The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_006582	Bacillus clausii KSM-K16, complete genome	4303871	1117517	1127255	4303871		Cyanophage(25.0%)	9	NA	NA
WP_011245881.1|1117517_1118816_+	adenylosuccinate lyase	NA	A0A1B3B081	Gordonia_phage	32.4	2.5e-17
WP_011245882.1|1118840_1119560_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A1D7SPE1	Cyanophage	43.7	1.3e-47
WP_011245883.1|1119552_1119804_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	A0A1D7SRI3	Cyanophage	34.6	2.1e-05
WP_011245884.1|1119800_1120484_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_011245885.1|1120467_1122693_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	43.1	6.3e-162
WP_011245886.1|1122668_1124081_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	34.2	2.4e-50
WP_011245887.1|1124104_1125142_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3F760	Synechococcus_phage	43.6	3.6e-67
WP_011245888.1|1125138_1125723_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	36.4	5.5e-25
WP_011245889.1|1125719_1127255_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	50.7	4.5e-74
>prophage 2
NC_006582	Bacillus clausii KSM-K16, complete genome	4303871	1403011	1492093	4303871	protease,holin,capsid,terminase,transposase,portal,integrase,head,tail	Bacillus_phage(52.5%)	98	1450838:1450897	1492300:1492391
WP_011245494.1|1403011_1403464_+|transposase	IS200/IS605 family transposase	transposase	A0A0H3UZM0	Geobacillus_virus	32.3	1.1e-15
WP_011246134.1|1403975_1405442_+	catalase	NA	A0A2K9L572	Tupanvirus	51.0	1.1e-111
WP_011246135.1|1405727_1407488_+	M3 family oligoendopeptidase	NA	NA	NA	NA	NA
WP_011246136.1|1407622_1408423_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011246137.1|1408487_1409528_-	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_011246138.1|1409544_1410882_-	cytochrome ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_011246139.1|1411161_1411332_-	FbpB family small basic protein	NA	NA	NA	NA	NA
WP_011246140.1|1411589_1411739_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011246141.1|1411844_1412195_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011246142.1|1412371_1413175_+	YfkD famly protein	NA	NA	NA	NA	NA
WP_011246143.1|1413241_1414351_-	radical SAM/CxCxxxxC motif protein YfkAB	NA	NA	NA	NA	NA
WP_011246144.1|1414519_1415167_+	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_011246145.1|1415304_1416672_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_011246146.1|1417079_1417901_-	DUF368 domain-containing protein	NA	NA	NA	NA	NA
WP_011246147.1|1418040_1418820_+	delta-lactam-biosynthetic de-N-acetylase	NA	NA	NA	NA	NA
WP_011246148.1|1419019_1419916_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_011246149.1|1419983_1420403_-	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_011246150.1|1421227_1421590_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011246151.1|1421754_1423170_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	36.8	1.0e-85
WP_011246152.1|1423241_1424279_+	LD-carboxypeptidase	NA	NA	NA	NA	NA
WP_011246153.1|1424399_1424696_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011246154.1|1424728_1425631_-	TIGR01777 family protein	NA	NA	NA	NA	NA
WP_011246155.1|1425732_1426554_+	recombination regulator RecX	NA	NA	NA	NA	NA
WP_011246156.1|1426553_1426874_+	YfhH family protein	NA	NA	NA	NA	NA
WP_011246157.1|1426913_1427072_-	YpzG family protein	NA	NA	NA	NA	NA
WP_011246158.1|1427090_1427246_-	small, acid-soluble spore protein K	NA	NA	NA	NA	NA
WP_011246159.1|1427358_1428339_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_081427578.1|1428461_1429595_+	A/G-specific adenine glycosylase	NA	G3CB03	Aeropyrum_pernix_spindle-shaped_virus	33.0	7.2e-29
WP_011246161.1|1429591_1430341_+	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.5	9.3e-17
WP_011246162.1|1430374_1430725_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011246163.1|1430740_1430941_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011246164.1|1431046_1431796_+	enoyl-[acyl-carrier-protein] reductase FabL	NA	NA	NA	NA	NA
WP_011246165.1|1431863_1432016_+	gamma-type small acid-soluble spore protein	NA	NA	NA	NA	NA
WP_011246166.1|1432229_1432757_+	DUF402 domain-containing protein	NA	NA	NA	NA	NA
WP_011246167.1|1432803_1434552_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	28.2	1.5e-49
WP_011246168.1|1434706_1435771_-	aromatic acid exporter family protein	NA	NA	NA	NA	NA
WP_011246169.1|1435861_1437166_-	glutamate-1-semialdehyde 2,1-aminomutase	NA	NA	NA	NA	NA
WP_011246170.1|1437333_1437804_+	thioredoxin-dependent thiol peroxidase	NA	NA	NA	NA	NA
WP_011246171.1|1437796_1438759_+	D-2-hydroxyacid dehydrogenase	NA	NA	NA	NA	NA
WP_011246172.1|1438776_1439073_+	cyclic-di-AMP receptor	NA	NA	NA	NA	NA
WP_011246173.1|1439281_1439713_+	peroxide-responsive transcriptional repressor PerR	NA	NA	NA	NA	NA
WP_011246174.1|1439783_1440149_-	YgzB family protein	NA	NA	NA	NA	NA
WP_011246175.1|1448267_1450652_+	phage-related pre-neck appendage protein	NA	B7SSN3	Bacillus_phage	45.9	3.2e-143
1450838:1450897	attL	CACGACTCAAAATCGTGTTCCTTCGGGAGTGTCGGTTCGACCCCGACCACCGGTATTAGG	NA	NA	NA	NA
WP_011246176.1|1451052_1452018_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A142F1N9	Bacillus_phage	45.0	5.3e-65
WP_041823703.1|1452421_1452652_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011246177.1|1452764_1453406_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041823706.1|1453464_1453728_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041823709.1|1453708_1454110_+	HNH endonuclease	NA	A0A2H4J3B4	uncultured_Caudovirales_phage	47.7	7.4e-29
WP_011246179.1|1454535_1455012_+|terminase	phage terminase small subunit P27 family	terminase	A6M947	Geobacillus_virus	39.7	5.5e-23
WP_011246180.1|1455008_1456703_+|terminase	terminase large subunit	terminase	A6M948	Geobacillus_virus	53.9	7.1e-174
WP_011246181.1|1456712_1456913_+	hypothetical protein	NA	Q9ZXF9	Bacillus_phage	68.5	2.6e-11
WP_011246182.1|1456918_1458205_+|portal	phage portal protein	portal	D6R3Y6	Bacillus_phage	61.5	3.1e-145
WP_011246183.1|1458161_1458794_+|head,protease	HK97 family phage prohead protease	head,protease	Q9ZXF7	Bacillus_phage	70.7	9.1e-74
WP_011246184.1|1458834_1460082_+|capsid	phage major capsid protein	capsid	A0A0A7RTL2	Clostridium_phage	46.3	6.8e-89
WP_011246185.1|1460163_1460646_+	Ig domain-containing protein	NA	A0A1D6Z291	Staphylococcus_phage	40.7	1.9e-10
WP_011246186.1|1460638_1460935_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4J6E5	uncultured_Caudovirales_phage	43.0	1.1e-08
WP_011246187.1|1460927_1461266_+|head,tail	head-tail adaptor protein	head,tail	NA	NA	NA	NA
WP_011246188.1|1461270_1461675_+	HK97 gp10 family phage protein	NA	NA	NA	NA	NA
WP_050748957.1|1461671_1462031_+	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_011246190.1|1462043_1462652_+	hypothetical protein	NA	A0A0S2SXT6	Bacillus_phage	33.2	3.5e-22
WP_011246191.1|1462783_1463131_+	hypothetical protein	NA	A0A288WGA9	Bacillus_phage	37.8	2.9e-05
WP_041823712.1|1463145_1463376_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011246192.1|1463393_1468058_+|tail	phage tail tape measure protein	tail	A0A0C5AJ16	Paenibacillus_phage	48.3	2.7e-98
WP_050748958.1|1468059_1468899_+|tail	phage tail family protein	tail	A6M962	Geobacillus_virus	35.1	5.5e-34
WP_011246194.1|1468922_1471577_+	peptidase G2	NA	D6R401	Bacillus_phage	37.9	1.3e-142
WP_011246196.1|1473659_1474040_+	hypothetical protein	NA	NA	NA	NA	NA
WP_152024041.1|1474026_1474194_+	XkdX family protein	NA	A0A142F1G4	Bacillus_phage	66.7	1.3e-11
WP_011246198.1|1474250_1474496_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011246199.1|1474574_1475030_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041823714.1|1475081_1476470_+|tail	phage tail protein	tail	A6M966	Geobacillus_virus	30.0	3.3e-28
WP_011246201.1|1476506_1476920_+|holin	phage holin family protein	holin	D6R405	Bacillus_phage	53.8	1.3e-31
WP_011246202.1|1476922_1477828_+	N-acetylmuramoyl-L-alanine amidase	NA	Q9ZXD7	Bacillus_phage	56.1	3.3e-45
WP_011246203.1|1477941_1478301_+	DUF2513 domain-containing protein	NA	NA	NA	NA	NA
WP_011246204.1|1478537_1479053_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011246206.1|1479424_1479811_-	YolD-like family protein	NA	NA	NA	NA	NA
WP_011246207.1|1479898_1480093_-	hypothetical protein	NA	A0A2H4J069	uncultured_Caudovirales_phage	60.8	7.0e-09
WP_011246208.1|1480490_1481267_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041823719.1|1481416_1481869_-	ImmA/IrrE family metallo-endopeptidase	NA	R9TQI1	Paenibacillus_phage	54.2	3.4e-38
WP_041823722.1|1481868_1482204_-	helix-turn-helix transcriptional regulator	NA	Q8W5Y0	Listeria_phage	41.9	1.0e-15
WP_011246211.1|1482468_1482654_+	helix-turn-helix domain-containing protein	NA	A0A0M3ULF9	Bacillus_phage	67.2	3.6e-15
WP_011246213.1|1482815_1483130_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011246214.1|1483130_1483322_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011246215.1|1483326_1483479_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011246216.1|1483557_1484106_+	host-nuclease inhibitor Gam family protein	NA	Q9ZXC8	Bacillus_phage	54.9	1.8e-46
WP_011246217.1|1484115_1485069_+	AAA family ATPase	NA	A0A0S2SY47	Bacillus_phage	58.5	1.2e-98
WP_011246218.1|1485084_1485522_+	DUF669 domain-containing protein	NA	Q9ZXC5	Bacillus_phage	52.4	2.3e-39
WP_011246219.1|1485579_1487955_+	primase	NA	Q9ZXC4	Bacillus_phage	61.9	3.3e-294
WP_011246220.1|1488181_1488616_+	hypothetical protein	NA	A0A2H4J832	uncultured_Caudovirales_phage	38.5	1.5e-19
WP_011246221.1|1488619_1489150_+	ERCC4 domain-containing protein	NA	A0A0S2SXQ1	Bacillus_phage	67.4	3.5e-63
WP_011246222.1|1489146_1489416_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011246223.1|1489417_1489648_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011246224.1|1489640_1489979_+	DUF3310 domain-containing protein	NA	I1TLI0	Bacillus_phage	51.6	4.5e-11
WP_041823725.1|1490092_1490488_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011246226.1|1490526_1490715_+	hypothetical protein	NA	A0A0A0RVG0	Bacillus_phage	63.2	7.7e-13
WP_011246227.1|1490750_1490987_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011246228.1|1491039_1491432_+	hypothetical protein	NA	A0A0K2CNN3	Brevibacillus_phage	48.1	6.5e-22
WP_011246229.1|1491434_1491635_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011246230.1|1491652_1492093_+	transcriptional regulator	NA	A0A0S2SXN1	Bacillus_phage	46.2	1.8e-28
1492300:1492391	attR	CACGACTCAAAATCGTGTTCCTTCGGGAGTGTCGGTTCGACCCCGACCACCGGTATTAGGTGCCAAACCTAAGTAATAGCAAATGTCTATTA	NA	NA	NA	NA
>prophage 3
NC_006582	Bacillus clausii KSM-K16, complete genome	4303871	2912943	2973274	4303871	holin,terminase,transposase,tRNA,capsid,tail	Bacillus_phage(48.15%)	65	NA	NA
WP_011247620.1|2912943_2913585_-|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_011247621.1|2913680_2913929_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011247622.1|2913987_2914782_-	phosphotransferase family protein	NA	NA	NA	NA	NA
WP_011247623.1|2915244_2916108_+	formyltetrahydrofolate deformylase	NA	M4QRX9	Synechococcus_phage	35.3	9.1e-16
WP_011247624.1|2916148_2916877_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.0	1.5e-16
WP_011247625.1|2916933_2917248_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011247626.1|2917631_2918864_-	2-oxo acid dehydrogenase subunit E2	NA	NA	NA	NA	NA
WP_011247627.1|2918893_2919937_-	alpha-ketoacid dehydrogenase subunit beta	NA	NA	NA	NA	NA
WP_011247628.1|2919954_2920902_-	thiamine pyrophosphate-dependent dehydrogenase E1 component subunit alpha	NA	NA	NA	NA	NA
WP_041823927.1|2920929_2922282_-	dihydrolipoyl dehydrogenase	NA	NA	NA	NA	NA
WP_011247630.1|2922549_2924493_-	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_011247631.1|2924715_2925420_-	LrgB family protein	NA	NA	NA	NA	NA
WP_011247632.1|2925385_2925790_-|holin	CidA/LrgA family holin-like protein	holin	NA	NA	NA	NA
WP_011247633.1|2925786_2926347_-	RNA 2',3'-cyclic phosphodiesterase	NA	NA	NA	NA	NA
WP_011247634.1|2926430_2927363_+	cysteine synthase A	NA	A0A1W6JIM2	Lactococcus_phage	55.3	2.8e-79
WP_011247635.1|2927530_2928409_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_035201960.1|2928562_2928919_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_035201965.1|2928932_2929754_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_011247638.1|2930046_2930487_-	metallothiol transferase FosB	NA	Q2LI91	Bacillus_phage	46.5	1.7e-23
WP_011247639.1|2930779_2930998_+	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_011247640.1|2931029_2931761_-	rRNA pseudouridine synthase	NA	NA	NA	NA	NA
WP_011247641.1|2931806_2932967_-	rod shape-determining protein RodA	NA	NA	NA	NA	NA
WP_011247642.1|2932980_2934123_-	putative lipid II flippase FtsW	NA	NA	NA	NA	NA
WP_011247643.1|2934459_2936061_-	polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_011247644.1|2936256_2937114_-	SMP-30/gluconolactonase/LRE family protein	NA	NA	NA	NA	NA
WP_011247645.1|2937110_2937518_-	YjbQ family protein	NA	NA	NA	NA	NA
WP_035201976.1|2937773_2938955_-	amidohydrolase	NA	NA	NA	NA	NA
WP_011247647.1|2939090_2939675_+	aminoacetone oxidase family FAD-binding enzyme	NA	NA	NA	NA	NA
WP_160162517.1|2939662_2939827_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011247648.1|2940122_2941262_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099045556.1|2942009_2942180_+	hypothetical protein	NA	A0A2H4J069	uncultured_Caudovirales_phage	68.8	1.2e-09
WP_152024047.1|2942281_2942662_+	YolD-like family protein	NA	NA	NA	NA	NA
WP_011247651.1|2942718_2943552_+	ATP-dependent DNA ligase	NA	O64130	Bacillus_phage	46.5	1.6e-62
WP_011247652.1|2943959_2944262_+	hypothetical protein	NA	NA	NA	NA	NA
WP_152024048.1|2944254_2944728_+	type I-C CRISPR-associated protein Cas8c/Csd1	NA	NA	NA	NA	NA
WP_011247654.1|2944873_2945146_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011247655.1|2945479_2946676_-|transposase	IS110 family transposase	transposase	A0A0U3ULR1	Bacillus_phage	24.7	2.1e-23
WP_011247656.1|2946956_2947301_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011247657.1|2947329_2948346_-	N-acetylmuramoyl-L-alanine amidase	NA	D6QWM8	uncultured_phage	55.2	6.2e-48
WP_011247658.1|2948345_2948573_-|holin	holin protein of PBSX prophage	holin	NA	NA	NA	NA
WP_011247659.1|2948562_2948853_-	hypothetical protein	NA	D2XR31	Bacillus_phage	65.9	6.1e-25
WP_011247660.1|2948889_2950275_-|tail	phage tail protein	tail	A6M966	Geobacillus_virus	29.8	4.3e-36
WP_011247661.1|2950261_2950441_-	XkdX family protein	NA	A0A142F1G4	Bacillus_phage	64.0	2.1e-12
WP_011247662.1|2950437_2950806_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081427718.1|2950816_2952727_-	hypothetical protein	NA	W8CZP9	Erwinia_phage	28.2	5.3e-16
WP_011247664.1|2952752_2955404_-	peptidase G2	NA	D6R401	Bacillus_phage	37.8	5.2e-147
WP_011247665.1|2955414_2956236_-|tail	phage tail family protein	tail	A6M962	Geobacillus_virus	43.5	2.2e-56
WP_050748987.1|2956232_2962001_-	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A2H4JA91	uncultured_Caudovirales_phage	29.9	1.1e-93
WP_011247667.1|2962052_2962874_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041823937.1|2962927_2963137_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011247669.1|2963274_2963757_-	hypothetical protein	NA	A0A218KCI2	Bacillus_phage	37.6	1.3e-16
WP_011247670.1|2963802_2964201_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011247671.1|2964266_2964854_-	hypothetical protein	NA	A0A2H4J7F5	uncultured_Caudovirales_phage	43.3	7.2e-33
WP_011247672.1|2964840_2965266_-	hypothetical protein	NA	M4ZR34	Bacillus_phage	32.1	7.1e-14
WP_011247673.1|2965262_2965745_-	hypothetical protein	NA	M4ZRN5	Bacillus_phage	48.4	4.5e-33
WP_152024049.1|2965737_2966076_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011247675.1|2966075_2966408_-	hypothetical protein	NA	A0A1U9WQS7	Geobacillus_phage	47.7	6.8e-20
WP_041823940.1|2966409_2966625_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011247676.1|2966635_2967652_-|capsid	major capsid protein	capsid	A0A142F1M0	Bacillus_phage	42.4	8.9e-71
WP_011247677.1|2967693_2968083_-	hypothetical protein	NA	A0A142F1L9	Bacillus_phage	54.6	5.3e-32
WP_041823943.1|2968086_2968758_-	hypothetical protein	NA	M4ZSA3	Bacillus_phage	30.0	2.8e-12
WP_011247679.1|2968851_2969952_-	hypothetical protein	NA	M4ZR27	Bacillus_phage	43.7	4.4e-84
WP_011247680.1|2969948_2971556_-	hypothetical protein	NA	A0A1U9WQP5	Geobacillus_phage	56.8	2.8e-159
WP_041824688.1|2971566_2972856_-|terminase	PBSX family phage terminase large subunit	terminase	A0A1B1UZZ1	Enterococcus_phage	73.4	8.9e-185
WP_011247682.1|2972836_2973274_-|terminase	terminase small subunit	terminase	S5MA50	Brevibacillus_phage	60.7	1.6e-40
>prophage 4
NC_006582	Bacillus clausii KSM-K16, complete genome	4303871	2977112	2987986	4303871		Bacillus_phage(25.0%)	25	NA	NA
WP_011247687.1|2977112_2977553_-	hypothetical protein	NA	A0A0U3TGS2	Bacillus_phage	56.4	5.6e-38
WP_160162518.1|2977539_2977710_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011247688.1|2977721_2978216_-	RusA family crossover junction endodeoxyribonuclease	NA	S6B1L9	Thermus_phage	50.4	4.4e-31
WP_160162519.1|2978199_2978337_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011247689.1|2978505_2979015_-	dUTP diphosphatase	NA	D2XR49	Bacillus_phage	48.8	1.0e-35
WP_050748989.1|2979029_2979269_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041823955.1|2979278_2979536_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011247690.1|2979545_2979968_-	single-stranded DNA-binding protein	NA	A0A1X9IGF2	Lactococcus_phage	44.7	1.4e-22
WP_041823958.1|2979968_2980148_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011247691.1|2980141_2981002_-	DNA (cytosine-5-)-methyltransferase	NA	A8YQM6	Lactobacillus_phage	52.0	6.1e-73
WP_011247692.1|2981141_2981603_-	HNH endonuclease	NA	A6M989	Geobacillus_virus	56.8	4.2e-36
WP_011247693.1|2981605_2982268_-	sigma-70 family RNA polymerase sigma factor	NA	G3MBD9	Bacillus_virus	27.5	1.3e-06
WP_011247694.1|2982264_2982537_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041823961.1|2982512_2982797_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011247695.1|2982800_2983637_-	ATP-binding protein	NA	A0A1B1P8D0	Bacillus_phage	48.6	1.3e-64
WP_011247696.1|2983569_2984349_-	conserved phage C-terminal domain-containing protein	NA	A6M985	Geobacillus_virus	68.9	1.3e-50
WP_011247697.1|2984515_2985238_-	phage antirepressor KilAC domain-containing protein	NA	G4KNN1	Staphylococcus_phage	55.2	2.3e-73
WP_011247698.1|2985393_2985633_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_011247699.1|2985808_2986036_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_011247700.1|2986215_2986551_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160162520.1|2986831_2987002_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011247701.1|2987033_2987375_-	hypothetical protein	NA	A8ASP1	Listeria_phage	39.7	6.3e-05
WP_160162521.1|2987371_2987638_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160162522.1|2987628_2987793_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041823964.1|2987797_2987986_-	hypothetical protein	NA	A0A2D1GQ75	Lysinibacillus_phage	43.1	4.1e-06
>prophage 5
NC_006582	Bacillus clausii KSM-K16, complete genome	4303871	3234367	3243113	4303871		Bacillus_phage(66.67%)	8	NA	NA
WP_035202795.1|3234367_3236470_+	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	U5PY35	Bacillus_phage	79.6	0.0e+00
WP_011247951.1|3236506_3237511_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	R4JMU8	Bacillus_phage	80.1	7.3e-150
WP_011247952.1|3237698_3238325_+	hypothetical protein	NA	A0A127AYS1	Bacillus_phage	42.0	1.1e-44
WP_011247953.1|3238371_3238917_-	cysteine hydrolase	NA	G3MA16	Bacillus_virus	41.1	5.3e-30
WP_011247954.1|3239037_3239244_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011247955.1|3239323_3240616_+	glycoside hydrolase family 18 protein	NA	NA	NA	NA	NA
WP_011247956.1|3240742_3241498_+	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	28.8	7.4e-14
WP_011247957.1|3241622_3243113_-	sucrose-6-phosphate hydrolase	NA	F8WPR5	Bacillus_phage	28.5	9.8e-34
