protein	NA	NA	NA	NA	NA
WP_173340399.1|4472933_4474643_+	ubiquinone-dependent pyruvate dehydrogenase	NA	NA	NA	NA	NA
WP_011260533.1|4474692_4476135_+	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_011260534.1|4476119_4477466_+	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_011409603.1|4477656_4478406_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011260536.1|4478507_4479119_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011260537.1|4479223_4480447_+	MFS transporter	NA	NA	NA	NA	NA
WP_011260538.1|4480788_4481265_-|tRNA	tRNA (cytidine(34)-2'-O)-methyltransferase	tRNA	NA	NA	NA	NA
WP_011409604.1|4481291_4481753_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010370565.1|4482138_4482459_+	DUF4156 domain-containing protein	NA	NA	NA	NA	NA
WP_011260540.1|4482560_4483577_+	3-oxoacyl-ACP synthase III	NA	NA	NA	NA	NA
WP_011260541.1|4483648_4484812_+	Fic family protein	NA	NA	NA	NA	NA
WP_011260542.1|4484808_4486440_+	site-specific DNA-methyltransferase	NA	A0A2K5B2C1	Erysipelothrix_phage	37.5	1.7e-63
WP_011409605.1|4486447_4488943_+	DEAD/DEAH box helicase family protein	NA	NA	NA	NA	NA
WP_011260544.1|4488939_4489842_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_011409606.1|4490063_4490447_-	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_011260546.1|4490765_4492436_+	AMP-binding protein	NA	NA	NA	NA	NA
WP_011409607.1|4492664_4493675_+	NAD-dependent epimerase/dehydratase family protein	NA	A0A0E3FNQ3	Synechococcus_phage	32.6	1.5e-14
WP_011260548.1|4493739_4493898_+	DUF1328 domain-containing protein	NA	NA	NA	NA	NA
WP_011260549.1|4494132_4495509_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	55.1	5.0e-77
WP_041182305.1|4495519_4496053_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011409609.1|4496481_4497741_-	HD-GYP domain-containing protein	NA	NA	NA	NA	NA
WP_011260552.1|4497879_4499187_-	MFS transporter	NA	NA	NA	NA	NA
WP_011407587.1|4501271_4502306_+|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	32.8	8.0e-43
WP_011409611.1|4502656_4503202_+	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_011409612.1|4503227_4503494_-	proteinase inhibitor	NA	NA	NA	NA	NA
WP_011260556.1|4503668_4505507_+	dihydroxy-acid dehydratase	NA	NA	NA	NA	NA
WP_011409614.1|4508730_4509873_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.8	5.3e-96
WP_011260560.1|4510999_4511899_+	oxygen-dependent coproporphyrinogen oxidase	NA	NA	NA	NA	NA
WP_011260561.1|4512846_4515648_-	DNA polymerase I	NA	A0A218MKQ4	uncultured_virus	30.4	2.4e-65
WP_011409617.1|4515724_4516015_+	DUF2782 domain-containing protein	NA	NA	NA	NA	NA
WP_113101711.1|4516372_4517475_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	40.5	6.7e-40
WP_125168768.1|4517580_4518252_-	HIRAN domain-containing protein	NA	NA	NA	NA	NA
WP_128896947.1|4518311_4519217_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409622.1|4519406_4522094_-	pyruvate dehydrogenase (acetyl-transferring), homodimeric type	NA	NA	NA	NA	NA
WP_011409626.1|4525415_4529345_+	TAL effector repeat-containing protein	NA	NA	NA	NA	NA
WP_011409629.1|4531043_4531556_-|transposase	transposase	transposase	Q8W6R2	Burkholderia_virus	68.8	1.6e-44
>prophage 29
NC_007705	Xanthomonas oryzae pv. oryzae MAFF 311018, complete genome	4940217	4629595	4729478	4940217	tRNA,transposase	Leptospira_phage(14.29%)	60	NA	NA
WP_109182036.1|4629595_4630561_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_011260658.1|4630661_4631087_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011260659.1|4631954_4632986_+|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	42.9	2.0e-70
WP_011260660.1|4634346_4635603_+	alanine--glyoxylate aminotransferase family protein	NA	NA	NA	NA	NA
WP_011260661.1|4635599_4636490_+	allantoinase PuuE	NA	NA	NA	NA	NA
WP_011409687.1|4636486_4636882_+	DUF3225 domain-containing protein	NA	NA	NA	NA	NA
WP_075239612.1|4636901_4637480_+	2-oxo-4-hydroxy-4-carboxy-5-ureidoimidazoline decarboxylase	NA	NA	NA	NA	NA
WP_011409690.1|4638155_4639544_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011260667.1|4644329_4646414_-	S9 family peptidase	NA	NA	NA	NA	NA
WP_011260668.1|4646513_4648541_-	acetyl/propionyl/methylcrotonyl-CoA carboxylase subunit alpha	NA	NA	NA	NA	NA
WP_011260669.1|4648783_4650394_-	methylcrotonoyl-CoA carboxylase	NA	A0A1B2ITV7	Pike_perch_iridovirus	51.5	1.1e-19
WP_011260670.1|4650404_4651568_-	isovaleryl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_011409694.1|4651696_4652317_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012443812.1|4652647_4652836_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011260672.1|4652878_4653214_-	DUF3325 domain-containing protein	NA	NA	NA	NA	NA
WP_075242289.1|4654838_4655150_-	DUF3649 domain-containing protein	NA	NA	NA	NA	NA
WP_011409699.1|4656268_4656787_+	cytochrome c5 family protein	NA	NA	NA	NA	NA
WP_011409700.1|4657058_4658777_+	ExeM/NucH family extracellular endonuclease	NA	NA	NA	NA	NA
WP_011260679.1|4658867_4659254_-	MerC family mercury resistance protein	NA	NA	NA	NA	NA
WP_011260680.1|4659315_4660641_+	GTP-binding protein	NA	NA	NA	NA	NA
WP_011260681.1|4660755_4662069_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011260682.1|4662167_4662893_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409701.1|4663109_4663772_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_011409702.1|4663850_4664945_+	cell division protein ZapE	NA	NA	NA	NA	NA
WP_173340400.1|4666509_4669209_+	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	36.2	1.2e-146
WP_011409706.1|4669461_4671051_-	sulfotransferase family protein	NA	NA	NA	NA	NA
WP_011409707.1|4671050_4673288_-|tRNA	glycine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_011409708.1|4673576_4674485_-|tRNA	glycine--tRNA ligase subunit alpha	tRNA	NA	NA	NA	NA
WP_011409709.1|4674574_4676389_+	type II/IV secretion system protein	NA	NA	NA	NA	NA
WP_103057247.1|4676774_4685231_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109182038.1|4685698_4686496_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011409712.1|4687040_4687793_+	glutamine amidotransferase	NA	NA	NA	NA	NA
WP_011260693.1|4687852_4688752_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011260694.1|4688903_4689659_-	twin-arginine translocase subunit TatC	NA	NA	NA	NA	NA
WP_011409714.1|4689655_4690291_-	twin-arginine translocase subunit TatB	NA	NA	NA	NA	NA
WP_003484969.1|4690306_4690534_-	Sec-independent protein translocase subunit TatA	NA	NA	NA	NA	NA
WP_011409715.1|4690606_4691509_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409716.1|4691663_4692629_+	ferrochelatase	NA	NA	NA	NA	NA
WP_011409718.1|4693562_4694021_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011409719.1|4694291_4695077_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_011409720.1|4695703_4696609_-	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	32.9	4.1e-43
WP_011260702.1|4696672_4697590_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	62.5	3.1e-83
WP_011259480.1|4698193_4699531_+	xylose isomerase	NA	NA	NA	NA	NA
WP_011409721.1|4699756_4700824_-	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_011409722.1|4700999_4703195_+	alpha-glucuronidase	NA	NA	NA	NA	NA
WP_011409723.1|4703191_4705156_+	9-O-acetylesterase	NA	NA	NA	NA	NA
WP_011409724.1|4705167_4706427_+	D-galactonate dehydratase family protein	NA	Q6A202	Oenococcus_phage	26.0	3.5e-40
WP_011260707.1|4706426_4708127_+	glycoside hydrolase family 43 protein	NA	NA	NA	NA	NA
WP_041182521.1|4708192_4710844_+	glycoside hydrolase family 3 protein	NA	NA	NA	NA	NA
WP_011260709.1|4711066_4712539_+	mannitol dehydrogenase family protein	NA	G8DCZ3	Micromonas_pusilla_virus	32.1	4.5e-47
WP_011260711.1|4713516_4714572_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011260712.1|4714799_4716218_-	glucuronate isomerase	NA	NA	NA	NA	NA
WP_011409725.1|4716258_4717236_-	endo-1,4-beta-xylanase	NA	NA	NA	NA	NA
WP_042465333.1|4718652_4719954_-	MFS transporter	NA	NA	NA	NA	NA
WP_011409727.1|4720415_4723349_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_011409728.1|4723447_4724935_+	MFS transporter	NA	NA	NA	NA	NA
WP_011260718.1|4724966_4726001_+	glycoside hydrolase family 43 protein	NA	NA	NA	NA	NA
WP_094187716.1|4726417_4727215_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_010374782.1|4728091_4728268_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109182039.1|4728521_4729478_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
>prophage 30
NC_007705	Xanthomonas oryzae pv. oryzae MAFF 311018, complete genome	4940217	4735165	4772996	4940217	tail,transposase	Arthrobacter_phage(37.5%)	24	NA	NA
WP_109182062.1|4735165_4735964_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011409735.1|4736092_4737412_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_042465802.1|4737514_4738471_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	36.0	1.4e-41
WP_011260733.1|4739937_4740396_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011409738.1|4740497_4740926_+	organic hydroperoxide resistance protein	NA	NA	NA	NA	NA
WP_011409739.1|4741172_4742036_-	DUF2884 family protein	NA	NA	NA	NA	NA
WP_042465346.1|4745212_4745479_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011260739.1|4745640_4745889_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_011409743.1|4746097_4746856_-	immunity 52 family protein	NA	NA	NA	NA	NA
WP_042465805.1|4746852_4747548_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409745.1|4747646_4747979_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409747.1|4748450_4748885_-	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_011260743.1|4749580_4749913_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011409748.1|4750362_4751754_-	nucleoside hydrolase	NA	NA	NA	NA	NA
WP_011260746.1|4752691_4752982_-	HigA family addiction module antidote protein	NA	M9MUN2	Rhodococcus_phage	53.8	1.5e-15
WP_011260747.1|4752999_4753281_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A222YWE2	Escherichia_phage	40.7	3.1e-10
WP_011409750.1|4753375_4755628_-	exodeoxyribonuclease V subunit alpha	NA	A0A0K2FLP8	Brevibacillus_phage	21.7	8.7e-10
WP_011409751.1|4755815_4759883_-	exodeoxyribonuclease V subunit beta	NA	S5MMD7	Bacillus_phage	22.5	4.1e-10
WP_011409752.1|4759879_4763293_-	exodeoxyribonuclease V subunit gamma	NA	NA	NA	NA	NA
WP_075244278.1|4763409_4763631_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011409756.1|4770206_4770752_+|tail	phage tail protein	tail	A0A0U4JXW2	Arthrobacter_phage	32.9	1.9e-11
WP_011260754.1|4770820_4771348_+|tail	phage tail protein	tail	A0A218M5J0	Arthrobacter_phage	33.1	1.2e-15
WP_011260755.1|4771406_4771943_+|tail	phage tail protein	tail	A0A0U4JYA4	Arthrobacter_phage	32.1	1.2e-10
WP_109182045.1|4772030_4772996_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
