The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_007626	Magnetospirillum magneticum AMB-1, complete genome	4967148	64069	71494	4967148		Escherichia_phage(33.33%)	6	NA	NA
WP_011382505.1|64069_65188_+	dTDP-glucose 4,6-dehydratase	NA	A0A1D7XFE8	Escherichia_phage	47.0	2.1e-81
WP_011382506.1|65184_66075_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	A0A291LA53	Escherichia_phage	54.2	8.0e-84
WP_011382507.1|66071_67868_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.0	1.2e-22
WP_011382508.1|67880_68906_+	SDR family oxidoreductase	NA	M4QPK0	Synechococcus_phage	40.3	3.8e-53
WP_011382509.1|68924_70481_+	adenylyltransferase/cytidyltransferase family protein	NA	M4QSA2	Synechococcus_phage	42.1	7.9e-10
WP_043742990.1|70501_71494_+	NAD-dependent epimerase/dehydratase family protein	NA	A0A1V0SKV4	Klosneuvirus	24.8	8.0e-16
>prophage 2
NC_007626	Magnetospirillum magneticum AMB-1, complete genome	4967148	221255	229531	4967148		uncultured_virus(28.57%)	10	NA	NA
WP_043743064.1|221255_222242_+	D-glycerate dehydrogenase	NA	A0A1B1IVB5	uncultured_Mediterranean_phage	31.8	1.1e-25
WP_011382643.1|222306_222831_-	Spy/CpxP family protein refolding chaperone	NA	NA	NA	NA	NA
WP_011382644.1|222949_223396_-	DsrE/DsrF/DrsH-like family protein	NA	NA	NA	NA	NA
WP_011382645.1|223382_224183_-	molybdopterin-synthase adenylyltransferase MoeB	NA	A0A1V0SAV8	Catovirus	25.0	3.5e-06
WP_011382646.1|224259_225219_-	cysteine synthase A	NA	A0A1X9I5K7	Streptococcus_phage	54.5	1.2e-82
WP_011382647.1|225274_225730_-	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_011382648.1|225735_226191_-	dUTP diphosphatase	NA	K4JSC8	Caulobacter_phage	59.9	6.2e-40
WP_011382649.1|226190_227396_-	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	33.5	4.3e-40
WP_011382650.1|227556_229215_-	chaperonin GroEL	NA	A0A219YK78	uncultured_virus	61.9	1.1e-179
WP_008613804.1|229243_229531_-	co-chaperone GroES	NA	A0A221S4G8	uncultured_virus	59.6	7.4e-23
>prophage 3
NC_007626	Magnetospirillum magneticum AMB-1, complete genome	4967148	391932	434384	4967148	capsid,transposase,terminase,head,portal	Acidithiobacillus_phage(33.33%)	50	NA	NA
WP_011382803.1|391932_394206_+	PriCT-2 domain-containing protein	NA	Q6UYG6	Burkholderia_phage	29.1	9.4e-20
WP_148207251.1|394205_394601_+	hypothetical protein	NA	NA	NA	NA	NA
WP_173361901.1|394690_395110_+	hypothetical protein	NA	K4ICN3	Acidithiobacillus_phage	66.2	8.5e-44
WP_011382805.1|395106_395304_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011382806.1|395296_395788_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043745812.1|396236_397745_+	DNA cytosine methyltransferase	NA	Q6V7R9	Burkholderia_virus	44.1	1.0e-94
WP_011382808.1|397747_399019_+	site-specific DNA-methyltransferase	NA	A0A0A8ILE7	Aurantimonas_phage	50.7	1.7e-119
WP_011382809.1|399005_399221_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011382810.1|399223_399388_-	hypothetical protein	NA	A0A1X9I6B9	Streptococcus_phage	57.4	2.1e-06
WP_043743175.1|399479_399689_+	hypothetical protein	NA	K4I1E3	Acidithiobacillus_phage	69.1	1.1e-15
WP_011382811.1|399764_400034_+	HU family DNA-binding protein	NA	A0A1B0WKX2	Flavobacterium_phage	36.1	1.3e-05
WP_011382812.1|400037_400226_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011382813.1|400201_400792_-	DUF3489 domain-containing protein	NA	K4HZZ2	Acidithiobacillus_phage	40.1	8.1e-16
WP_011382814.1|400892_401072_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043743177.1|401114_401480_-	hypothetical protein	NA	K4ICP1	Acidithiobacillus_phage	57.3	7.2e-31
WP_011382816.1|401577_402129_+	hypothetical protein	NA	A0A2H4JCL4	uncultured_Caudovirales_phage	46.7	6.1e-34
WP_011382817.1|402076_404062_+|terminase	phage terminase large subunit family protein	terminase	A0A2H4JIC6	uncultured_Caudovirales_phage	58.2	4.2e-210
WP_009870805.1|404064_404274_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011382818.1|404276_405707_+|portal	phage portal protein	portal	K4I1F2	Acidithiobacillus_phage	69.8	3.9e-189
WP_011382819.1|405715_406948_+	S49 family peptidase	NA	K4HZZ6	Acidithiobacillus_phage	47.6	8.5e-84
WP_011382820.1|406960_407350_+|head	head decoration protein	head	K4ICP8	Acidithiobacillus_phage	58.1	4.2e-29
WP_011382821.1|407364_408387_+|capsid	major capsid protein	capsid	K4I3Z3	Acidithiobacillus_phage	57.5	2.2e-106
WP_011382822.1|408386_408683_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011382823.1|408679_409318_+	hypothetical protein	NA	G8DH49	Emiliania_huxleyi_virus	46.2	2.3e-40
WP_011382824.1|409298_410432_-	Fic family protein	NA	D7RWK9	Brochothrix_phage	33.7	5.3e-08
WP_011382825.1|410562_410991_+	hypothetical protein	NA	G8DH50	Emiliania_huxleyi_virus	48.2	6.0e-29
WP_011382826.1|411018_411978_+	hypothetical protein	NA	G8DH51	Emiliania_huxleyi_virus	44.2	7.6e-64
WP_011382827.1|411980_412496_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011382828.1|412522_412708_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011382829.1|412711_415702_+	tape measure protein	NA	NA	NA	NA	NA
WP_011382830.1|415698_416196_+	hypothetical protein	NA	Q9MCA0	Pseudomonas_phage	46.0	3.5e-20
WP_011382831.1|416202_417072_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011382832.1|417082_417493_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011382833.1|417497_418064_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011382834.1|418066_419410_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011382835.1|419412_419850_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011382836.1|419879_420230_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011382837.1|420222_420747_+	DUF1833 family protein	NA	NA	NA	NA	NA
WP_043745819.1|420847_421243_+	C40 family peptidase	NA	A0A0G3EYJ9	Achromobacter_phage	42.4	1.3e-22
WP_011382839.1|421239_423567_+	hypothetical protein	NA	A0A0B5A1N2	Achromobacter_phage	38.4	2.5e-116
WP_043743182.1|423629_424067_+	structural protein	NA	A0A2I7RXE2	Vibrio_phage	45.5	1.8e-28
WP_011382841.1|424069_424666_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083763589.1|424786_425806_-	rod shape-determining protein	NA	NA	NA	NA	NA
WP_083763405.1|426171_428502_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_148207252.1|428522_429182_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148207253.1|429859_430700_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011382844.1|431794_432820_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148207254.1|433206_433395_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148207255.1|433422_433695_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008622511.1|434033_434384_+|transposase	transposase	transposase	A0A1B0YZU7	Pseudomonas_phage	54.2	8.5e-05
>prophage 4
NC_007626	Magnetospirillum magneticum AMB-1, complete genome	4967148	489668	501817	4967148	transposase,integrase	Pseudomonas_phage(22.22%)	19	487781:487795	494168:494182
487781:487795	attL	CCGGCGGCGAGGCGC	NA	NA	NA	NA
WP_011382890.1|489668_491870_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A0M4U788	Ralstonia_phage	38.0	8.9e-68
WP_011382891.1|491937_492681_+	ATP-binding protein	NA	A0A0A1IVZ3	Pseudomonas_phage	52.5	3.3e-67
WP_011382892.1|492680_493325_+	hypothetical protein	NA	M4SNW4	Rhodobacter_phage	39.2	3.2e-26
WP_011382893.1|493314_493716_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011382894.1|493705_493975_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011382895.1|493971_494313_+	hypothetical protein	NA	NA	NA	NA	NA
494168:494182	attR	CCGGCGGCGAGGCGC	NA	NA	NA	NA
WP_011382896.1|494309_494807_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011382898.1|494937_495474_+	host-nuclease inhibitor Gam family protein	NA	C9DGL8	Escherichia_phage	48.3	2.6e-37
WP_011382899.1|495470_495818_+	hypothetical protein	NA	A0A0U5KSG7	unidentified_phage	48.9	1.7e-18
WP_011382900.1|495822_496104_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011382901.1|496105_496639_+	DUF1566 domain-containing protein	NA	A0A2I6PHV0	Pseudomonas_phage	33.7	2.4e-19
WP_011382902.1|496704_497247_+	DUF1566 domain-containing protein	NA	NA	NA	NA	NA
WP_011382903.1|497311_497668_+	four helix bundle protein	NA	NA	NA	NA	NA
WP_148207261.1|497943_499059_+	RNA-directed DNA polymerase	NA	H7BVN7	unidentified_phage	36.1	1.2e-44
WP_011382905.1|499055_499787_+	class I SAM-dependent methyltransferase	NA	A0A076GD02	Sinorhizobium_phage	50.8	7.8e-53
WP_011382906.1|499783_500452_+	regulatory protein GemA	NA	NA	NA	NA	NA
WP_148207263.1|500463_500802_-	zinc ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_011382908.1|500879_501251_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011382909.1|501364_501817_+	hypothetical protein	NA	A0A1B1IQT0	uncultured_Mediterranean_phage	38.8	1.0e-18
>prophage 5
NC_007626	Magnetospirillum magneticum AMB-1, complete genome	4967148	961676	997303	4967148	transposase,protease,integrase	Shigella_phage(16.67%)	32	960963:960977	995862:995876
960963:960977	attL	TCGCCTGCCGCCCCG	NA	NA	NA	NA
WP_043743433.1|961676_962414_+|protease	proteasome-type protease	protease	NA	NA	NA	NA
WP_011383344.1|962680_964069_-	peptidoglycan DD-metalloendopeptidase family protein	NA	G9BW84	Planktothrix_phage	41.0	9.7e-20
WP_043746000.1|970259_971309_+|integrase	site-specific integrase	integrase	W6MYA3	Pseudomonas_phage	39.4	1.5e-52
WP_148207292.1|971301_971820_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043743436.1|972085_974710_+	DEAD/DEAH box helicase	NA	A0A2H4PCN4	Arthrobacter_phage	30.1	3.7e-44
WP_011383349.1|974931_975783_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011383350.1|975796_977311_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_148207293.1|977355_977805_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008620715.1|977961_978675_-	signal transduction histidine kinase	NA	NA	NA	NA	NA
WP_173361904.1|978702_978885_-|transposase	transposase	transposase	A0A220NQR7	Corynebacterium_phage	46.8	2.0e-05
WP_008620711.1|979455_980070_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_011383353.1|980220_980460_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050750625.1|981729_982824_+	two-component sensor histidine kinase	NA	NA	NA	NA	NA
WP_011383355.1|983205_983484_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_083763424.1|983698_984457_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_083763425.1|984584_985049_-	DUF1465 family protein	NA	NA	NA	NA	NA
WP_011383357.1|985388_985715_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A088CBP5	Shigella_phage	40.5	1.3e-10
WP_008620724.1|985711_985993_+	helix-turn-helix transcriptional regulator	NA	A0A088CD40	Shigella_phage	43.3	9.8e-12
WP_083763426.1|986143_986539_-	transcriptional repressor	NA	NA	NA	NA	NA
WP_008622021.1|986844_987225_+	response regulator	NA	NA	NA	NA	NA
WP_011383360.1|987310_987772_-	transcriptional repressor NrdR	NA	NA	NA	NA	NA
WP_083763427.1|988097_989627_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	32.8	6.5e-17
WP_043743454.1|989743_990139_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050750627.1|990215_992045_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	34.3	6.0e-17
WP_011383363.1|992070_992298_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162470165.1|992483_992651_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083763593.1|992671_992974_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158303994.1|992990_993323_+	HU family DNA-binding protein	NA	B5TA87	Burkholderia_phage	55.6	4.8e-18
WP_011383364.1|993312_993726_+	MucR family transcriptional regulator	NA	A0A1P8VVG0	Erythrobacter_phage	47.4	3.0e-17
WP_011383366.1|994460_995318_+|integrase	tyrosine-type recombinase/integrase	integrase	S5W9T9	Leptospira_phage	35.3	2.3e-35
WP_011383368.1|996525_996774_+	hypothetical protein	NA	NA	NA	NA	NA
995862:995876	attR	TCGCCTGCCGCCCCG	NA	NA	NA	NA
WP_008621829.1|996928_997303_+|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	47.7	8.4e-27
>prophage 6
NC_007626	Magnetospirillum magneticum AMB-1, complete genome	4967148	1196225	1256607	4967148	protease,capsid,terminase,head,portal	Acidithiobacillus_phage(44.0%)	61	NA	NA
WP_043743542.1|1196225_1196558_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	42.1	5.9e-16
WP_011383536.1|1196601_1198896_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	44.5	1.1e-180
WP_043746153.1|1199451_1200030_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_083763597.1|1200045_1201269_+	23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN	NA	NA	NA	NA	NA
WP_011383538.1|1201344_1202559_+	argininosuccinate synthase	NA	NA	NA	NA	NA
WP_148207309.1|1202784_1205175_+	PAS domain-containing protein	NA	NA	NA	NA	NA
WP_011383540.1|1205240_1206848_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_011383542.1|1207549_1207939_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011383543.1|1208225_1208732_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_011383544.1|1208826_1209534_+	Abi family protein	NA	NA	NA	NA	NA
WP_011383545.1|1209549_1211505_-	DUF3732 domain-containing protein	NA	NA	NA	NA	NA
WP_011383546.1|1211501_1212014_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043743549.1|1212015_1213215_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011383548.1|1213429_1213732_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011383550.1|1214219_1215185_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_083763442.1|1215279_1216011_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_011383552.1|1216007_1222400_+	DUF4347 domain-containing protein	NA	NA	NA	NA	NA
WP_148207310.1|1222420_1224133_+	TolC family protein	NA	NA	NA	NA	NA
WP_011383554.1|1224132_1224858_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_011383555.1|1224854_1226141_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_011383556.1|1226143_1228240_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_011383557.1|1228239_1228626_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148207311.1|1228909_1229548_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043743558.1|1229666_1229918_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_011383559.1|1229911_1230187_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011383560.1|1230183_1230663_+	hypothetical protein	NA	K4HZ96	Acidithiobacillus_phage	44.8	6.3e-27
WP_011383561.1|1230755_1231592_+	ATP-binding protein	NA	K4HZX9	Acidithiobacillus_phage	47.6	4.3e-63
WP_011383562.1|1231609_1232353_+	hypothetical protein	NA	K4ICM8	Acidithiobacillus_phage	36.6	7.3e-22
WP_011383563.1|1232370_1232598_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011383564.1|1232609_1232966_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011383565.1|1232976_1233774_+	hypothetical protein	NA	K4HZA0	Acidithiobacillus_phage	51.5	3.5e-62
WP_011383566.1|1233770_1236287_+	toprim domain-containing protein	NA	A0A2D1GN57	Marinobacter_phage	37.3	1.0e-75
WP_011383567.1|1236289_1236961_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043746159.1|1236965_1237385_-	TIR domain-containing protein	NA	Q4ZA72	Staphylococcus_virus	30.2	1.0e-09
WP_043743561.1|1238063_1238534_+	hypothetical protein	NA	K4ICN3	Acidithiobacillus_phage	64.3	2.3e-50
WP_011383570.1|1238530_1238950_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043746161.1|1239397_1241215_+	DNA cytosine methyltransferase	NA	Q6V7R9	Burkholderia_virus	51.1	4.3e-15
WP_011383572.1|1241211_1242078_+	phosphoadenosine phosphosulfate reductase family protein	NA	A0A2H4J418	uncultured_Caudovirales_phage	43.2	1.2e-60
WP_011383573.1|1242080_1243349_+	site-specific DNA-methyltransferase	NA	A0A0A8ILE7	Aurantimonas_phage	50.2	8.9e-121
WP_011383574.1|1243335_1243545_-	hypothetical protein	NA	NA	NA	NA	NA
WP_173361892.1|1243546_1243711_-	hypothetical protein	NA	A0A1B0RXC3	Streptococcus_phage	60.0	9.4e-07
WP_043743562.1|1243802_1244015_+	hypothetical protein	NA	K4I1E3	Acidithiobacillus_phage	62.3	1.4e-15
WP_011383576.1|1244086_1244356_+	HU family DNA-binding protein	NA	NA	NA	NA	NA
WP_011383577.1|1244359_1244557_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011383578.1|1244526_1244724_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043743564.1|1244735_1245323_-	DUF3489 domain-containing protein	NA	K4HZZ2	Acidithiobacillus_phage	34.6	5.2e-15
WP_011383580.1|1245446_1245665_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043743566.1|1245769_1246315_+	hypothetical protein	NA	A0A2H4JCL4	uncultured_Caudovirales_phage	48.3	5.5e-35
WP_011383582.1|1246262_1248251_+|terminase	phage terminase large subunit family protein	terminase	A0A2H4JIC6	uncultured_Caudovirales_phage	58.4	1.7e-211
WP_011383583.1|1248256_1248466_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011383584.1|1248468_1249887_+|portal	phage portal protein	portal	K4I1F2	Acidithiobacillus_phage	75.1	5.0e-197
WP_011383585.1|1249895_1251110_+	S49 family peptidase	NA	K4HZZ6	Acidithiobacillus_phage	53.0	2.1e-98
WP_011383586.1|1251112_1251502_+|head	head decoration protein	head	K4ICP8	Acidithiobacillus_phage	59.7	1.3e-30
WP_011383587.1|1251516_1252539_+|capsid	major capsid protein	capsid	K4I3Z3	Acidithiobacillus_phage	57.5	5.9e-107
WP_011383588.1|1252541_1252838_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011383589.1|1252834_1253473_+	hypothetical protein	NA	G8DH49	Emiliania_huxleyi_virus	46.2	7.8e-41
WP_011383590.1|1253472_1253901_+	hypothetical protein	NA	G8DH50	Emiliania_huxleyi_virus	47.5	3.9e-28
WP_011383591.1|1253927_1254887_+	hypothetical protein	NA	G8DH51	Emiliania_huxleyi_virus	44.2	5.8e-64
WP_011382827.1|1254889_1255405_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011383592.1|1255431_1255617_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043743570.1|1255626_1256607_+	hypothetical protein	NA	A0A1B1IPE0	uncultured_Mediterranean_phage	45.3	4.5e-80
>prophage 7
NC_007626	Magnetospirillum magneticum AMB-1, complete genome	4967148	1856262	1890977	4967148	protease,transposase,tail,integrase,head	Microcystis_virus(33.33%)	32	1869925:1869942	1879392:1879409
WP_011384116.1|1856262_1857816_+|protease	serine protease	protease	A0A1B1IRH0	uncultured_Mediterranean_phage	30.3	1.6e-10
WP_011384117.1|1857852_1858074_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043743942.1|1858109_1858787_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011384119.1|1858812_1859904_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148207356.1|1860214_1860901_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011384121.1|1860939_1862400_+	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	A0A075BUR2	Microcystis_phage	46.0	8.6e-35
WP_011384122.1|1862648_1863443_+	formylglycine-generating enzyme family protein	NA	A0A7H6	Microcystis_virus	45.5	1.3e-48
WP_011384123.1|1863534_1863726_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011384124.1|1863746_1864595_+	DUF4384 domain-containing protein	NA	NA	NA	NA	NA
WP_011384125.1|1864591_1865833_+	DUF799 family lipoprotein	NA	NA	NA	NA	NA
WP_011384126.1|1865829_1866459_+	hypothetical protein	NA	M1I819	Pelagibacter_phage	28.0	1.7e-11
WP_148207358.1|1866722_1867733_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011384128.1|1867784_1868561_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083763602.1|1868608_1869394_+	formylglycine-generating enzyme family protein	NA	A0A7H6	Microcystis_virus	44.9	4.0e-47
WP_148207587.1|1869485_1870937_+	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	A0A7H6	Microcystis_virus	43.1	2.8e-46
1869925:1869942	attL	GCTCCGACACCGCCAAGG	NA	NA	NA	NA
WP_148207359.1|1871009_1871687_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148207360.1|1871840_1873787_+	caspase family protein	NA	NA	NA	NA	NA
WP_043743954.1|1873795_1874125_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050750670.1|1874272_1875061_-|integrase	site-specific integrase	integrase	A0A221SAN4	Ralstonia_phage	30.9	2.0e-17
WP_148207277.1|1875144_1876291_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_148207361.1|1876411_1876783_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043743958.1|1877304_1878171_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083763603.1|1878304_1878664_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_148207362.1|1880385_1881240_-	replication protein	NA	NA	NA	NA	NA
1879392:1879409	attR	CCTTGGCGGTGTCGGAGC	NA	NA	NA	NA
WP_083763476.1|1881254_1881476_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_011384139.1|1882610_1883192_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011384140.1|1883255_1883840_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083763477.1|1884006_1884219_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_011384143.1|1884674_1885376_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011384144.1|1885368_1886415_+|protease	phage protease	protease	A0A0M3LPA7	Mannheimia_phage	27.6	2.7e-22
WP_011384145.1|1886418_1887348_+|head	Mu-like prophage major head subunit gpT family protein	head	J9SVY7	Pseudomonas_phage	43.9	2.1e-71
WP_011384146.1|1887359_1890977_+|tail	phage tail length tape measure family protein	tail	NA	NA	NA	NA
>prophage 8
NC_007626	Magnetospirillum magneticum AMB-1, complete genome	4967148	1897928	1908375	4967148	capsid,protease,head	Burkholderia_phage(20.0%)	12	NA	NA
WP_011384161.1|1897928_1898669_+	transglycosylase SLT domain-containing protein	NA	M4R0Y9	Tetraselmis_viridis_virus	49.5	1.7e-39
WP_148207588.1|1898776_1899250_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011384163.1|1899242_1899458_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011384164.1|1899454_1899814_+	hypothetical protein	NA	Q6QIC4	Burkholderia_phage	48.2	5.4e-15
WP_011384165.1|1899791_1900121_+	hypothetical protein	NA	A0A0S4L0A3	Pseudomonas_phage	64.7	2.1e-34
WP_011384166.1|1900117_1900681_+	DUF3486 family protein	NA	Q6QIC2	Burkholderia_phage	55.1	1.2e-45
WP_011384168.1|1900815_1902453_+	hypothetical protein	NA	A0A219VH72	Ochrobactrum_phage	43.6	4.1e-110
WP_011384169.1|1902452_1904057_+	DUF935 domain-containing protein	NA	A0A2P9JZI9	Alteromonadaceae_phage	43.9	4.6e-106
WP_083763481.1|1904049_1905453_+|capsid	minor capsid protein	capsid	A0A219VH74	Ochrobactrum_phage	48.1	6.3e-59
WP_043743974.1|1905849_1907061_+|protease	phage protease	protease	H7BWC3	unidentified_phage	28.4	7.0e-14
WP_148207589.1|1907085_1907469_+	hypothetical protein	NA	J9RWG0	Pseudomonas_phage	58.4	2.7e-28
WP_011384173.1|1907481_1908375_+|head	Mu-like prophage major head subunit gpT family protein	head	M4SRT6	Rhodobacter_phage	56.9	2.3e-99
>prophage 9
NC_007626	Magnetospirillum magneticum AMB-1, complete genome	4967148	1962170	1970503	4967148		uncultured_Caudovirales_phage(57.14%)	10	NA	NA
WP_011384227.1|1962170_1963022_+	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	40.2	2.0e-44
WP_011384228.1|1963050_1964328_+	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	61.1	4.3e-139
WP_011384229.1|1964377_1965052_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_043744012.1|1965156_1965948_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_011384231.1|1965944_1967540_+	GHKL domain-containing protein	NA	W8CYF6	Bacillus_phage	26.9	2.3e-12
WP_043744015.1|1967626_1968043_+	helix-turn-helix transcriptional regulator	NA	A0A2H4J145	uncultured_Caudovirales_phage	53.0	1.9e-11
WP_011384233.1|1968039_1968540_+	arsenate reductase ArsC	NA	A0A2H4J8A6	uncultured_Caudovirales_phage	38.1	2.9e-22
WP_011384234.1|1968553_1969012_+	arsenate reductase ArsC	NA	A0A2H4J8A6	uncultured_Caudovirales_phage	46.0	3.7e-24
WP_173361911.1|1969047_1970070_+	ACR3 family arsenite efflux transporter	NA	NA	NA	NA	NA
WP_011384236.1|1970074_1970503_+	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	72.7	3.0e-52
>prophage 10
NC_007626	Magnetospirillum magneticum AMB-1, complete genome	4967148	2029718	2073794	4967148	transposase,tail,integrase,plate	Bacillus_phage(16.67%)	40	2034265:2034281	2080995:2081011
WP_011384289.1|2029718_2031314_+|tail	phage tail sheath family protein	tail	J9PVC2	Bacillus_phage	30.2	1.4e-51
WP_011384290.1|2031336_2031780_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_011384291.1|2031805_2032135_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043744050.1|2032330_2032780_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_011384294.1|2032776_2033781_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011384295.1|2033780_2034470_+	hypothetical protein	NA	NA	NA	NA	NA
2034265:2034281	attL	TCGCCCAGACCACCTTG	NA	NA	NA	NA
WP_011384296.1|2034462_2035506_+	phage late control D family protein	NA	NA	NA	NA	NA
WP_011384297.1|2035502_2036129_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011384298.1|2036153_2036567_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011384299.1|2036573_2036984_+	GPW/gp25 family protein	NA	A0A1D8KJJ7	Synechococcus_phage	29.5	1.9e-08
WP_011384300.1|2036995_2037184_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011384301.1|2037185_2040266_+|plate	putative baseplate assembly protein	plate	NA	NA	NA	NA
WP_011384302.1|2040273_2041371_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011384303.1|2041367_2042336_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011384304.1|2042345_2043170_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050750678.1|2043184_2046577_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011384306.1|2046579_2047200_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148207367.1|2047214_2047724_+	aspartyl/asparaginyl beta-hydroxylase domain-containing protein	NA	A0A1V0SE75	Indivirus	25.4	7.2e-05
WP_011384308.1|2047720_2049856_+	ATP-binding protein	NA	K9MCS8	Sulfolobus_virus	34.0	8.3e-10
WP_011384309.1|2049926_2050784_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011384310.1|2050805_2051732_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011384311.1|2051742_2052834_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011384312.1|2052830_2053307_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158303957.1|2053690_2053807_+	K(+)-transporting ATPase subunit F	NA	NA	NA	NA	NA
WP_011384314.1|2053818_2055489_+	potassium-transporting ATPase subunit KdpA	NA	NA	NA	NA	NA
WP_011384315.1|2055497_2057528_+	potassium-transporting ATPase subunit KdpB	NA	M1HLC0	Paramecium_bursaria_Chlorella_virus	25.7	6.4e-28
WP_043744056.1|2057541_2058123_+	potassium-transporting ATPase subunit KdpC	NA	NA	NA	NA	NA
WP_043746451.1|2058133_2060821_+	sensor histidine kinase KdpD	NA	NA	NA	NA	NA
WP_011384318.1|2060820_2061507_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_011384319.1|2061687_2063019_-	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_011384322.1|2063681_2064713_+	complex I NDUFA9 subunit family protein	NA	NA	NA	NA	NA
WP_011384323.1|2064693_2067582_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_011384324.1|2067663_2068413_-	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_050750680.1|2068434_2068959_-	SEC-C domain-containing protein	NA	NA	NA	NA	NA
WP_043744063.1|2069179_2069629_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011384327.1|2069642_2070218_+	cytochrome b/b6 domain-containing protein	NA	NA	NA	NA	NA
WP_083763495.1|2070257_2070638_+	zf-TFIIB domain-containing protein	NA	NA	NA	NA	NA
WP_148207277.1|2070879_2072026_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_158303958.1|2072129_2072720_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011384328.1|2072843_2073794_+|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	A0A0U4JIT5	Pseudomonas_phage	36.0	1.4e-41
2080995:2081011	attR	TCGCCCAGACCACCTTG	NA	NA	NA	NA
>prophage 11
NC_007626	Magnetospirillum magneticum AMB-1, complete genome	4967148	2079543	2086328	4967148	integrase	Pseudomonas_phage(33.33%)	12	2069703:2069718	2095119:2095134
2069703:2069718	attL	CAGATGATCACCAGCC	NA	NA	NA	NA
WP_011384334.1|2079543_2080269_-	hypothetical protein	NA	R9TRS6	Rhizobium_phage	32.1	5.3e-09
WP_011384335.1|2080426_2080624_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_011384336.1|2080624_2081029_+	RusA family crossover junction endodeoxyribonuclease	NA	J7I4J7	Pseudomonas_phage	46.7	1.1e-24
WP_011384337.1|2081025_2081343_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011384338.1|2081339_2082233_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011384339.1|2082232_2083426_+	DUF2800 domain-containing protein	NA	A0A2I7QSN8	Vibrio_phage	28.5	6.8e-30
WP_011384340.1|2083446_2084103_+	DUF2815 family protein	NA	NA	NA	NA	NA
WP_011384341.1|2084115_2084394_+	DUF2312 domain-containing protein	NA	B0VK10	Azospirillum_phage	42.2	1.8e-05
WP_043744071.1|2084443_2084683_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011384343.1|2084679_2084955_+	hypothetical protein	NA	A0A0F6YRD1	Mycobacterium_phage	48.7	1.2e-11
WP_083763497.1|2084896_2085235_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050750682.1|2085236_2086328_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0U4JIT5	Pseudomonas_phage	43.0	1.3e-67
2095119:2095134	attR	GGCTGGTGATCATCTG	NA	NA	NA	NA
>prophage 12
NC_007626	Magnetospirillum magneticum AMB-1, complete genome	4967148	2240557	2258673	4967148		Shigella_phage(15.38%)	24	NA	NA
WP_011384457.1|2240557_2241946_-	DNA adenine methylase	NA	M4R1L7	Synechococcus_phage	28.4	1.2e-22
WP_011384458.1|2241945_2242347_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011384459.1|2242347_2243085_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011384460.1|2243103_2243328_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148207384.1|2243539_2244100_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011384462.1|2244434_2244986_+	recombinase family protein	NA	A0A219YA40	Aeromonas_phage	38.9	6.8e-25
WP_011384463.1|2245052_2245379_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A088CBP5	Shigella_phage	40.5	2.1e-10
WP_011384464.1|2245375_2245657_+	helix-turn-helix transcriptional regulator	NA	A0A088CD40	Shigella_phage	42.2	2.2e-11
WP_011384466.1|2245934_2247212_-	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	42.6	4.2e-86
WP_148207597.1|2247218_2247584_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	40.7	4.4e-20
WP_011384468.1|2248035_2248806_+	phage Gp37/Gp68 family protein	NA	A0A088F7U1	Mycobacterium_phage	35.4	3.7e-29
WP_043744145.1|2248811_2249294_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148207385.1|2249896_2250916_+	WYL domain-containing protein	NA	NA	NA	NA	NA
WP_148207386.1|2250967_2251165_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148207598.1|2251322_2251931_+	phosphohydrolase	NA	A0A218M3C6	Acidovorax_phage	37.3	3.9e-13
WP_011384472.1|2251933_2252257_+	DUF3572 domain-containing protein	NA	NA	NA	NA	NA
WP_043744148.1|2252242_2253136_-	3'-5' exonuclease	NA	A0A0K2SUJ2	Clostridium_phage	29.8	2.1e-07
WP_083763606.1|2253152_2253947_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011384474.1|2254012_2254474_-	transcriptional repressor NrdR	NA	NA	NA	NA	NA
WP_083763607.1|2254754_2256584_+	diguanylate cyclase	NA	G3MA91	Bacillus_virus	31.0	2.7e-17
WP_043744151.1|2257009_2257375_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011384479.1|2257464_2257743_+	HU family DNA-binding protein	NA	B5TA87	Burkholderia_phage	55.6	1.4e-18
WP_011384480.1|2257732_2258146_+	MucR family transcriptional regulator	NA	A0A1P8VVG0	Erythrobacter_phage	50.8	4.8e-23
WP_043744153.1|2258253_2258673_+	helix-turn-helix transcriptional regulator	NA	Q8W6G2	Sinorhizobium_phage	43.9	1.3e-20
>prophage 13
NC_007626	Magnetospirillum magneticum AMB-1, complete genome	4967148	2583148	2592184	4967148		uncultured_Mediterranean_phage(50.0%)	8	NA	NA
WP_011384773.1|2583148_2585323_+	ATP-binding cassette domain-containing protein	NA	F2Y165	Organic_Lake_phycodnavirus	28.1	3.6e-21
WP_011384774.1|2585324_2586731_+	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_011384775.1|2586805_2587309_-	single-stranded DNA-binding protein	NA	A0A0U2C0X4	Paracoccus_phage	70.2	1.6e-41
WP_011384776.1|2587376_2587787_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011384777.1|2587959_2590647_+	DNA gyrase subunit A	NA	G3M9Z5	Bacillus_virus	33.8	8.9e-102
WP_011384778.1|2590639_2591146_+	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	46.6	1.3e-33
WP_011384779.1|2591157_2591634_+	peptidylprolyl isomerase	NA	A0A1B1IVS0	uncultured_Mediterranean_phage	56.2	4.6e-38
WP_011384780.1|2591638_2592184_+	peptidylprolyl isomerase	NA	A0A1B1IVS0	uncultured_Mediterranean_phage	50.9	4.3e-32
>prophage 14
NC_007626	Magnetospirillum magneticum AMB-1, complete genome	4967148	2700364	2709319	4967148	protease,tRNA	uncultured_Mediterranean_phage(88.89%)	12	NA	NA
WP_043744450.1|2700364_2701417_-	peptidoglycan DD-metalloendopeptidase family protein	NA	Q8SBN9	Clostridium_phage	41.1	5.9e-17
WP_011384900.1|2701452_2702097_-	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	44.6	5.9e-28
WP_011384901.1|2702096_2702879_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	40.2	5.6e-41
WP_011384902.1|2702880_2704149_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	49.4	6.2e-106
WP_050750818.1|2704163_2704961_-	twin-arginine translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	48.8	2.9e-53
WP_043744457.1|2704998_2705370_-	twin-arginine translocase subunit TatB	NA	A0A1B1IVT0	uncultured_Mediterranean_phage	40.3	3.6e-06
WP_043744460.1|2705376_2705616_-	twin-arginine translocase TatA/TatE family subunit	NA	NA	NA	NA	NA
WP_043744464.1|2705706_2706087_-	DUF454 family protein	NA	NA	NA	NA	NA
WP_011384906.1|2706090_2706741_-	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	48.5	8.5e-43
WP_011384907.1|2706792_2707608_-	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	35.6	2.9e-32
WP_043744467.1|2707604_2708288_-|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_043744470.1|2708287_2709319_-	beta-N-acetylhexosaminidase	NA	A0A1B1IVS3	uncultured_Mediterranean_phage	43.7	3.5e-22
>prophage 15
NC_007626	Magnetospirillum magneticum AMB-1, complete genome	4967148	3556003	3608663	4967148	transposase,integrase	Stx2-converting_phage(36.36%)	47	3544324:3544341	3607072:3607089
3544324:3544341	attL	TTGGCCAGGACCGGCACG	NA	NA	NA	NA
WP_011385641.1|3556003_3557707_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_011385642.1|3558130_3558514_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_011385644.1|3559018_3560152_+	HD domain-containing protein	NA	NA	NA	NA	NA
WP_011385645.1|3560451_3560661_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	50.0	7.5e-09
WP_011385646.1|3560742_3561390_-	DNA polymerase III subunit epsilon	NA	NA	NA	NA	NA
WP_011385647.1|3561425_3561671_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148207452.1|3561983_3565067_-	tetrathionate reductase subunit TtrA	NA	NA	NA	NA	NA
WP_011385650.1|3565205_3566300_-	polysulfide reductase NrfD	NA	NA	NA	NA	NA
WP_011385651.1|3566312_3567041_-	4Fe-4S dicluster domain-containing protein	NA	NA	NA	NA	NA
WP_011385652.1|3567135_3567750_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_043744894.1|3567746_3569513_-	PhnD/SsuA/transferrin family substrate-binding protein	NA	NA	NA	NA	NA
WP_011385654.1|3569640_3569865_+	SlyX family protein	NA	NA	NA	NA	NA
WP_011385655.1|3569886_3570108_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148207453.1|3570423_3571860_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043744903.1|3571993_3572359_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043744907.1|3572351_3572717_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_043744911.1|3572717_3573182_-	MucR family transcriptional regulator	NA	A0A1P8VVG0	Erythrobacter_phage	41.2	1.8e-15
WP_148207454.1|3574202_3575006_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148207455.1|3575016_3575346_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148207456.1|3576206_3576545_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011385660.1|3576687_3580512_-	cadherin-like domain-containing protein	NA	M1ID94	Pelagibacter_phage	32.7	1.7e-13
WP_011385661.1|3581102_3582188_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_011385662.1|3582240_3583641_-	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	36.1	5.2e-21
WP_148207457.1|3583646_3585008_-	porin	NA	NA	NA	NA	NA
WP_011385664.1|3585201_3585630_+	organic hydroperoxide resistance protein	NA	NA	NA	NA	NA
WP_011385666.1|3586868_3587927_-	alkene reductase	NA	NA	NA	NA	NA
WP_148207647.1|3587968_3588574_-	isochorismatase family protein	NA	NA	NA	NA	NA
WP_011385668.1|3588608_3589433_-	pirin family protein	NA	NA	NA	NA	NA
WP_050750747.1|3589529_3590420_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_043744926.1|3590929_3591514_-	recombinase family protein	NA	A0A286S1P7	Klebsiella_phage	53.6	5.9e-43
WP_043744929.1|3591730_3592054_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148207458.1|3592166_3592673_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043744934.1|3593003_3593231_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043744937.1|3593269_3593671_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043744940.1|3593776_3594211_-	hemerythrin family protein	NA	NA	NA	NA	NA
WP_148207460.1|3594236_3595424_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_148207461.1|3595420_3597622_-	PAS domain S-box protein	NA	A0A1V0SGX0	Hokovirus	22.1	8.5e-10
WP_043744942.1|3597749_3599804_-	nitrate- and nitrite sensing domain-containing protein	NA	NA	NA	NA	NA
WP_158303983.1|3600847_3601198_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_043744949.1|3601194_3601542_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	62.6	1.3e-34
WP_043744951.1|3601629_3603177_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	47.9	7.5e-130
WP_011385681.1|3603173_3603764_+	plasmid pRiA4b ORF-3 family protein	NA	A0A2H4PDG5	Mycobacterium_phage	31.1	1.1e-15
WP_158303984.1|3604480_3605119_-	biliverdin-producing heme oxygenase	NA	NA	NA	NA	NA
WP_083763546.1|3605115_3605448_-	response regulator	NA	NA	NA	NA	NA
WP_043744955.1|3606230_3607862_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	44.8	5.0e-108
3607072:3607089	attR	TTGGCCAGGACCGGCACG	NA	NA	NA	NA
WP_011385686.1|3607920_3608268_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	57.5	3.3e-33
WP_011385687.1|3608264_3608663_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 16
NC_007626	Magnetospirillum magneticum AMB-1, complete genome	4967148	3996145	4053922	4967148	transposase,integrase,tRNA	Vibrio_phage(18.18%)	51	4022633:4022649	4057954:4057970
WP_011385993.1|3996145_3997648_-|tRNA	proline--tRNA ligase	tRNA	A0A2K9L3R9	Tupanvirus	36.1	5.3e-80
WP_011385995.1|3997841_3998312_+	DoxX family protein	NA	NA	NA	NA	NA
WP_043745158.1|3998877_3999705_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043746978.1|4000303_4001449_-	hypothetical protein	NA	A0A2I7R904	Vibrio_phage	34.1	1.4e-48
WP_011385998.1|4002144_4002537_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043745165.1|4002538_4002907_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011385999.1|4003703_4004138_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158303986.1|4004744_4004939_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_083763557.1|4005095_4005830_+	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_148207485.1|4006306_4007533_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A068CCA6	Rhizobium_phage	30.9	4.1e-38
WP_158303987.1|4007806_4008319_+	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_148207486.1|4008389_4009595_+	hypothetical protein	NA	Q9G095	Leptospira_phage	30.9	2.5e-16
WP_043745173.1|4009903_4010902_+|integrase	site-specific integrase	integrase	A0A0A1I5U0	Burkholderia_phage	42.2	1.2e-64
WP_043745175.1|4011113_4011746_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A166Y2G8	Gordonia_phage	29.4	3.1e-05
WP_011386008.1|4011897_4013280_-	class II fumarate hydratase	NA	NA	NA	NA	NA
WP_011386009.1|4013319_4016031_+	aconitate hydratase AcnA	NA	NA	NA	NA	NA
WP_148207487.1|4016368_4016560_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043746987.1|4016776_4019632_-	PAS domain-containing protein	NA	NA	NA	NA	NA
WP_043745179.1|4019698_4020916_-	PAS domain S-box protein	NA	A0A1V0SGX0	Hokovirus	25.6	3.7e-15
WP_148207488.1|4020984_4021470_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043745183.1|4022049_4022259_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050750758.1|4022285_4022513_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011386017.1|4022515_4022671_+	hypothetical protein	NA	NA	NA	NA	NA
4022633:4022649	attL	CCCCGCGTCACCGGCCC	NA	NA	NA	NA
WP_011386018.1|4022679_4024194_-	B12-binding domain-containing radical SAM protein	NA	NA	NA	NA	NA
WP_148207489.1|4024211_4024430_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011386020.1|4024486_4024915_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011386021.1|4025027_4025549_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011386022.1|4025695_4026340_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_011386023.1|4026336_4027953_-	PAS domain S-box protein	NA	NA	NA	NA	NA
WP_043745190.1|4028184_4028736_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148207277.1|4028939_4030086_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_011386025.1|4030083_4030779_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011386026.1|4030806_4032171_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011386027.1|4032924_4033251_-	DUF3768 domain-containing protein	NA	NA	NA	NA	NA
WP_011386028.1|4033346_4034711_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_011386029.1|4034861_4035317_-	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_043745198.1|4035375_4036323_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_011386031.1|4036317_4037916_-	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	34.8	2.3e-36
WP_011386032.1|4038053_4039556_-	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	37.0	1.8e-48
WP_011386033.1|4039635_4040625_-	flippase-like domain-containing protein	NA	NA	NA	NA	NA
WP_043745201.1|4040795_4042352_+	NACHT domain-containing protein	NA	NA	NA	NA	NA
WP_011386035.1|4042342_4044136_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011386036.1|4044151_4045360_-	AmmeMemoRadiSam system radical SAM enzyme	NA	NA	NA	NA	NA
WP_083763560.1|4045452_4046412_+	DNA adenine methylase	NA	NA	NA	NA	NA
WP_011386038.1|4046415_4047843_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011386039.1|4047846_4049349_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070108669.1|4049450_4050062_+	6-carboxytetrahydropterin synthase	NA	NA	NA	NA	NA
WP_043745207.1|4050058_4050673_+	7-carboxy-7-deazaguanine synthase	NA	NA	NA	NA	NA
WP_083763561.1|4050839_4051547_+	GTP cyclohydrolase I FolE	NA	A0A2I7S8W4	Vibrio_phage	45.4	9.6e-40
WP_158303988.1|4051670_4053356_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_011386044.1|4053352_4053922_-|integrase	site-specific integrase	integrase	A0A1W6DWU1	Sphingobium_phage	27.6	4.0e-12
4057954:4057970	attR	GGGCCGGTGACGCGGGG	NA	NA	NA	NA
>prophage 17
NC_007626	Magnetospirillum magneticum AMB-1, complete genome	4967148	4070470	4146497	4967148	transposase,integrase	Pandoravirus(20.0%)	60	4144438:4144462	4148221:4148245
WP_043745222.1|4070470_4072060_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_011386062.1|4072585_4073956_+	AmmeMemoRadiSam system protein B	NA	NA	NA	NA	NA
WP_011386063.1|4074086_4076285_+	xanthine dehydrogenase family protein molybdopterin-binding subunit	NA	NA	NA	NA	NA
WP_011386064.1|4076281_4077058_+	3'(2'),5'-bisphosphate nucleotidase CysQ	NA	NA	NA	NA	NA
WP_011386066.1|4077439_4078036_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_011386067.1|4078097_4079321_+	DUF2325 domain-containing protein	NA	NA	NA	NA	NA
WP_043745227.1|4079365_4080337_+	threonylcarbamoyl-AMP synthase	NA	A0A291ATS8	Pandoravirus	42.6	2.8e-50
WP_043745229.1|4080540_4081950_+	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_011386070.1|4082033_4083140_+	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_011386071.1|4083141_4085925_+	LPS-assembly protein LptD	NA	NA	NA	NA	NA
WP_011386072.1|4085941_4087207_+	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_011386073.1|4087229_4088234_+	4-hydroxythreonine-4-phosphate dehydrogenase PdxA	NA	NA	NA	NA	NA
WP_011386074.1|4088226_4089072_+	16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))- dimethyltransferase RsmA	NA	NA	NA	NA	NA
WP_043745234.1|4089463_4090876_+	methyl-accepting chemotaxis protein	NA	NA	NA	NA	NA
WP_011386077.1|4090981_4091689_+	cytidylate kinase-like family protein	NA	NA	NA	NA	NA
WP_011386078.1|4091776_4092316_-	cytochrome b	NA	NA	NA	NA	NA
WP_148207668.1|4092654_4093569_+	SPOR domain-containing protein	NA	NA	NA	NA	NA
WP_148207490.1|4093668_4096719_+	PAS domain-containing protein	NA	NA	NA	NA	NA
WP_011386081.1|4096986_4098783_-	class I poly(R)-hydroxyalkanoic acid synthase	NA	NA	NA	NA	NA
WP_011386082.1|4099002_4100151_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011386083.1|4100281_4101514_+	LL-diaminopimelate aminotransferase	NA	NA	NA	NA	NA
WP_011386084.1|4101510_4102797_+	homoserine dehydrogenase	NA	NA	NA	NA	NA
WP_011386085.1|4102807_4103800_+	class II fructose-bisphosphatase	NA	NA	NA	NA	NA
WP_011386086.1|4103796_4105590_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	31.2	1.5e-60
WP_011386087.1|4106080_4106428_-	alkylphosphonate utilization protein	NA	NA	NA	NA	NA
WP_043745240.1|4107277_4108384_+	serine hydrolase	NA	A0A2K9VHZ2	Mycobacterium_phage	26.0	7.5e-15
WP_011386090.1|4108422_4109520_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_083763621.1|4109947_4112620_+	hybrid sensor histidine kinase/response regulator	NA	A0A1V0SGX0	Hokovirus	32.0	2.3e-62
WP_148207669.1|4112710_4113406_+	cyclic nucleotide-binding domain-containing protein	NA	NA	NA	NA	NA
WP_043747022.1|4113626_4113788_+	Flp family type IVb pilin	NA	NA	NA	NA	NA
WP_043747024.1|4114113_4114275_+	Flp family type IVb pilin	NA	NA	NA	NA	NA
WP_011386095.1|4114533_4115016_+	prepilin peptidase	NA	NA	NA	NA	NA
WP_011386096.1|4115034_4115937_+	Flp pilus assembly protein CpaB	NA	NA	NA	NA	NA
WP_011386097.1|4115933_4117421_+	type II and III secretion system protein family protein	NA	NA	NA	NA	NA
WP_148207670.1|4117426_4118128_+	CpaD family pilus assembly lipoprotein	NA	NA	NA	NA	NA
WP_011386099.1|4118137_4119319_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_011386100.1|4119322_4120711_+	CpaF family protein	NA	NA	NA	NA	NA
WP_011386101.1|4120703_4121696_+	type II secretion system F family protein	NA	NA	NA	NA	NA
WP_043745245.1|4121846_4122806_+	type II secretion system F family protein	NA	NA	NA	NA	NA
WP_011386103.1|4122938_4123286_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148207491.1|4123448_4124219_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_011386105.1|4124334_4124787_+	pilus assembly protein N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_148207671.1|4124928_4125399_+	pilus assembly protein	NA	NA	NA	NA	NA
WP_011386107.1|4125395_4125935_+	pilus assembly protein	NA	NA	NA	NA	NA
WP_011386108.1|4125937_4127332_+	Flp pilus assembly protein TadG	NA	NA	NA	NA	NA
WP_011386109.1|4127450_4127966_-	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_043745253.1|4127949_4128276_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148207277.1|4128293_4129440_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_083763565.1|4129539_4130439_-	TniB family NTP-binding protein	NA	NA	NA	NA	NA
WP_011386112.1|4130432_4132379_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_011386113.1|4132375_4133059_-|transposase	heteromeric transposase endonuclease subunit TnsA	transposase	NA	NA	NA	NA
WP_083763566.1|4133048_4134395_-	TniQ family protein	NA	NA	NA	NA	NA
WP_011386115.1|4134972_4135695_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011386116.1|4135740_4135953_-	SEC-C domain-containing protein	NA	NA	NA	NA	NA
WP_011386117.1|4135960_4137922_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_011386118.1|4137918_4138602_-|transposase	heteromeric transposase endonuclease subunit TnsA	transposase	NA	NA	NA	NA
WP_011386119.1|4138591_4139938_-	TniQ family protein	NA	NA	NA	NA	NA
WP_043745259.1|4140240_4143888_+	SIR2 family protein	NA	NA	NA	NA	NA
4144438:4144462	attL	CGACGAACATACAGCATGTATGTTC	NA	NA	NA	NA
WP_043745264.1|4144543_4145887_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043745265.1|4145930_4146497_-|integrase	site-specific integrase	integrase	K4JX14	Caulobacter_virus	34.8	1.1e-17
4148221:4148245	attR	GAACATACATGCTGTATGTTCGTCG	NA	NA	NA	NA
