The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_010609	Lactobacillus reuteri JCM 1112, complete genome	2039414	261274	319703	2039414	protease,tRNA,transposase	Pseudomonas_phage(18.75%)	49	NA	NA
WP_130125636.1|261274_261685_+|transposase	IS200/IS605 family transposase	transposase	A0A286QN76	Streptococcus_phage	62.6	5.2e-46
WP_003667207.1|261684_262860_+|transposase	transposase	transposase	A0A0P0ICY9	Lactobacillus_phage	55.2	6.6e-118
WP_003667208.1|263086_263485_+	DUF1934 domain-containing protein	NA	NA	NA	NA	NA
WP_011953385.1|263530_264088_+	DNA-directed RNA polymerase subunit delta	NA	NA	NA	NA	NA
WP_003667210.1|264264_265869_+	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	50.9	1.3e-148
WP_003667212.1|266381_267764_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	26.8	1.4e-29
WP_003667214.1|268047_269325_+	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_003665599.1|269417_269663_+	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_011953387.1|269824_271141_+	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_003667221.1|271124_272015_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_003667224.1|272064_272769_+	class A sortase	NA	NA	NA	NA	NA
WP_003667227.1|273169_273949_+	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_003667230.1|273960_274827_+	class II fructose-1,6-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_003667231.1|274846_275503_+	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_003667233.1|275541_276006_-	low molecular weight phosphotyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_003667234.1|276135_276705_+	LemA family protein	NA	NA	NA	NA	NA
WP_003667235.1|276707_277604_+|protease	zinc metalloprotease HtpX	protease	NA	NA	NA	NA
WP_003667237.1|277757_279137_+	UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D- alanine ligase	NA	NA	NA	NA	NA
WP_003667239.1|279208_280705_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	39.0	3.4e-71
WP_003667241.1|280785_281622_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	32.4	6.5e-27
WP_003667242.1|282087_283029_+	glutaminase	NA	NA	NA	NA	NA
WP_003664118.1|283174_283633_-|transposase	IS200/IS605 family transposase	transposase	A0A1P8BMC0	Lactococcus_phage	37.0	3.9e-18
WP_003667243.1|284288_285671_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	27.8	1.7e-27
WP_011953388.1|285754_287044_-	D-alanyl-lipoteichoic acid biosynthesis protein DltD	NA	NA	NA	NA	NA
WP_003667244.1|287036_287276_-	D-alanine--poly(phosphoribitol) ligase subunit DltC	NA	NA	NA	NA	NA
WP_003667245.1|287295_288513_-	D-alanyl-lipoteichoic acid biosynthesis protein DltB	NA	A0A125RNP0	Pseudomonas_phage	29.3	4.1e-22
WP_003667246.1|288512_290039_-	D-alanine--poly(phosphoribitol) ligase subunit DltA	NA	A0A2K9KZV5	Tupanvirus	26.0	1.2e-39
WP_003665629.1|290060_290201_-	teichoic acid D-Ala incorporation-associated protein DltX	NA	NA	NA	NA	NA
WP_003667247.1|290531_290894_+	holo-ACP synthase	NA	NA	NA	NA	NA
WP_003667248.1|290893_292021_+	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	28.0	2.5e-29
WP_003667249.1|292039_292414_+	type II toxin-antitoxin system PemK/MazF family toxin	NA	A0A291I9M9	Lactobacillus_phage	36.0	2.1e-09
WP_003667250.1|292604_293981_+	cytosine permease	NA	NA	NA	NA	NA
WP_003667251.1|293971_295210_+	cytosine deaminase	NA	NA	NA	NA	NA
WP_003667252.1|295594_296386_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011953389.1|296494_297133_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_011953390.1|297338_297899_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_003667257.1|297917_301457_+	transcription-repair coupling factor	NA	NA	NA	NA	NA
WP_003667258.1|301453_301726_+	RNA-binding S4 domain-containing protein	NA	NA	NA	NA	NA
WP_003667261.1|301826_302183_+	septum formation initiator family protein	NA	NA	NA	NA	NA
WP_003665652.1|302366_302861_+	RNA-binding protein S1	NA	NA	NA	NA	NA
WP_003673314.1|302862_304257_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	A0A0N7G7K4	Chrysochromulina_ericina_virus	27.1	2.8e-14
WP_003667265.1|304249_304792_+	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	26.8	6.1e-10
WP_003665660.1|307223_308144_+	Hsp33 family molecular chaperone HslO	NA	NA	NA	NA	NA
WP_003665662.1|308251_309253_+|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_003667268.1|309273_310800_+|tRNA	lysine--tRNA ligase	tRNA	A0A2K9KZX5	Tupanvirus	41.9	3.4e-90
WP_003667270.1|310925_311459_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003667271.1|317553_317742_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003667289.1|317731_318088_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_003667292.1|318158_319703_+|transposase	IS66 family transposase	transposase	S5VLC8	Leptospira_phage	24.8	8.6e-17
>prophage 2
NC_010609	Lactobacillus reuteri JCM 1112, complete genome	2039414	731821	752088	2039414	tail,protease,head,capsid,portal,terminase	Staphylococcus_phage(27.27%)	23	NA	NA
WP_003666838.1|731821_733072_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	59.2	2.3e-137
WP_003668240.1|733089_733680_+	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_003674350.1|733681_733981_+	nucleoside triphosphate pyrophosphohydrolase family protein	NA	A0A1S7FYY8	Listeria_phage	49.0	5.0e-22
WP_003668237.1|734024_734162_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003668235.1|734305_736117_+	excinuclease ABC subunit UvrC	NA	NA	NA	NA	NA
WP_003668233.1|736181_737498_+	GTPase ObgE	NA	NA	NA	NA	NA
WP_003668232.1|737530_738460_+	ribonuclease Z	NA	NA	NA	NA	NA
WP_012390529.1|738477_739311_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_003668229.1|739450_739918_+	hypothetical protein	NA	A7KV88	Bacillus_phage	43.3	4.1e-15
WP_003668227.1|739931_740252_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003668226.1|740371_740644_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003668224.1|740661_741162_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003668222.1|741187_742579_+	primase	NA	A0A0M4RE09	Enterococcus_phage	31.5	4.7e-30
WP_003668220.1|743008_743368_+|head,tail	head-tail adaptor protein	head,tail	NA	NA	NA	NA
WP_003668217.1|743376_743790_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003668215.1|743793_744318_+	HNH endonuclease	NA	H0USW1	Bacillus_phage	32.7	1.8e-11
WP_003668211.1|744664_745129_+|terminase	phage terminase small subunit P27 family	terminase	A0A1J0MG04	Staphylococcus_phage	33.6	9.2e-15
WP_003668210.1|745128_746838_+|terminase	terminase large subunit	terminase	A0A2H4JBN3	uncultured_Caudovirales_phage	38.5	9.9e-107
WP_003668208.1|747002_748121_+|portal	phage portal protein	portal	A0A1D6Z2A2	Staphylococcus_phage	31.9	8.6e-43
WP_011953433.1|748098_749619_+|capsid	phage major capsid protein	capsid	A0A1Q1PVX2	Staphylococcus_phage	35.0	9.3e-40
WP_003668206.1|749675_750098_+	transcriptional regulator	NA	E3W8E2	Leuconostoc_phage	32.7	1.2e-08
WP_003668205.1|750113_750392_+|head,tail	phage gp6-like head-tail connector protein	head,tail	NA	NA	NA	NA
WP_003668204.1|751419_752088_+	viroplasmin family protein	NA	C1KFJ1	Lactobacillus_virus	33.9	1.2e-31
>prophage 3
NC_010609	Lactobacillus reuteri JCM 1112, complete genome	2039414	782032	791236	2039414	integrase	Lactobacillus_phage(28.57%)	9	775527:775541	789290:789304
775527:775541	attL	AGAAAAATAAGAAGA	NA	NA	NA	NA
WP_003668169.1|782032_783898_+	molecular chaperone DnaK	NA	A0A2P1EIW2	Megavirus	46.6	1.1e-135
WP_003665811.1|784026_785178_+	molecular chaperone DnaJ	NA	A0A1V0SBY2	Catovirus	27.1	1.3e-30
WP_003668167.1|785308_787144_+	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	25.9	4.3e-23
WP_003668165.1|787294_788455_-|integrase	site-specific integrase	integrase	A0A2I7SCV1	Paenibacillus_phage	43.6	8.0e-84
WP_003668163.1|788578_789313_-	hypothetical protein	NA	U5U717	Lactobacillus_phage	38.0	1.1e-38
789290:789304	attR	TCTTCTTATTTTTCT	NA	NA	NA	NA
WP_003668162.1|789317_789554_+	hypothetical protein	NA	U5U783	Lactobacillus_phage	53.4	1.8e-14
WP_003668161.1|789605_790055_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003668160.1|790153_790612_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080502980.1|791074_791236_-	hypothetical protein	NA	A0A2I6PDG6	Staphylococcus_phage	65.9	1.4e-10
>prophage 4
NC_010609	Lactobacillus reuteri JCM 1112, complete genome	2039414	847594	855659	2039414	tRNA	Staphylococcus_phage(33.33%)	8	NA	NA
WP_003666054.1|847594_847870_+	HU family DNA-binding protein	NA	A0A0H3UZA0	Geobacillus_virus	68.5	2.6e-25
WP_011953444.1|848005_849271_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_003668104.1|849396_850608_+|tRNA	CCA tRNA nucleotidyltransferase	tRNA	G3MAR3	Bacillus_virus	39.7	3.8e-36
WP_003668103.1|850609_852520_+	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	30.4	1.4e-56
WP_003668102.1|852538_853501_+	thymidylate synthase	NA	A0A0N9SH48	Staphylococcus_phage	61.2	2.5e-115
WP_003666061.1|853516_854005_+	dihydrofolate reductase	NA	A0A1B2IBQ4	Erwinia_phage	40.8	4.3e-23
WP_003666062.1|853993_854638_-	hemolysin III family protein	NA	NA	NA	NA	NA
WP_003668100.1|854816_855659_+	DegV family protein	NA	A0A0N9SI50	Staphylococcus_phage	33.3	2.3e-16
>prophage 5
NC_010609	Lactobacillus reuteri JCM 1112, complete genome	2039414	870310	908993	2039414	transposase,tail,head,capsid,portal,terminase	Lactobacillus_phage(46.67%)	58	NA	NA
WP_003668074.1|870310_871279_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_003668071.1|871472_871877_+	iron-sulfur cluster biosynthesis family protein	NA	NA	NA	NA	NA
WP_003668066.1|872353_872533_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003668064.1|872560_873055_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_003668062.1|873209_873593_-	Asp23/Gls24 family envelope stress response protein	NA	NA	NA	NA	NA
WP_003666092.1|873610_873802_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003668061.1|873816_874362_-	alkaline shock response membrane anchor protein AmaP	NA	NA	NA	NA	NA
WP_003668059.1|874541_876071_-	gluconokinase	NA	NA	NA	NA	NA
WP_003668057.1|876121_877141_-	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_080502967.1|877220_878405_-	gluconate permease	NA	NA	NA	NA	NA
WP_080502968.1|878462_879839_-	recombinase family protein	NA	D2KRD2	Lactobacillus_phage	53.3	3.0e-106
WP_003668052.1|880195_881053_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011953447.1|881073_881595_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003668049.1|881608_882013_-	hypothetical protein	NA	E9LUL0	Lactobacillus_phage	61.3	2.2e-17
WP_003668048.1|882066_882471_-	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_003668047.1|882487_882862_-	helix-turn-helix transcriptional regulator	NA	A0A1B0Y2R0	Lactobacillus_phage	49.5	9.9e-20
WP_003668046.1|882983_883199_+	helix-turn-helix transcriptional regulator	NA	A0A059T7X5	Listeria_phage	59.3	3.5e-09
WP_003668044.1|883217_883991_+	phage repressor protein/antirepressor Ant	NA	B8R674	Lactobacillus_phage	71.2	6.3e-93
WP_003668042.1|884266_884470_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003668040.1|884466_884715_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003668039.1|884692_884896_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003668038.1|884910_885087_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003668037.1|885086_885359_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003668036.1|885351_886281_+	recombinase RecT	NA	E9LUM3	Lactobacillus_phage	52.8	1.2e-74
WP_003668035.1|886264_887089_+	PD-(D/E)XK nuclease-like domain-containing protein	NA	E9LUM4	Lactobacillus_phage	64.5	1.8e-106
WP_003668034.1|887066_887951_+	DnaD domain protein	NA	Q8SDH3	Lactococcus_phage	43.3	5.4e-16
WP_003666901.1|887943_888273_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003666903.1|888269_888641_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003666905.1|888716_888995_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003666907.1|889179_889332_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003666908.1|889375_889570_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003666909.1|889569_889830_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003666911.1|889829_890171_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003666912.1|890170_890359_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003666913.1|890366_890627_+	hypothetical protein	NA	A0A2K9VD68	Lactobacillus_phage	37.8	1.3e-05
WP_003666914.1|890626_890938_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003666915.1|891000_891144_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003666916.1|891225_891648_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003668032.1|892595_892802_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003668031.1|892859_893558_+	phosphoadenosine phosphosulfate reductase family protein	NA	NA	NA	NA	NA
WP_003668030.1|893557_893983_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003668029.1|893996_894776_+	ParB N-terminal domain-containing protein	NA	A0A1B1P7B5	Bacillus_phage	39.5	1.3e-13
WP_003668028.1|894792_895296_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003668027.1|895270_896566_+|terminase	PBSX family phage terminase large subunit	terminase	H9A0U5	Staphylococcus_phage	54.7	5.9e-128
WP_003668026.1|896565_898227_+|portal	phage portal protein	portal	D2IZF6	Enterococcus_phage	33.2	1.7e-63
WP_003668025.1|898226_899177_+|capsid	minor capsid protein	capsid	NA	NA	NA	NA
WP_003668024.1|899187_899433_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003668023.1|899562_900216_+	DUF4355 domain-containing protein	NA	NA	NA	NA	NA
WP_003668021.1|900230_901307_+	hypothetical protein	NA	D7RWJ0	Brochothrix_phage	30.3	3.1e-37
WP_003668019.1|901319_901685_+|head,tail	phage head-tail connector protein	head,tail	Q77K22	Lactococcus_phage	34.8	8.5e-08
WP_003668018.1|901684_901999_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003668016.1|901988_902549_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003668015.1|902557_902968_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003668014.1|902970_903618_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003668013.1|903637_904183_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003668011.1|904275_904455_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003668009.1|904458_908109_+	hypothetical protein	NA	A0A2I6QQX2	Streptococcus_phage	28.9	2.4e-49
WP_003668007.1|908105_908993_+|tail	phage tail family protein	tail	NA	NA	NA	NA
>prophage 6
NC_010609	Lactobacillus reuteri JCM 1112, complete genome	2039414	1040141	1096361	2039414	integrase,transposase	Lactococcus_phage(20.0%)	50	1032355:1032372	1105916:1105933
1032355:1032372	attL	TGAAGATGGTAATGATAT	NA	NA	NA	NA
WP_080502969.1|1040141_1040492_-|integrase	tyrosine-type recombinase/integrase	integrase	E9LUK6	Lactobacillus_phage	68.1	8.4e-37
WP_003667773.1|1042243_1042702_+|transposase	IS200/IS605 family transposase	transposase	A0A1P8BMC0	Lactococcus_phage	36.3	1.9e-17
WP_173030300.1|1042929_1043790_-	alpha/beta hydrolase	NA	A0A088FQA2	Mycobacterium_phage	28.1	8.4e-14
WP_003667771.1|1044092_1044740_+	DsbA family oxidoreductase	NA	NA	NA	NA	NA
WP_003667770.1|1044872_1045226_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003667768.1|1046410_1047175_-	enoyl-ACP reductase FabI	NA	NA	NA	NA	NA
WP_003667767.1|1047185_1047962_-	acetyl-CoA carboxylase carboxyl transferase subunit alpha	NA	NA	NA	NA	NA
WP_169471569.1|1047954_1048803_-	acetyl-CoA carboxylase, carboxyltransferase subunit beta	NA	NA	NA	NA	NA
WP_003667763.1|1048799_1050170_-	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
WP_003667761.1|1050178_1050613_-	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_003667760.1|1050605_1051058_-	acetyl-CoA carboxylase biotin carboxyl carrier protein subunit	NA	NA	NA	NA	NA
WP_003667758.1|1051064_1052297_-	beta-ketoacyl-ACP synthase II	NA	NA	NA	NA	NA
WP_003667757.1|1052307_1053042_-	3-oxoacyl-[acyl-carrier-protein] reductase	NA	NA	NA	NA	NA
WP_003667755.1|1053025_1053976_-	ACP S-malonyltransferase	NA	NA	NA	NA	NA
WP_003674025.1|1053975_1054218_-	acyl carrier protein	NA	NA	NA	NA	NA
WP_003667751.1|1054237_1055212_-	ketoacyl-ACP synthase III	NA	NA	NA	NA	NA
WP_003663667.1|1055231_1055678_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003667749.1|1055764_1056211_-	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_003667748.1|1056535_1057615_+	tyrosine recombinase XerS	NA	A0A0E3XA96	Gordonia_phage	29.6	6.9e-05
WP_003667747.1|1057687_1057846_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011953475.1|1059770_1060625_+	patatin family protein	NA	NA	NA	NA	NA
WP_003663651.1|1060641_1061289_+|integrase	site-specific integrase	integrase	D2XR58	Bacillus_phage	30.7	2.5e-18
WP_003667741.1|1061397_1062288_+	DMT family transporter	NA	NA	NA	NA	NA
WP_003667418.1|1062471_1064082_+|transposase	IS1182 family transposase	transposase	A0ZS58	Staphylococcus_virus	39.3	1.0e-97
WP_003667738.1|1065607_1066297_-	respiratory nitrate reductase subunit gamma	NA	NA	NA	NA	NA
WP_012390566.1|1066289_1066868_-	nitrate reductase molybdenum cofactor assembly chaperone	NA	NA	NA	NA	NA
WP_003667734.1|1066860_1068420_-	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	37.1	7.1e-19
WP_003667732.1|1068409_1072075_-	nitrate reductase subunit alpha	NA	NA	NA	NA	NA
WP_003667730.1|1072220_1073240_+	HesA/MoeB/ThiF family protein	NA	NA	NA	NA	NA
WP_003667728.1|1073236_1073734_+	MogA/MoaB family molybdenum cofactor biosynthesis protein	NA	NA	NA	NA	NA
WP_003667726.1|1073723_1074941_+	molybdopterin molybdotransferase MoeA	NA	NA	NA	NA	NA
WP_003667725.1|1074919_1075408_+	molybdopterin-guanine dinucleotide biosynthesis protein B	NA	NA	NA	NA	NA
WP_003667723.1|1075407_1075980_+	NTP transferase domain-containing protein	NA	NA	NA	NA	NA
WP_003667721.1|1075969_1076254_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012390567.1|1076404_1077460_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_003667719.1|1077452_1078106_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_003667718.1|1078201_1078474_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003667717.1|1078479_1079448_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003663626.1|1079452_1080358_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003667716.1|1080418_1081612_-	NarK/NasA family nitrate transporter	NA	NA	NA	NA	NA
WP_003667715.1|1081658_1081904_-	MoaD/ThiS family protein	NA	NA	NA	NA	NA
WP_035161426.1|1081903_1082305_-	molybdenum cofactor biosynthesis protein MoaE	NA	NA	NA	NA	NA
WP_003667713.1|1082435_1082885_+	flavodoxin	NA	NA	NA	NA	NA
WP_035164271.1|1082877_1083873_+	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_003667711.1|1083869_1084646_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	29.2	1.1e-15
WP_163622757.1|1084699_1085719_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_080502971.1|1087958_1088162_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_003667706.1|1088144_1089527_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	27.0	7.9e-30
WP_041816918.1|1090121_1093790_-	YSIRK-type signal peptide-containing protein	NA	NA	NA	NA	NA
WP_003664118.1|1095902_1096361_-|transposase	IS200/IS605 family transposase	transposase	A0A1P8BMC0	Lactococcus_phage	37.0	3.9e-18
1105916:1105933	attR	TGAAGATGGTAATGATAT	NA	NA	NA	NA
>prophage 7
NC_010609	Lactobacillus reuteri JCM 1112, complete genome	2039414	1100369	1173327	2039414	transposase	Lactobacillus_phage(21.43%)	56	NA	NA
WP_003667693.1|1100369_1101914_+|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	24.2	1.4e-22
WP_003667691.1|1102060_1103950_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003667690.1|1103950_1104256_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003667689.1|1104535_1105345_+	hydroxyethylthiazole kinase	NA	NA	NA	NA	NA
WP_012390570.1|1105337_1106156_+	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_003667687.1|1106152_1106800_+	thiamine phosphate synthase	NA	NA	NA	NA	NA
WP_003667685.1|1106875_1108135_-	chloride channel protein	NA	NA	NA	NA	NA
WP_003667683.1|1108292_1110599_-	DUF4968 domain-containing protein	NA	NA	NA	NA	NA
WP_035164274.1|1110743_1111385_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_003667102.1|1111557_1111746_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003667088.1|1111735_1112092_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_003667087.1|1112158_1113688_+|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
WP_003667086.1|1119381_1119870_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003667085.1|1119900_1120908_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003667084.1|1121094_1121376_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003667083.1|1121490_1122327_-	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_003673269.1|1122490_1123195_+	glucosamine-6-phosphate deaminase	NA	NA	NA	NA	NA
WP_011953477.1|1123191_1123752_-	Fic family protein	NA	S4TP71	Salmonella_phage	28.8	7.7e-08
WP_003667079.1|1123753_1124167_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_003667077.1|1124276_1126535_-	bifunctional metallophosphatase/5'-nucleotidase	NA	NA	NA	NA	NA
WP_011953478.1|1126740_1127418_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003667074.1|1128057_1131159_-	SMC family ATPase	NA	NA	NA	NA	NA
WP_003667073.1|1131160_1132279_-	exonuclease SbcCD subunit D	NA	A0A143FIT9	Bacillus_phage	25.7	7.1e-05
WP_003667071.1|1132431_1132608_-	hypothetical protein	NA	A0A0A1ERA5	Lactobacillus_phage	55.6	6.1e-12
WP_003667070.1|1132626_1133403_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003667066.1|1137049_1138942_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003667064.1|1139251_1140043_-	DUF3800 domain-containing protein	NA	NA	NA	NA	NA
WP_003667062.1|1140063_1140864_-	helix-turn-helix transcriptional regulator	NA	A8ATJ9	Listeria_phage	32.7	8.7e-05
WP_003667061.1|1141057_1141315_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003667060.1|1141393_1142797_-	amino acid permease	NA	NA	NA	NA	NA
WP_003667059.1|1142789_1143722_-	homocysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_003667058.1|1144166_1144592_-	protein-export chaperone SecB	NA	A0A2D1GPE1	Lactobacillus_phage	37.7	3.4e-16
WP_003667057.1|1144883_1145852_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_003667055.1|1145853_1146771_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003667054.1|1146859_1147618_-	ATP-binding protein	NA	A0A059NT77	Lactococcus_phage	48.2	8.7e-63
WP_011953482.1|1147622_1148834_-|transposase	IS21 family transposase	transposase	A0A059NT83	Lactococcus_phage	45.7	2.1e-90
WP_003667051.1|1149010_1150102_-	ATP-dependent helicase	NA	A0A1V0SG90	Hokovirus	21.7	2.4e-05
WP_003667049.1|1150086_1151700_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_003667043.1|1152941_1154960_-	NTPase KAP	NA	NA	NA	NA	NA
WP_003667042.1|1156370_1158029_-	DUF2971 domain-containing protein	NA	NA	NA	NA	NA
WP_003667041.1|1158053_1158899_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	39.7	4.2e-34
WP_003667039.1|1160230_1161232_-	LCP family protein	NA	NA	NA	NA	NA
WP_003667038.1|1161628_1162027_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003667037.1|1162132_1162657_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003667036.1|1162791_1163967_-|transposase	transposase	transposase	A0A0P0ICY9	Lactobacillus_phage	55.4	7.8e-119
WP_035167525.1|1163966_1164365_-|transposase	IS200/IS605 family transposase	transposase	A0A286QN76	Streptococcus_phage	62.1	4.3e-45
WP_003667034.1|1164480_1164723_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003667032.1|1164915_1165491_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_003667031.1|1165500_1165737_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003667030.1|1165778_1166291_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003667028.1|1166337_1167840_-	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_003663508.1|1167974_1168160_-	4-oxalocrotonate tautomerase	NA	NA	NA	NA	NA
WP_003676754.1|1168242_1170072_-	monovalent cation:proton antiporter family protein	NA	NA	NA	NA	NA
WP_003667025.1|1170210_1171614_+	C69 family dipeptidase	NA	NA	NA	NA	NA
WP_003667023.1|1171765_1172479_+	helix-turn-helix domain-containing protein	NA	A0A0C5AJ29	Paenibacillus_phage	36.6	1.5e-27
WP_003667021.1|1172475_1173327_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	24.5	3.4e-15
>prophage 8
NC_010609	Lactobacillus reuteri JCM 1112, complete genome	2039414	1192521	1226789	2039414	transposase,tail,plate,head,protease,capsid,portal,terminase	Lactobacillus_phage(69.23%)	37	NA	NA
WP_003666987.1|1192521_1193904_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	26.8	1.0e-29
WP_003666986.1|1194399_1195227_-	exodeoxyribonuclease III	NA	M1PSC0	Streptococcus_phage	63.0	1.4e-98
WP_003666985.1|1195229_1195562_-	MazG-like family protein	NA	M5AWB2	Nitratiruptor_phage	40.2	3.2e-14
WP_003666984.1|1195711_1195936_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003664118.1|1196398_1196857_-|transposase	IS200/IS605 family transposase	transposase	A0A1P8BMC0	Lactococcus_phage	37.0	3.9e-18
WP_003666953.1|1198094_1199294_-	N-acetylmuramoyl-L-alanine amidase	NA	Q9MCC6	Lactobacillus_phage	63.3	2.4e-51
WP_003666952.1|1199283_1199655_-	hypothetical protein	NA	A0A2H4PBB2	Lactobacillus_phage	47.3	1.6e-09
WP_003666951.1|1199651_1199978_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003666949.1|1199992_1201081_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003666948.1|1201119_1201671_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003666947.1|1201709_1201829_-	XkdX family protein	NA	NA	NA	NA	NA
WP_003666945.1|1201821_1202226_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003666944.1|1202237_1203353_-|plate	BppU family phage baseplate upper protein	plate	E9LUJ9	Lactobacillus_phage	37.2	5.2e-56
WP_003666943.1|1203349_1204495_-	SGNH/GDSL hydrolase family protein	NA	E9LUJ8	Lactobacillus_phage	42.4	7.4e-82
WP_003666942.1|1204507_1204777_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003666941.1|1204819_1205062_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003666940.1|1205054_1209134_-	hypothetical protein	NA	E9LUJ5	Lactobacillus_phage	26.6	6.8e-29
WP_003666939.1|1209081_1210833_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_003666938.1|1210840_1211686_-|tail	phage tail family protein	tail	E9LUJ3	Lactobacillus_phage	35.6	2.0e-36
WP_003666937.1|1211700_1215540_-	tape measure protein	NA	A0A0M9JJ59	Lactobacillus_phage	34.5	3.8e-114
WP_003666935.1|1215756_1216155_-	hypothetical protein	NA	A0A2P0ZL35	Lactobacillus_phage	34.7	5.1e-06
WP_003666934.1|1216204_1216915_-|tail	phage tail protein	tail	A0A0M7RF39	Lactobacillus_phage	52.1	1.3e-55
WP_003666933.1|1216919_1217303_-	DUF806 family protein	NA	A0A2P0ZLF4	Lactobacillus_phage	37.7	8.9e-16
WP_003666932.1|1217299_1217725_-	HK97 gp10 family phage protein	NA	A0A0M7RDL2	Lactobacillus_phage	49.0	6.6e-28
WP_003666931.1|1217717_1218068_-|head	phage head closure protein	head	Q6J1Y0	Lactobacillus_phage	35.4	4.1e-07
WP_003666930.1|1218036_1218405_-|head,tail	phage gp6-like head-tail connector protein	head,tail	F8HGT2	Streptococcus_phage	48.4	5.9e-17
WP_011953496.1|1218424_1219600_-|capsid	phage major capsid protein	capsid	Q9T1F6	Lactobacillus_phage	57.5	1.4e-120
WP_003666928.1|1219589_1220324_-|protease	Clp protease ClpP	protease	E9LUQ2	Lactobacillus_phage	54.5	8.1e-58
WP_003666926.1|1220307_1221498_-|portal	phage portal protein	portal	E9LUQ1	Lactobacillus_phage	58.2	1.4e-131
WP_080502972.1|1221515_1221695_-	DUF1056 family protein	NA	NA	NA	NA	NA
WP_003666925.1|1221684_1223574_-|terminase	terminase large subunit	terminase	E9LUP9	Lactobacillus_phage	63.5	1.9e-244
WP_003666924.1|1223597_1223813_+	hypothetical protein	NA	A0A0A7RTH9	Clostridium_phage	52.8	9.4e-07
WP_003666923.1|1223809_1224247_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011953499.1|1224269_1224743_-|terminase	phage terminase small subunit P27 family	terminase	A0A2P0VIH5	Streptococcus_phage	50.0	3.2e-39
WP_003666921.1|1224887_1225424_-	HNH endonuclease	NA	E9LUP7	Lactobacillus_phage	53.7	3.7e-44
WP_003666920.1|1225491_1225671_-	hypothetical protein	NA	F8J1H1	Lactobacillus_phage	50.0	2.7e-07
WP_003664118.1|1226330_1226789_-|transposase	IS200/IS605 family transposase	transposase	A0A1P8BMC0	Lactococcus_phage	37.0	3.9e-18
>prophage 9
NC_010609	Lactobacillus reuteri JCM 1112, complete genome	2039414	1233368	1241084	2039414	integrase	Lactobacillus_phage(28.57%)	13	1236578:1236593	1246588:1246603
WP_003668359.1|1233368_1234193_-	PD-(D/E)XK nuclease-like domain-containing protein	NA	E9LUM4	Lactobacillus_phage	64.5	1.1e-106
WP_003668360.1|1234176_1235166_-	recombinase RecT	NA	E9LUM3	Lactobacillus_phage	46.4	7.3e-62
WP_003666975.1|1235158_1235389_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003666974.1|1235424_1235610_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003666973.1|1235662_1236169_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003666969.1|1236448_1236727_-	hypothetical protein	NA	NA	NA	NA	NA
1236578:1236593	attL	ATCTGGATAGTTTTCT	NA	NA	NA	NA
WP_003666968.1|1236738_1237542_-	phage repressor protein/antirepressor Ant	NA	Q6SEF4	Lactobacillus_prophage	61.0	1.3e-77
WP_003666967.1|1237560_1237764_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_011953501.1|1237942_1238380_+	helix-turn-helix transcriptional regulator	NA	Q0H244	Geobacillus_phage	44.1	1.9e-22
WP_003666963.1|1238392_1238833_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A0S2MV59	Bacillus_phage	37.6	1.6e-16
WP_003666961.1|1238961_1239471_+	Ltp family lipoprotein	NA	Q6SEA6	Lactobacillus_prophage	70.3	7.7e-15
WP_003666960.1|1239633_1239951_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003666958.1|1239953_1241084_+|integrase	site-specific integrase	integrase	A0A1S5SA77	Streptococcus_phage	34.7	2.1e-49
1246588:1246603	attR	ATCTGGATAGTTTTCT	NA	NA	NA	NA
>prophage 10
NC_010609	Lactobacillus reuteri JCM 1112, complete genome	2039414	1380682	1454520	2039414	tRNA,integrase,protease,transposase	Staphylococcus_phage(18.75%)	54	1430670:1430689	1440576:1440595
WP_003668546.1|1380682_1383103_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	68.1	0.0e+00
WP_003668547.1|1383424_1384612_-	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	67.7	3.6e-148
WP_003668549.1|1384772_1385312_-	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
WP_003668551.1|1385734_1387174_-	MFS transporter	NA	NA	NA	NA	NA
WP_003675841.1|1387297_1387753_+	transcriptional repressor	NA	NA	NA	NA	NA
WP_003668553.1|1387784_1389131_-	amino acid permease	NA	NA	NA	NA	NA
WP_003668554.1|1389221_1389833_+	VanZ family protein	NA	NA	NA	NA	NA
WP_003664220.1|1389844_1390012_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003668555.1|1390179_1390704_+	DUF308 domain-containing protein	NA	NA	NA	NA	NA
WP_003668556.1|1390727_1391171_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003668557.1|1391170_1392673_-	LytTR family transcriptional regulator	NA	Q6DMX4	Streptococcus_phage	27.2	4.4e-34
WP_003664225.1|1392799_1393231_-	Hsp20/alpha crystallin family protein	NA	NA	NA	NA	NA
WP_003668559.1|1393363_1394212_+	aldo/keto reductase	NA	NA	NA	NA	NA
WP_003668560.1|1394309_1395608_-	NAD-dependent dihydropyrimidine dehydrogenase subunit PreA	NA	NA	NA	NA	NA
WP_003668561.1|1395600_1396842_-	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_003668562.1|1397137_1397899_+	exodeoxyribonuclease III	NA	E3T4M6	Cafeteria_roenbergensis_virus	42.0	7.6e-51
WP_003668563.1|1398020_1398728_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A0E3XCL7	Enterococcus_phage	46.4	9.3e-27
WP_003668564.1|1399056_1400757_-	phosphoenolpyruvate carboxykinase	NA	NA	NA	NA	NA
WP_011953516.1|1400911_1401673_-	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_003668566.1|1402057_1402951_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003664234.1|1402959_1403538_-	anaerobic ribonucleoside-triphosphate reductase activating protein	NA	A0A0C5K925	Enterococcus_phage	59.7	3.6e-53
WP_003668567.1|1403603_1405838_-	anaerobic ribonucleoside-triphosphate reductase	NA	A0A0C5KKX3	Enterococcus_phage	59.4	1.8e-249
WP_003668569.1|1406243_1407641_+	multidrug efflux MFS transporter	NA	NA	NA	NA	NA
WP_003668571.1|1407678_1408233_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003668573.1|1414827_1415076_-	YkuJ family protein	NA	NA	NA	NA	NA
WP_003668575.1|1415133_1416147_-	flippase-like domain-containing protein	NA	NA	NA	NA	NA
WP_011953518.1|1416146_1417175_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_003668578.1|1417177_1418395_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_003668580.1|1418628_1420359_-	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	27.0	1.5e-14
WP_003664342.1|1420358_1420625_-	phosphocarrier protein HPr	NA	NA	NA	NA	NA
WP_003664345.1|1420746_1420932_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003668582.1|1421207_1423412_+|protease	ATP-dependent Clp protease ATP-binding subunit	protease	A0A223W0B1	Agrobacterium_phage	41.1	3.3e-123
WP_003668584.1|1423462_1424071_-	ECF transporter S component	NA	NA	NA	NA	NA
WP_003668586.1|1424220_1424946_+	MucBP domain-containing protein	NA	NA	NA	NA	NA
WP_003668588.1|1425076_1425763_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003668591.1|1425762_1426629_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.6	1.4e-19
WP_011953520.1|1426606_1426990_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003668595.1|1427153_1428128_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003668597.1|1428061_1429504_-	glycosyl hydrolase 53 family protein	NA	NA	NA	NA	NA
WP_003668598.1|1430069_1430624_-	cell wall-binding protein	NA	NA	NA	NA	NA
WP_003668600.1|1430533_1430893_-	hypothetical protein	NA	NA	NA	NA	NA
1430670:1430689	attL	GGATCAAAGTAGTAATATGT	NA	NA	NA	NA
WP_003668601.1|1431025_1431244_-|transposase	transposase	transposase	A0A1B1P773	Bacillus_phage	40.8	6.2e-06
WP_003668602.1|1431274_1431649_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A1B1P773	Bacillus_phage	37.8	1.2e-12
WP_003668612.1|1435043_1435391_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_003668614.1|1435390_1436035_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_003668618.1|1437121_1441588_-	KxYKxGKxW signal peptide domain-containing protein	NA	NA	NA	NA	NA
1440576:1440595	attR	GGATCAAAGTAGTAATATGT	NA	NA	NA	NA
WP_003668620.1|1441743_1442625_-	C40 family peptidase	NA	A0A1J0GW44	Streptomyces_phage	44.3	6.6e-22
WP_003668623.1|1442775_1444149_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	27.0	2.7e-30
WP_003664118.1|1444800_1445259_+|transposase	IS200/IS605 family transposase	transposase	A0A1P8BMC0	Lactococcus_phage	37.0	3.9e-18
WP_003668625.1|1445431_1447009_-	peptide chain release factor 3	NA	A0A1B0RXH7	Streptococcus_phage	26.1	6.3e-31
WP_003668627.1|1447195_1448662_+	LCP family protein	NA	NA	NA	NA	NA
WP_003668628.1|1448705_1450274_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003668630.1|1450257_1451385_-	AI-2E family transporter	NA	NA	NA	NA	NA
WP_035167652.1|1453275_1454520_-|transposase	ISLre2 family transposase	transposase	NA	NA	NA	NA
>prophage 11
NC_010609	Lactobacillus reuteri JCM 1112, complete genome	2039414	1683071	1702298	2039414	protease,integrase,transposase	Streptococcus_phage(40.0%)	19	1685806:1685820	1713462:1713476
WP_003668960.1|1683071_1683758_-|protease	matrixin family metalloprotease	protease	NA	NA	NA	NA
WP_011953550.1|1683781_1684396_-	sugar permease	NA	NA	NA	NA	NA
WP_003668962.1|1684701_1685757_-	zinc-dependent alcohol dehydrogenase family protein	NA	K7Z7U2	Megavirus	23.0	8.5e-08
1685806:1685820	attL	GAAAAAGCTGATAAC	NA	NA	NA	NA
WP_003668964.1|1687077_1687224_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080502982.1|1687224_1687407_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_003668965.1|1687523_1688918_+|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	39.5	1.8e-29
WP_003668966.1|1689132_1690380_+|transposase	ISL3 family transposase	transposase	Q6V7R1	Burkholderia_virus	23.9	5.7e-11
WP_003668967.1|1690447_1690690_-	cytochrome b5	NA	NA	NA	NA	NA
WP_011953551.1|1690781_1691252_-|transposase	transposase	transposase	A0A1S5SBP9	Streptococcus_phage	31.2	1.6e-11
WP_003668972.1|1691899_1692487_-	DUF4767 domain-containing protein	NA	NA	NA	NA	NA
WP_003668974.1|1692940_1694152_+	putative hydroxymethylpyrimidine transporter CytX	NA	NA	NA	NA	NA
WP_003668975.1|1694225_1694747_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003668976.1|1694962_1695427_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003668977.1|1695439_1696507_-	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_011953553.1|1696599_1697760_-	MFS transporter	NA	NA	NA	NA	NA
WP_035164165.1|1697778_1698315_+	TIGR01440 family protein	NA	NA	NA	NA	NA
WP_003668981.1|1698506_1699379_-	RNA methyltransferase	NA	NA	NA	NA	NA
WP_003668982.1|1699449_1700688_-	OFA family MFS transporter	NA	NA	NA	NA	NA
WP_003668983.1|1701080_1702298_-|integrase	site-specific integrase	integrase	A0A1S5S7K9	Streptococcus_phage	28.0	2.7e-21
1713462:1713476	attR	GTTATCAGCTTTTTC	NA	NA	NA	NA
