The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_006510	Geobacillus kaustophilus HTA426, complete genome	3544776	255640	331371	3544776	protease,tRNA,transposase	Moraxella_phage(10.53%)	60	NA	NA
WP_011229745.1|255640_256099_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
WP_011229746.1|256095_256836_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_011229747.1|256795_257248_+	ribosomal protein S18-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_011229748.1|257244_258258_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	43.6	1.7e-66
WP_011229749.1|258580_260506_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	34.1	3.4e-63
WP_011229750.1|260603_261092_+	cyclic pyranopterin monophosphate synthase MoaC	NA	NA	NA	NA	NA
WP_011229751.1|261107_261749_+	redox-sensing transcriptional repressor Rex	NA	NA	NA	NA	NA
WP_011229752.1|261765_261918_+	twin-arginine translocase TatA/TatE family subunit	NA	NA	NA	NA	NA
WP_011229753.1|261938_262682_+	twin-arginine translocase subunit TatC	NA	NA	NA	NA	NA
WP_013522803.1|262865_263045_-	YdiK family protein	NA	NA	NA	NA	NA
WP_011229755.1|263041_263776_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_013144057.1|264132_264417_+	co-chaperone GroES	NA	A0A221S3C8	uncultured_virus	50.5	1.1e-18
WP_011229758.1|264521_266138_+	chaperonin GroEL	NA	A0A219YK78	uncultured_virus	59.0	1.3e-164
WP_011229759.1|266578_267949_+	class II fumarate hydratase	NA	NA	NA	NA	NA
WP_011229760.1|268138_269095_+	MoxR family ATPase	NA	NA	NA	NA	NA
WP_041467764.1|269091_270273_+	DUF58 domain-containing protein	NA	NA	NA	NA	NA
WP_011229762.1|270269_272432_+	transglutaminase domain-containing protein	NA	NA	NA	NA	NA
WP_011229763.1|272635_274168_+	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	29.5	3.8e-17
WP_011229764.1|274458_275784_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	32.2	1.4e-52
WP_011229765.1|281981_282431_-	Hsp20/alpha crystallin family protein	NA	NA	NA	NA	NA
WP_011229766.1|282791_283280_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	42.9	3.1e-21
WP_011229767.1|283272_284421_+	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_011229768.1|284417_285713_+	adenylosuccinate lyase	NA	A0A1B3B081	Gordonia_phage	33.6	3.8e-18
WP_014194762.1|285773_286517_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3HI61	Synechococcus_phage	42.5	9.4e-46
WP_011229770.1|286504_286759_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_011229771.1|286755_287442_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_011229772.1|287425_289654_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	42.4	3.1e-169
WP_011229773.1|289629_291042_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	34.7	8.3e-51
WP_011229774.1|291165_292206_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3FC27	Synechococcus_phage	43.6	4.7e-67
WP_011229775.1|292202_292835_+	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	37.4	4.1e-26
WP_011229776.1|292797_294336_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	53.0	7.9e-79
WP_011229777.1|294359_295652_+	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_011229778.1|295800_295965_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011229779.1|295961_296207_-	DUF2892 domain-containing protein	NA	NA	NA	NA	NA
WP_011229780.1|296303_298049_+	adenine deaminase	NA	NA	NA	NA	NA
WP_031212138.1|298076_299099_+	DUF3048 domain-containing protein	NA	NA	NA	NA	NA
WP_011229782.1|299191_299527_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011229783.1|299624_300344_+	heptaprenylglyceryl phosphate synthase	NA	NA	NA	NA	NA
WP_011229784.1|300372_302547_+	DNA helicase PcrA	NA	A7KV33	Bacillus_phage	42.1	2.2e-135
WP_011229785.1|302567_304580_+	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	40.2	1.2e-127
WP_011229786.1|304576_305800_+	CamS family sex pheromone protein	NA	NA	NA	NA	NA
WP_011229787.1|305975_306533_+	TIGR00730 family Rossman fold protein	NA	A0A1V0S9E9	Catovirus	29.4	8.7e-12
WP_011229788.1|306966_307743_-	VOC family protein	NA	NA	NA	NA	NA
WP_011229789.1|307772_308279_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011229790.1|308437_308728_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC	tRNA	NA	NA	NA	NA
WP_011229791.1|308740_310198_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA	tRNA	NA	NA	NA	NA
WP_011229792.1|310211_311642_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB	tRNA	NA	NA	NA	NA
WP_011229793.1|311817_313122_+	homocysteine synthase	NA	A0A0B5JD48	Pandoravirus	26.4	4.1e-20
WP_011229794.1|313640_314720_+|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_011229795.1|314933_315104_+	gallidermin/nisin family lantibiotic	NA	NA	NA	NA	NA
WP_011229796.1|315292_315682_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011229797.1|315799_316681_+	NADH dehydrogenase	NA	NA	NA	NA	NA
WP_041467772.1|316664_317405_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011229799.1|317401_318103_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011229800.1|318116_318770_+	heme ABC exporter ATP-binding protein CcmA	NA	G3M9Y6	Bacillus_virus	32.2	6.2e-25
WP_011229802.1|319183_320545_-|transposase	IS4-like element ISGka3 family transposase	transposase	NA	NA	NA	NA
WP_011229804.1|321328_322777_-|transposase	IS66-like element ISGst1 family transposase	transposase	NA	NA	NA	NA
WP_089113994.1|323960_324278_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_094239504.1|324326_324431_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011229811.1|330183_331371_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NC_006510	Geobacillus kaustophilus HTA426, complete genome	3544776	337277	388617	3544776	transposase,holin	Staphylococcus_phage(14.29%)	37	NA	NA
WP_011229816.1|337277_338468_-|transposase	ISL3 family transposase	transposase	A0A0A8WEF4	Clostridium_phage	25.2	2.2e-28
WP_004888811.1|339062_339851_-	lantibiotic immunity ABC transporter MutG family permease subunit	NA	NA	NA	NA	NA
WP_008881432.1|339852_340599_-	lantibiotic immunity ABC transporter MutE/EpiE family permease subunit	NA	NA	NA	NA	NA
WP_008881431.1|340617_341307_-	lantibiotic protection ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	48.0	5.1e-54
WP_011229818.1|341909_342539_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_011229819.1|342793_343921_-|holin	betaine/proline/choline family ABC transporter ATP-binding protein	holin	G3M9Y6	Bacillus_virus	35.5	2.5e-29
WP_014194799.1|343937_344840_-	proline/glycine betaine ABC-type transport system, permease component fused to periplasmic component	NA	NA	NA	NA	NA
WP_041467781.1|345314_346088_-	coiled-coil protein	NA	NA	NA	NA	NA
WP_011229822.1|346232_347723_+	TIGR02677 family protein	NA	NA	NA	NA	NA
WP_011229823.1|347725_348922_+	TIGR02678 family protein	NA	NA	NA	NA	NA
WP_011229824.1|348881_353003_+	TIGR02680 family protein	NA	NA	NA	NA	NA
WP_011229825.1|352999_354220_+	TIGR02679 family protein	NA	NA	NA	NA	NA
WP_011229826.1|354287_354665_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011229827.1|355569_355794_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011229828.1|355930_356986_+	P1 family peptidase	NA	NA	NA	NA	NA
WP_011229829.1|357072_358305_-	MFS transporter	NA	NA	NA	NA	NA
WP_011229830.1|358504_359158_-	PspA/IM30 family protein	NA	NA	NA	NA	NA
WP_011229831.1|359117_359642_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011229832.1|359841_360165_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011229833.1|360549_362859_-	YhgE/Pip domain-containing protein	NA	NA	NA	NA	NA
WP_011229836.1|364861_365533_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	35.7	1.1e-32
WP_011229837.1|365706_366912_+	trypsin-like peptidase domain-containing protein	NA	W5SAB9	Pithovirus	29.4	4.1e-14
WP_041467784.1|366983_367325_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_049752144.1|367719_368418_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011229840.1|368628_369765_+|transposase	IS110-like element ISGka2 family transposase	transposase	Q9JMN8	Wolbachia_phage	27.1	1.2e-31
WP_011229842.1|370658_371048_+	DUF962 domain-containing protein	NA	NA	NA	NA	NA
WP_011229843.1|371184_372051_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	NA	NA	NA	NA
WP_011229844.1|372263_372803_+	NfeD family protein	NA	NA	NA	NA	NA
WP_011229845.1|372825_374343_+	flotillin family protein	NA	A0A2I2L4B2	Orpheovirus	27.1	2.7e-07
WP_011229846.1|374485_375406_+	diacylglycerol kinase	NA	A0A1V0SBJ0	Catovirus	30.9	1.2e-26
WP_011229847.1|375483_376857_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	49.1	1.0e-125
WP_011229848.1|377194_378649_+	SAM-dependent DNA methyltransferase	NA	A0A1W6JNK1	Staphylococcus_phage	27.7	8.1e-25
WP_011229849.1|378645_379686_+	restriction endonuclease subunit S	NA	F2Y1N5	Organic_Lake_phycodnavirus	24.5	2.1e-06
WP_008880572.1|379812_380982_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	25.2	1.9e-24
WP_041467787.1|381253_384595_+	DEAD/DEAH box helicase family protein	NA	A0A097BY72	Enterococcus_phage	25.0	2.3e-19
WP_011229851.1|384853_385468_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	NA	NA	NA	NA
WP_011229853.1|387369_388617_+|transposase	IS481 family transposase	transposase	M4T586	Rhodobacter_phage	25.1	1.3e-10
>prophage 3
NC_006510	Geobacillus kaustophilus HTA426, complete genome	3544776	529467	604296	3544776	head,integrase,tail,transposase,holin,tRNA,capsid,protease,terminase,portal	Bacillus_phage(32.65%)	98	513791:513806	588626:588641
513791:513806	attL	GGGCGAAGCGGTTTAT	NA	NA	NA	NA
WP_011229986.1|529467_530610_+|tRNA	tRNA epoxyqueuosine(34) reductase QueG	tRNA	NA	NA	NA	NA
WP_011229987.1|530671_531535_+	amidase domain-containing protein	NA	NA	NA	NA	NA
WP_011229988.1|531555_532029_+|tRNA	tRNA (uridine(34)/cytosine(34)/5- carboxymethylaminomethyluridine(34)-2'-O)- methyltransferase TrmL	tRNA	NA	NA	NA	NA
WP_011229990.1|532354_534250_+	PrkA family serine protein kinase	NA	A0MN77	Thermus_phage	38.4	2.4e-109
WP_011229991.1|534558_535743_+	sporulation protein YhbH	NA	A0A140HLI1	Bacillus_phage	44.9	8.0e-23
WP_011229992.1|535714_537259_-	recombinase family protein	NA	D2XR37	Bacillus_phage	58.0	3.0e-147
WP_011229993.1|537376_538072_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A2H4JA43	uncultured_Caudovirales_phage	39.4	1.3e-28
WP_011229994.1|538153_538414_-	DUF2283 domain-containing protein	NA	NA	NA	NA	NA
WP_041467818.1|538385_538793_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011229995.1|538779_539085_-	DUF3467 domain-containing protein	NA	NA	NA	NA	NA
WP_011229996.1|539238_539604_-	helix-turn-helix transcriptional regulator	NA	A0A1L2JY18	Aeribacillus_phage	38.7	3.9e-13
WP_011229997.1|539639_540017_-	helix-turn-helix transcriptional regulator	NA	A0A2H4J6F9	uncultured_Caudovirales_phage	40.5	2.3e-16
WP_011229998.1|540013_540376_-	helix-turn-helix transcriptional regulator	NA	A0A1L2JY18	Aeribacillus_phage	41.5	1.1e-12
WP_011229999.1|540552_540798_+	helix-turn-helix transcriptional regulator	NA	A0A290G4F8	Caldibacillus_phage	54.0	3.9e-09
WP_011230001.1|540857_541163_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011230002.1|541168_541537_-	hypothetical protein	NA	R9VW35	Paenibacillus_phage	28.2	1.1e-07
WP_158300536.1|541648_541810_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011230003.1|541784_542126_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081130673.1|542340_542541_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011230005.1|542512_542962_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011230006.1|543041_543338_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011230007.1|543334_543700_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011230008.1|543771_543969_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011230009.1|544031_544259_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011230010.1|544245_544767_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_011230011.1|544784_544964_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011230012.1|544963_545131_+	hypothetical protein	NA	NA	NA	NA	NA
WP_122381431.1|545370_545634_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041467821.1|545630_546026_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167522584.1|546078_546243_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011230016.1|546291_547287_+	DnaD domain protein	NA	A0A0U4JX08	Bacillus_phage	62.5	2.2e-37
WP_011230017.1|547513_547702_+	Fur-regulated basic protein FbpA	NA	NA	NA	NA	NA
WP_011230018.1|547770_547941_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011230019.1|547940_548423_+	dUTP diphosphatase	NA	A0A1L2JY27	Aeribacillus_phage	58.3	4.2e-47
WP_011230020.1|548424_548685_+	hypothetical protein	NA	S6BFL9	Thermus_phage	75.9	4.9e-18
WP_041467823.1|548883_549090_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041467957.1|549098_549326_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011230022.1|549338_549542_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011230023.1|549594_550335_+	phage antirepressor Ant	NA	A0A2P1JTZ2	Anoxybacillus_phage	75.3	1.7e-103
WP_011230024.1|550451_550640_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041467824.1|550663_551104_+	ArpU family transcriptional regulator	NA	S6AVV9	Thermus_phage	62.3	3.5e-40
WP_011230026.1|551100_551643_+|integrase	site-specific integrase	integrase	D2XR58	Bacillus_phage	62.2	7.1e-59
WP_011230027.1|551787_552081_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011230028.1|552278_553022_+	hypothetical protein	NA	D2XR29	Bacillus_phage	39.6	8.6e-39
WP_011230029.1|553465_553711_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041467959.1|553928_554273_+	HNH endonuclease	NA	A0A0C5AFD8	Paenibacillus_phage	64.6	1.2e-19
WP_122381433.1|554404_554764_+|terminase	P27 family phage terminase small subunit	terminase	NA	NA	NA	NA
WP_011230032.1|554744_556460_+|terminase	terminase large subunit	terminase	A0A2I7SCY3	Paenibacillus_phage	66.1	4.9e-231
WP_011230033.1|556482_557697_+|portal	phage portal protein	portal	A0A0U3SQF0	Bacillus_phage	63.5	5.3e-147
WP_049626318.1|557713_558442_+|protease	Clp protease ClpP	protease	A0A2I7SCY8	Paenibacillus_phage	80.0	8.8e-105
WP_011230035.1|558438_559572_+|capsid	phage major capsid protein	capsid	A0A0K2CZ99	Paenibacillus_phage	77.7	6.9e-165
WP_011230036.1|559590_559866_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2I7SD07	Paenibacillus_phage	55.3	1.8e-18
WP_011230037.1|559862_560063_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011230038.1|560034_560376_+|head	phage head closure protein	head	Q9ZXF2	Bacillus_phage	47.1	1.6e-24
WP_011230039.1|560368_560755_+	HK97 gp10 family phage protein	NA	Q9ZXF1	Bacillus_phage	63.6	3.2e-37
WP_041467826.1|560770_561139_+	DUF3168 domain-containing protein	NA	Q9ZXF0	Bacillus_phage	53.7	3.6e-30
WP_011230040.1|561150_561729_+	hypothetical protein	NA	Q9ZXE9	Bacillus_phage	60.4	2.5e-62
WP_011230041.1|561789_562122_+	hypothetical protein	NA	Q9ZXE8	Bacillus_phage	52.4	1.6e-24
WP_011230042.1|562124_562289_+	hypothetical protein	NA	D6R3Z7	Bacillus_phage	64.8	3.1e-10
WP_011230043.1|562302_567996_+|tail	phage tail tape measure protein	tail	D6R3Z8	Bacillus_phage	33.0	1.8e-112
WP_011230044.1|567997_568867_+|tail	phage tail family protein	tail	A0A2I7SBZ7	Paenibacillus_phage	41.2	1.3e-59
WP_011230045.1|568879_569566_+	hypothetical protein	NA	A0A0C5ABC3	Paenibacillus_phage	41.4	3.7e-36
WP_011230046.1|569575_570931_+	siphovirus ReqiPepy6 Gp37-like family protein	NA	A0A0K2CZQ1	Paenibacillus_phage	44.6	4.2e-92
WP_193338938.1|572621_573557_+|tail	tail fiber protein	tail	A0A1L2K2Q1	Aeribacillus_phage	49.3	2.1e-34
WP_011230049.1|573813_574182_+	hypothetical protein	NA	E5DV66	Deep-sea_thermophilic_phage	64.0	1.2e-30
WP_011230050.1|574181_575189_+	WD40 repeat domain-containing protein	NA	NA	NA	NA	NA
WP_011230051.1|575201_575528_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167522585.1|575529_575667_+	hypothetical protein	NA	A0A1B1P890	Bacillus_phage	74.4	6.8e-11
WP_011230052.1|575741_576161_+|holin	phage holin family protein	holin	S6AVT9	Thermus_phage	96.4	1.8e-65
WP_011230053.1|576157_576838_+	N-acetylmuramoyl-L-alanine amidase	NA	S6BFI4	Thermus_phage	84.1	1.1e-106
WP_011230054.1|576963_577311_+	hypothetical protein	NA	S6B1J4	Thermus_phage	90.4	1.6e-51
WP_011230055.1|577319_577538_-	helix-turn-helix transcriptional regulator	NA	Q0H252	Geobacillus_phage	84.5	8.9e-29
WP_011230056.1|577916_578240_+	hypothetical protein	NA	Q0H251	Geobacillus_phage	64.5	2.0e-32
WP_070104266.1|578241_579420_+	DNA translocase FtsK	NA	Q0H250	Geobacillus_phage	53.5	9.2e-112
WP_011230058.1|579400_580081_+	hypothetical protein	NA	Q0H249	Geobacillus_phage	81.3	6.5e-102
WP_011230059.1|580096_580270_+	hypothetical protein	NA	Q0H248	Geobacillus_phage	92.5	5.1e-19
WP_011230060.1|580526_581219_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011230062.1|581753_582434_-	response regulator	NA	W8CYM9	Bacillus_phage	26.4	4.6e-07
WP_011230063.1|582497_584075_-	sensor histidine kinase	NA	W8CYF6	Bacillus_phage	25.6	9.7e-08
WP_011230064.1|584387_585428_+	TRAP transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_025039067.1|585588_586851_+	dicarboxylate/amino acid:cation symporter	NA	NA	NA	NA	NA
WP_011230066.1|587133_587961_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	52.0	5.7e-76
WP_011230067.1|588108_588801_+	zinc metallopeptidase	NA	NA	NA	NA	NA
588626:588641	attR	GGGCGAAGCGGTTTAT	NA	NA	NA	NA
WP_011230068.1|588912_590253_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_011230069.1|590327_591227_-	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
WP_014194938.1|591365_591764_+	YhcU family protein	NA	NA	NA	NA	NA
WP_011230071.1|592089_592563_-	thioredoxin family protein	NA	NA	NA	NA	NA
WP_011230072.1|592559_592997_-	disulfide bond formation protein B	NA	NA	NA	NA	NA
WP_011230073.1|593170_593617_+	CBS domain-containing protein	NA	A0A2I6B2H4	Macacine_betaherpesvirus	39.7	3.0e-15
WP_011230074.1|593733_595491_+	phospho-sugar mutase	NA	A0A1X9I671	Streptococcus_phage	49.7	5.5e-161
WP_011230075.1|595538_595796_-	YhdB family protein	NA	NA	NA	NA	NA
WP_025039331.1|595976_596225_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011230077.1|596254_596860_-	DedA family protein	NA	NA	NA	NA	NA
WP_011230079.1|598126_599998_+	putative DNA binding domain-containing protein	NA	NA	NA	NA	NA
WP_011230080.1|600787_601369_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_011230081.1|601686_602160_+	PCYCGC domain-containing protein	NA	NA	NA	NA	NA
WP_011230082.1|602296_603019_+	ZIP family metal transporter	NA	NA	NA	NA	NA
WP_011230083.1|603156_604296_-|transposase	IS110-like element ISGka2 family transposase	transposase	Q9JMN8	Wolbachia_phage	27.2	2.0e-31
>prophage 4
NC_006510	Geobacillus kaustophilus HTA426, complete genome	3544776	864319	911842	3544776	coat,transposase	Tupanvirus(16.67%)	49	NA	NA
WP_011230338.1|864319_865414_-|coat	CotS family spore coat protein	coat	NA	NA	NA	NA
WP_011230339.1|865669_866824_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_011230340.1|866820_867777_-	NAD-dependent epimerase/dehydratase family protein	NA	A0A2K9L4U8	Tupanvirus	33.1	4.9e-39
WP_011230341.1|867773_869057_-	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	37.6	3.2e-73
WP_011230342.1|869238_870321_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_011230343.1|870327_871323_-	phosphotransferase	NA	NA	NA	NA	NA
WP_011230344.1|871484_871787_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011230345.1|871961_872312_+	DUF1360 domain-containing protein	NA	NA	NA	NA	NA
WP_011230347.1|872625_873390_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011230348.1|873491_874211_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014195191.1|874365_874701_+|coat	spore coat protein	coat	NA	NA	NA	NA
WP_011230350.1|875083_875314_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011230351.1|875341_875545_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011230352.1|875703_875910_+	DUF1657 domain-containing protein	NA	NA	NA	NA	NA
WP_011230353.1|876007_876484_+	YhcN/YlaJ family sporulation lipoprotein	NA	NA	NA	NA	NA
WP_011230354.1|876495_876975_+	stage V sporulation protein AC	NA	NA	NA	NA	NA
WP_011230355.1|876974_877988_+	stage V sporulation protein AD	NA	NA	NA	NA	NA
WP_013146042.1|877989_878346_+	stage V sporulation protein AE	NA	NA	NA	NA	NA
WP_011230357.1|878358_878565_+	DUF1657 domain-containing protein	NA	NA	NA	NA	NA
WP_011230358.1|878577_879438_+	DUF421 domain-containing protein	NA	NA	NA	NA	NA
WP_011230359.1|879458_879629_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011230360.1|879768_880089_-	thioredoxin family protein	NA	NA	NA	NA	NA
WP_011230361.1|880217_880454_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011230362.1|880533_880659_+	YjcZ family sporulation protein	NA	NA	NA	NA	NA
WP_011230363.1|880785_881043_+	stage VI sporulation protein F	NA	NA	NA	NA	NA
WP_011230364.1|881160_881595_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_011230365.1|881596_882118_-	YjcG family protein	NA	NA	NA	NA	NA
WP_011230366.1|882216_882945_-	esterase family protein	NA	NA	NA	NA	NA
WP_011230367.1|883443_884547_+	methionine biosynthesis PLP-dependent protein	NA	A0A0B5JD48	Pandoravirus	28.4	5.2e-16
WP_011230368.1|884550_885732_+	cystathionine beta-lyase	NA	NA	NA	NA	NA
WP_011230369.1|885781_885991_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011230370.1|886139_886583_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021321892.1|886831_887527_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_033013361.1|887526_888645_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_015374191.1|888644_889700_+	polysaccharide pyruvyl transferase family protein	NA	NA	NA	NA	NA
WP_145972832.1|891687_892029_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_011230378.1|892178_893348_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	25.2	3.2e-24
WP_011230379.1|893487_894567_-	LAGLIDADG family homing endonuclease	NA	NA	NA	NA	NA
WP_011230380.1|895671_896229_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011230381.1|896369_897620_+|transposase	IS481 family transposase	transposase	M4T586	Rhodobacter_phage	26.0	2.2e-10
WP_011230382.1|897612_898413_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_011230384.1|898845_899532_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021322266.1|899528_899747_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011230385.1|899953_901426_-	recombinase family protein	NA	A0A2I4R675	Erysipelothrix_phage	26.5	1.1e-34
WP_021322265.1|901422_901593_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011230386.1|904347_906762_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_011230387.1|907816_908071_-	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_011230388.1|908409_910068_-|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
WP_011230389.1|910174_911842_-|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
>prophage 5
NC_006510	Geobacillus kaustophilus HTA426, complete genome	3544776	1000482	1008616	3544776		Streptococcus_virus(33.33%)	10	NA	NA
WP_025039182.1|1000482_1001148_+	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	57.5	3.0e-67
WP_011230477.1|1001144_1001582_+	6-carboxytetrahydropterin synthase QueD	NA	A0A1U9WRB3	Streptococcus_virus	33.0	9.6e-06
WP_011230478.1|1001581_1002316_+	7-carboxy-7-deazaguanine synthase QueE	NA	A0A1U9WRB6	Streptococcus_virus	44.6	3.8e-55
WP_011230479.1|1002368_1002866_+	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	E7DN65	Pneumococcus_phage	67.9	7.7e-52
WP_014195299.1|1002919_1003603_+	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_011230482.1|1004115_1004697_-	cell wall hydrolase	NA	A0A0E3XAL9	Bacillus_phage	48.1	1.4e-41
WP_011230483.1|1004897_1005092_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011230484.1|1005263_1005938_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011230486.1|1007022_1007268_+	YueH family protein	NA	NA	NA	NA	NA
WP_011230487.1|1007323_1008616_+	PAS domain-containing protein	NA	A0A1V0SGX0	Hokovirus	26.0	2.1e-16
>prophage 7
NC_006510	Geobacillus kaustophilus HTA426, complete genome	3544776	1719503	1752484	3544776	integrase,transposase	Streptococcus_phage(100.0%)	28	1718546:1718561	1756371:1756386
1718546:1718561	attL	ATGCCGCAAATGATGG	NA	NA	NA	NA
WP_011231190.1|1719503_1721162_+|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
WP_011231191.1|1721407_1721890_+	PH domain-containing protein	NA	NA	NA	NA	NA
WP_011231192.1|1721879_1723322_+	PH domain-containing protein	NA	NA	NA	NA	NA
WP_041467856.1|1723529_1725191_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011231194.1|1725392_1726028_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081430699.1|1726133_1726709_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011231196.1|1726790_1727273_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011231197.1|1727626_1728394_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011229854.1|1728527_1729328_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_011231199.1|1731547_1731892_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011231200.1|1731938_1732607_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011231201.1|1732759_1734196_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A1X9I6E7	Streptococcus_phage	26.7	2.6e-07
WP_011231202.1|1734438_1734762_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011231203.1|1735014_1737225_+	catalase/peroxidase HPI	NA	NA	NA	NA	NA
WP_049752153.1|1737603_1738086_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011231205.1|1738517_1739609_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_041467858.1|1739842_1740568_+	MOSC domain-containing protein	NA	NA	NA	NA	NA
WP_081430722.1|1740749_1740965_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_011231207.1|1741137_1741770_+	FMN-binding negative transcriptional regulator	NA	NA	NA	NA	NA
WP_011231208.1|1741898_1743344_+	aspartate aminotransferase family protein	NA	NA	NA	NA	NA
WP_011231209.1|1743549_1744026_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_011231210.1|1744171_1744792_-	LysE family translocator	NA	NA	NA	NA	NA
WP_011231211.1|1745181_1745889_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011231213.1|1746832_1748200_+|transposase	ISLre2 family transposase	transposase	NA	NA	NA	NA
WP_011231214.1|1748428_1749307_-|transposase	IS982-like element ISGsp1 family transposase	transposase	NA	NA	NA	NA
WP_033005834.1|1750328_1750610_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011231217.1|1750696_1750942_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011229894.1|1751296_1752484_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
1756371:1756386	attR	ATGCCGCAAATGATGG	NA	NA	NA	NA
>prophage 8
NC_006510	Geobacillus kaustophilus HTA426, complete genome	3544776	1903562	1957794	3544776	transposase	Staphylococcus_phage(40.0%)	39	NA	NA
WP_011231366.1|1903562_1905221_+|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
WP_011231367.1|1905458_1906505_-	galactose mutarotase	NA	NA	NA	NA	NA
WP_011231368.1|1906521_1907517_-	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_041467868.1|1907601_1908777_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_011231370.1|1908779_1910294_-	xylose ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.4	3.4e-18
WP_011231371.1|1910406_1911498_-	D-xylose ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_012749092.1|1912240_1913521_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_011229672.1|1913646_1913973_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_011231374.1|1913969_1914842_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	41.5	8.5e-46
WP_011231375.1|1915055_1916201_-	MFS transporter	NA	NA	NA	NA	NA
WP_011231376.1|1916265_1917153_-	class II fructose-1,6-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_041467869.1|1917226_1918687_-	CoA-acylating methylmalonate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_011231378.1|1918707_1919715_-	5-dehydro-2-deoxygluconokinase	NA	NA	NA	NA	NA
WP_011231379.1|1919746_1920577_-	5-deoxy-glucuronate isomerase	NA	NA	NA	NA	NA
WP_011231380.1|1920595_1921522_-	myo-inosose-2 dehydratase	NA	NA	NA	NA	NA
WP_011231381.1|1921540_1923475_-	3D-(3,5/4)-trihydroxycyclohexane-1,2-dione acylhydrolase (decyclizing)	NA	NA	NA	NA	NA
WP_011231382.1|1923496_1924339_-	sugar phosphate isomerase/epimerase	NA	NA	NA	NA	NA
WP_011231383.1|1924358_1925363_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_011231384.1|1925380_1926892_-	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	23.0	3.9e-14
WP_041467870.1|1927876_1928845_-	sugar ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_011231387.1|1928987_1930013_-	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_011231388.1|1930068_1931262_-	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_011231389.1|1931278_1932283_-	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_011231390.1|1932549_1934019_+|transposase	IS5-like element ISGka1 family transposase	transposase	NA	NA	NA	NA
WP_011231391.1|1934129_1935146_-	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_011231392.1|1935340_1938475_-	alpha-mannosidase	NA	NA	NA	NA	NA
WP_011231366.1|1938875_1940534_-|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
WP_041467871.1|1940771_1942262_-	L-arabinose isomerase	NA	NA	NA	NA	NA
WP_011231394.1|1942278_1943973_-	ribulokinase	NA	NA	NA	NA	NA
WP_011231395.1|1943989_1944676_-	L-ribulose-5-phosphate 4-epimerase	NA	NA	NA	NA	NA
WP_011231396.1|1944769_1945864_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_049752169.1|1946169_1947381_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_011231398.1|1947394_1948936_-	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	28.1	4.1e-19
WP_011231399.1|1949017_1950097_-	sugar-binding protein	NA	NA	NA	NA	NA
WP_011231400.1|1950290_1951496_-	response regulator	NA	NA	NA	NA	NA
WP_033007424.1|1951509_1953285_-	sensor histidine kinase	NA	NA	NA	NA	NA
WP_011231402.1|1953320_1954328_-	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_011231403.1|1954642_1955407_-	enoyl-CoA hydratase	NA	NA	NA	NA	NA
WP_011230282.1|1956543_1957794_+|transposase	IS481 family transposase	transposase	M4T586	Rhodobacter_phage	26.6	4.4e-11
>prophage 9
NC_006510	Geobacillus kaustophilus HTA426, complete genome	3544776	2270408	2288792	3544776	protease,coat,transposase	Diadromus_pulchellus_ascovirus(20.0%)	20	NA	NA
WP_012820744.1|2270408_2271086_-|protease	intramembrane metalloprotease PrsW	protease	NA	NA	NA	NA
WP_011231717.1|2271174_2272146_-	asparaginase	NA	NA	NA	NA	NA
WP_011231718.1|2272364_2273357_-	YpdA family putative bacillithiol disulfide reductase	NA	NA	NA	NA	NA
WP_011231719.1|2273446_2274718_-	Glu/Leu/Phe/Val dehydrogenase	NA	NA	NA	NA	NA
WP_011231720.1|2274878_2275469_-	genetic competence negative regulator	NA	NA	NA	NA	NA
WP_041467892.1|2275626_2276019_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014196217.1|2276122_2276353_+|coat	spore coat associated protein CotJA	coat	NA	NA	NA	NA
WP_011231722.1|2276349_2276610_+|coat	spore coat protein CotJB	coat	NA	NA	NA	NA
WP_011231723.1|2276644_2277214_+	manganese catalase family protein	NA	NA	NA	NA	NA
WP_011231724.1|2277239_2277686_-	YpbF family protein	NA	NA	NA	NA	NA
WP_011231725.1|2277784_2278315_-	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_011231726.1|2278311_2278896_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_011231727.1|2278879_2280403_-	ATP-dependent DNA helicase RecQ	NA	F2NZ48	Diadromus_pulchellus_ascovirus	39.0	3.3e-61
WP_011231728.1|2280390_2281437_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_011231729.1|2281691_2281940_+	ferredoxin	NA	A0A127AYY7	Bacillus_phage	53.3	5.6e-19
WP_011231730.1|2282104_2282608_+	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	44.8	1.0e-27
WP_041467893.1|2282854_2284402_+	phosphoglycerate dehydrogenase	NA	A0A1B1IVB5	uncultured_Mediterranean_phage	32.8	2.1e-31
WP_011231732.1|2284663_2285476_-	histidinol-phosphatase	NA	NA	NA	NA	NA
WP_011231734.1|2285897_2286953_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_011229816.1|2287601_2288792_-|transposase	ISL3 family transposase	transposase	A0A0A8WEF4	Clostridium_phage	25.2	2.2e-28
>prophage 10
NC_006510	Geobacillus kaustophilus HTA426, complete genome	3544776	2319765	2329613	3544776		Staphylococcus_phage(50.0%)	11	NA	NA
WP_011231768.1|2319765_2320914_-	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	33.6	3.9e-22
WP_025039220.1|2321263_2322577_-	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	43.6	5.2e-39
WP_011231771.1|2322934_2323336_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011231772.1|2323354_2324008_-	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	35.3	1.7e-14
WP_020278275.1|2324183_2324939_-	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	24.5	9.4e-09
WP_011231774.1|2325133_2325673_+	DUF309 domain-containing protein	NA	NA	NA	NA	NA
WP_011231775.1|2325695_2326052_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_011231776.1|2326172_2326637_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	61.1	1.0e-42
WP_014196246.1|2326657_2327851_-	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	54.1	1.5e-117
WP_011231778.1|2327871_2328516_-	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	41.3	1.9e-39
WP_011231779.1|2328470_2329613_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	36.3	2.0e-55
>prophage 11
NC_006510	Geobacillus kaustophilus HTA426, complete genome	3544776	2612672	2671595	3544776	protease,coat,tRNA	Clostridium_phage(20.0%)	55	NA	NA
WP_011232074.1|2612672_2614229_-|coat	SafA/ExsA family spore coat assembly protein	coat	NA	NA	NA	NA
WP_011232075.1|2614387_2615491_-	quinolinate synthase NadA	NA	NA	NA	NA	NA
WP_011232076.1|2615505_2616336_-	carboxylating nicotinate-nucleotide diphosphorylase	NA	NA	NA	NA	NA
WP_173400011.1|2616364_2617957_-	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_011232078.1|2618026_2619151_+	IscS subfamily cysteine desulfurase	NA	NA	NA	NA	NA
WP_011232079.1|2619166_2619706_+	transcription repressor NadR	NA	NA	NA	NA	NA
WP_011232080.1|2619819_2620668_-	prephenate dehydratase	NA	NA	NA	NA	NA
WP_011232081.1|2620689_2621133_-	ACT domain-containing protein	NA	NA	NA	NA	NA
WP_011232082.1|2621149_2622448_-	GTPase ObgE	NA	NA	NA	NA	NA
WP_011232083.1|2622671_2623220_-	Spo0B domain-containing protein	NA	NA	NA	NA	NA
WP_011232084.1|2623391_2623682_-	50S ribosomal protein L27	NA	NA	NA	NA	NA
WP_011232085.1|2623697_2624027_-|protease	ribosomal-processing cysteine protease Prp	protease	NA	NA	NA	NA
WP_011232086.1|2624029_2624338_-	50S ribosomal protein L21	NA	NA	NA	NA	NA
WP_041467899.1|2624819_2625680_-|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_011232088.1|2625672_2626440_-	M23 family metallopeptidase	NA	NA	NA	NA	NA
WP_011232089.1|2626703_2627507_-	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_011232090.1|2627509_2628193_-	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_011232091.1|2628242_2628761_-	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_011232092.1|2628757_2629624_-	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_011232093.1|2629643_2630666_-	rod shape-determining protein	NA	NA	NA	NA	NA
WP_174520663.1|2630823_2631495_-	DNA repair protein RadC	NA	NA	NA	NA	NA
WP_015375502.1|2631639_2632215_-	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_011232096.1|2632551_2633667_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011232097.1|2633783_2634245_-	type II secretion system protein	NA	NA	NA	NA	NA
WP_011232098.1|2634266_2634974_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011232099.1|2634970_2635546_-	DUF2681 domain-containing protein	NA	NA	NA	NA	NA
WP_011232100.1|2635535_2636468_-	pilus assembly protein PilM	NA	NA	NA	NA	NA
WP_011232101.1|2636495_2637242_-	prepilin peptidase	NA	NA	NA	NA	NA
WP_011232102.1|2637262_2637724_-	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	NA	NA	NA	NA
WP_011232103.1|2637819_2639031_-	type II secretion system F family protein	NA	NA	NA	NA	NA
WP_011232104.1|2639017_2640073_-	type IV pilus twitching motility protein PilT	NA	NA	NA	NA	NA
WP_011232105.1|2640085_2641750_-	Flp pilus assembly complex ATPase component TadA	NA	NA	NA	NA	NA
WP_108209751.1|2641746_2642925_-	VanW family protein	NA	NA	NA	NA	NA
WP_011232107.1|2643104_2643875_-	PRC-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_011232108.1|2643885_2645337_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011232109.1|2645452_2646085_+	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	NA	NA	NA	NA
WP_011232110.1|2646068_2646638_+	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	NA	NA	NA	NA
WP_021321851.1|2646650_2648372_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011232112.1|2648438_2651321_-	VWA domain-containing protein	NA	A0A1L2BYA9	Clostridium_phage	33.1	2.7e-08
WP_011232113.1|2651350_2652700_-	bifunctional folylpolyglutamate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_011232114.1|2652883_2655526_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0S951	Catovirus	42.4	7.2e-165
WP_011232115.1|2656000_2656189_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011232116.1|2656227_2657259_-|coat	spore coat protein YsxE	coat	NA	NA	NA	NA
WP_011232117.1|2657303_2658353_-	stage VI sporulation protein D	NA	NA	NA	NA	NA
WP_011232118.1|2658471_2659761_-	glutamate-1-semialdehyde 2,1-aminomutase	NA	NA	NA	NA	NA
WP_011232119.1|2659777_2660752_-	porphobilinogen synthase	NA	NA	NA	NA	NA
WP_011232120.1|2660752_2661523_-	uroporphyrinogen-III synthase	NA	NA	NA	NA	NA
WP_011232121.1|2661522_2662452_-	hydroxymethylbilane synthase	NA	NA	NA	NA	NA
WP_011232122.1|2662467_2663286_-	cytochrome c biogenesis protein CcsA	NA	NA	NA	NA	NA
WP_011232123.1|2663296_2664661_-|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_011232124.1|2664827_2665313_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011232125.1|2665354_2665942_-	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_041467901.1|2665938_2668281_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	44.7	9.8e-182
WP_011232127.1|2668511_2670185_-|protease	ATP-dependent protease LonB	protease	A0A076FMQ5	Aureococcus_anophage	32.7	2.4e-12
WP_011232128.1|2670329_2671595_-|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	67.0	6.3e-151
>prophage 12
NC_006510	Geobacillus kaustophilus HTA426, complete genome	3544776	2880542	2940314	3544776	integrase,transposase,holin	Staphylococcus_phage(40.0%)	56	2929634:2929691	2940455:2940512
WP_011232324.1|2880542_2881445_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	NA	NA	NA	NA
WP_011232325.1|2881725_2881968_-	DUF2584 domain-containing protein	NA	NA	NA	NA	NA
WP_011232326.1|2882060_2882849_-	S9 family peptidase	NA	A0A2H4PQM6	Staphylococcus_phage	37.7	7.4e-33
WP_011232327.1|2883142_2884147_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_011232328.1|2884165_2884957_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	37.6	3.0e-34
WP_011232329.1|2884940_2885750_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_011232330.1|2885868_2886336_-	nucleoside triphosphatase YtkD	NA	A0A2H4PQM4	Staphylococcus_phage	39.0	6.0e-22
WP_011232331.1|2886394_2886727_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011232332.1|2886788_2887184_-|holin	phage holin family protein	holin	A0A0N7GFE6	Paenibacillus_phage	48.3	9.2e-24
WP_011232333.1|2887336_2887777_-	DNA starvation/stationary phase protection protein	NA	A0A0A7RTZ1	Clostridium_phage	67.8	9.5e-54
WP_172637444.1|2888275_2888491_+	YtzI protein	NA	NA	NA	NA	NA
WP_011232335.1|2888513_2888990_-	S-ribosylhomocysteine lyase	NA	NA	NA	NA	NA
WP_011232336.1|2889203_2889449_+	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	61.3	7.7e-21
WP_011232337.1|2889552_2890539_+	zinc ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_011232338.1|2890755_2892714_-	beta-propeller fold lactonase family protein	NA	NA	NA	NA	NA
WP_011232339.1|2892810_2894889_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013524470.1|2895037_2895526_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011232341.1|2895544_2895835_-	DUF2325 domain-containing protein	NA	NA	NA	NA	NA
WP_011232342.1|2896163_2896325_+	DUF1540 domain-containing protein	NA	NA	NA	NA	NA
WP_011232343.1|2896390_2896588_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011232344.1|2896894_2898367_-	o-succinylbenzoate--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	33.2	4.0e-64
WP_011232345.1|2898482_2899301_-	1,4-dihydroxy-2-naphthoyl-CoA synthase	NA	NA	NA	NA	NA
WP_011232346.1|2899301_2900114_-	2-succinyl-6-hydroxy-2, 4-cyclohexadiene-1-carboxylate synthase	NA	NA	NA	NA	NA
WP_011232347.1|2900125_2901859_-	2-succinyl-5-enolpyruvyl-6-hydroxy-3- cyclohexene-1-carboxylic-acid synthase	NA	NA	NA	NA	NA
WP_011232348.1|2901851_2903228_-	isochorismate synthase	NA	NA	NA	NA	NA
WP_011232349.1|2903396_2904326_+	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_011232350.1|2904412_2905222_+	yteA family sporulation protein	NA	NA	NA	NA	NA
WP_011232351.1|2905321_2906116_+	TIGR00266 family protein	NA	NA	NA	NA	NA
WP_011232352.1|2906333_2907452_-|transposase	transposase	transposase	A0A0P0IJS6	Lactobacillus_phage	45.6	5.2e-88
WP_011232353.1|2907832_2908783_+	cation transporter	NA	NA	NA	NA	NA
WP_011232354.1|2908913_2909540_+	LysE family translocator	NA	NA	NA	NA	NA
WP_023633412.1|2909743_2910031_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011232356.1|2910040_2910595_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_011232357.1|2910710_2911337_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011232358.1|2911333_2912236_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_011232361.1|2913248_2914796_-	L-glutamate gamma-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_011232363.1|2915272_2915428_-	aminopeptidase P family N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_011232364.1|2915496_2915832_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_011232365.1|2915851_2917588_-	hydantoinase B/oxoprolinase family protein	NA	NA	NA	NA	NA
WP_011232366.1|2917595_2919638_-	hydantoinase/oxoprolinase family protein	NA	NA	NA	NA	NA
WP_011232367.1|2919677_2920220_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_011232368.1|2920425_2921769_-	MFS transporter	NA	NA	NA	NA	NA
WP_011232369.1|2921799_2922549_-	hydantoin racemase	NA	NA	NA	NA	NA
WP_041468039.1|2922924_2924427_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011232371.1|2924479_2925460_-	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_011232372.1|2925452_2926451_-	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_011232373.1|2926481_2927423_-	iron-siderophore ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_011232374.1|2928049_2928562_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041468040.1|2928867_2929329_-	YobA family protein	NA	NA	NA	NA	NA
2929634:2929691	attL	GATGCCGATGGTGGGAGTCGAACCCACACGGGGGGCTACCCCACACGATTTTGAGTCG	NA	NA	NA	NA
WP_011229840.1|2929994_2931131_-|transposase	IS110-like element ISGka2 family transposase	transposase	Q9JMN8	Wolbachia_phage	27.1	1.2e-31
WP_041467903.1|2931288_2931495_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011232376.1|2931509_2932826_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_011232378.1|2934023_2934902_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_011232379.1|2935015_2935360_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011232380.1|2935709_2936687_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049752174.1|2939309_2940314_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A142F1N9	Bacillus_phage	48.8	1.0e-74
2940455:2940512	attR	GATGCCGATGGTGGGAGTCGAACCCACACGGGGGGCTACCCCACACGATTTTGAGTCG	NA	NA	NA	NA
>prophage 13
NC_006510	Geobacillus kaustophilus HTA426, complete genome	3544776	3270831	3347557	3544776	integrase,transposase	Bacillus_phage(27.27%)	57	3270092:3270110	3275317:3275335
3270092:3270110	attL	AACTCACATTTCGCACCCT	NA	NA	NA	NA
WP_041467913.1|3270831_3272244_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A1X9I6E7	Streptococcus_phage	26.2	3.3e-07
WP_020278768.1|3273884_3275096_+	MFS transporter	NA	NA	NA	NA	NA
WP_011232709.1|3275418_3277077_+|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
3275317:3275335	attR	AACTCACATTTCGCACCCT	NA	NA	NA	NA
WP_011232711.1|3277637_3277838_-	DUF3311 domain-containing protein	NA	NA	NA	NA	NA
WP_011232715.1|3280087_3281212_-	KdpD-like non-kinase potassium sensor	NA	NA	NA	NA	NA
WP_011232716.1|3281201_3281780_-	potassium-transporting ATPase subunit KdpC	NA	NA	NA	NA	NA
WP_011232717.1|3281798_3283832_-	potassium-transporting ATPase subunit KdpB	NA	A0A218MNH6	uncultured_virus	27.2	6.9e-22
WP_011232718.1|3283847_3285530_-	potassium-transporting ATPase subunit KdpA	NA	NA	NA	NA	NA
WP_068895790.1|3285596_3285677_-	K(+)-transporting ATPase subunit F	NA	NA	NA	NA	NA
WP_011232721.1|3287219_3288404_-	amidohydrolase	NA	NA	NA	NA	NA
WP_011232722.1|3288437_3289667_-	Zn-dependent hydrolase	NA	NA	NA	NA	NA
WP_014196895.1|3289823_3291152_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011232724.1|3291408_3292782_-	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	40.6	5.9e-86
WP_011232725.1|3293023_3294364_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1S5QTQ1	Bacillus_phage	34.6	1.7e-16
WP_011232727.1|3295133_3295844_+	plasmid pRiA4b ORF-3 family protein	NA	A0A2H4PDG5	Mycobacterium_phage	35.4	6.1e-26
WP_041467917.1|3295930_3297226_-	SEC-C domain-containing protein	NA	NA	NA	NA	NA
WP_011232729.1|3297751_3299947_-	SEC-C domain-containing protein	NA	NA	NA	NA	NA
WP_011232730.1|3300244_3301561_-	SEC-C domain-containing protein	NA	NA	NA	NA	NA
WP_011232731.1|3301777_3303424_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011232732.1|3303420_3306180_+	DEAD/DEAH box helicase	NA	E7DNC5	Pneumococcus_phage	26.0	2.0e-32
WP_011232734.1|3306867_3307839_-	DUF1861 family protein	NA	NA	NA	NA	NA
WP_011232735.1|3308119_3308605_-	macro domain-containing protein	NA	G3MBI4	Bacillus_virus	54.8	1.9e-42
WP_011232736.1|3308608_3308986_-	DUF488 family protein	NA	NA	NA	NA	NA
WP_011232737.1|3309007_3309439_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011232738.1|3309441_3310755_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_011232739.1|3310797_3311685_-	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	52.7	1.1e-77
WP_011232740.1|3311966_3313025_-	glycoside hydrolase family 130 protein	NA	NA	NA	NA	NA
WP_011232741.1|3313027_3313975_-	DUF1861 family protein	NA	NA	NA	NA	NA
WP_011232742.1|3314016_3314847_-	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_011232743.1|3314833_3315712_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_011232744.1|3315713_3317039_-	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_011232745.1|3317533_3318547_+	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_011232746.1|3318586_3319480_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	NA	NA	NA	NA
WP_011232747.1|3319681_3320614_-	DMT family transporter	NA	NA	NA	NA	NA
WP_011232748.1|3320908_3321382_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011232749.1|3321425_3321626_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011232750.1|3321859_3322357_+	L,D-transpeptidase family protein	NA	NA	NA	NA	NA
WP_011232751.1|3322527_3323598_+	cell envelope integrity protein TolA	NA	NA	NA	NA	NA
WP_011232752.1|3323741_3324341_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011232753.1|3324414_3326181_-	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_011232754.1|3326437_3326890_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_011232755.1|3327239_3327497_-	DUF2283 domain-containing protein	NA	NA	NA	NA	NA
WP_011232756.1|3327465_3327861_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021321464.1|3327860_3328151_-	DUF3467 domain-containing protein	NA	NA	NA	NA	NA
WP_011232757.1|3328421_3328898_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_011232758.1|3328903_3330430_-	YifB family Mg chelatase-like AAA ATPase	NA	NA	NA	NA	NA
WP_011232761.1|3331373_3332120_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014196909.1|3332121_3332994_-	HipA domain-containing protein	NA	NA	NA	NA	NA
WP_011232763.1|3333142_3334576_-	caspase family protein	NA	NA	NA	NA	NA
WP_011232764.1|3334787_3336410_-	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_011232766.1|3337238_3338210_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	40.8	6.1e-61
WP_011232767.1|3338224_3339967_-	phospho-sugar mutase	NA	A0A1X9I671	Streptococcus_phage	52.4	2.3e-175
WP_011232768.1|3340367_3341639_-	polysaccharide pyruvyl transferase family protein	NA	NA	NA	NA	NA
WP_011232769.1|3341643_3342933_-	flippase	NA	NA	NA	NA	NA
WP_081430727.1|3343042_3343363_-	sugar transferase	NA	NA	NA	NA	NA
WP_011229840.1|3343659_3344796_-|transposase	IS110-like element ISGka2 family transposase	transposase	Q9JMN8	Wolbachia_phage	27.1	1.2e-31
WP_011229657.1|3345898_3347557_+|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
>prophage 14
NC_006510	Geobacillus kaustophilus HTA426, complete genome	3544776	3443333	3484045	3544776	protease,tRNA,coat,transposase	Bacillus_phage(50.0%)	42	NA	NA
WP_011232868.1|3443333_3445007_-|tRNA	arginine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_011232869.1|3445010_3445442_-	DUF1934 domain-containing protein	NA	NA	NA	NA	NA
WP_011232870.1|3445696_3446074_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011232871.1|3446205_3447081_-	agmatinase	NA	NA	NA	NA	NA
WP_011232872.1|3447093_3447921_-	polyamine aminopropyltransferase	NA	NA	NA	NA	NA
WP_011232873.1|3448177_3450223_+	PBP1A family penicillin-binding protein	NA	NA	NA	NA	NA
WP_011232874.1|3450354_3450870_-	YwhD family protein	NA	NA	NA	NA	NA
WP_011232875.1|3450887_3451556_-|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_011232876.1|3451687_3451876_+	4-oxalocrotonate tautomerase	NA	NA	NA	NA	NA
WP_011232877.1|3451963_3452482_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011232878.1|3452495_3453794_-	HD domain-containing protein	NA	E3T4P8	Cafeteria_roenbergensis_virus	28.6	4.7e-24
WP_011232879.1|3453938_3454166_-	DUF1450 domain-containing protein	NA	NA	NA	NA	NA
WP_011232880.1|3454341_3454995_+	RsfA family transcriptional regulator	NA	A0A1D6X8E5	Bacillus_phage	51.5	9.9e-07
WP_011232881.1|3455133_3455985_-	lipoate--protein ligase family protein	NA	NA	NA	NA	NA
WP_011232882.1|3456184_3457165_-	phosphate acetyltransferase	NA	NA	NA	NA	NA
WP_011232883.1|3457422_3458169_+	heme-dependent peroxidase	NA	NA	NA	NA	NA
WP_011232884.1|3458490_3458937_+	cell wall hydrolase	NA	NA	NA	NA	NA
WP_011232885.1|3458955_3459540_+|coat	spore coat protein GerQ	coat	NA	NA	NA	NA
WP_011232886.1|3459735_3460107_-	DUF423 domain-containing protein	NA	NA	NA	NA	NA
WP_011232887.1|3460773_3461073_-	YwdI family protein	NA	NA	NA	NA	NA
WP_011232888.1|3461091_3461781_-	uracil-DNA glycosylase	NA	A0A0B5IW78	Pandoravirus	50.2	2.7e-55
WP_011232889.1|3462168_3462519_+	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_011232890.1|3462515_3463004_+	anti-sigma B factor RsbW	NA	NA	NA	NA	NA
WP_011232891.1|3462963_3463734_+	sigma-70 family RNA polymerase sigma factor	NA	A0A0A0RV91	Bacillus_phage	34.2	4.3e-17
WP_011232892.1|3463783_3465694_-	SpoIIE family protein phosphatase	NA	NA	NA	NA	NA
WP_011232893.1|3466114_3466633_+	type II toxin-antitoxin system PemK/MazF family toxin	NA	NA	NA	NA	NA
WP_041467928.1|3467067_3467304_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011232895.1|3467475_3468111_-	FMN-dependent NADH-azoreductase	NA	NA	NA	NA	NA
WP_011232896.1|3468283_3468433_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011232897.1|3468602_3469985_-|tRNA	glycine--tRNA ligase	tRNA	A0A1V0SAN4	Catovirus	30.4	1.1e-52
WP_011229531.1|3470443_3471808_-|transposase	ISLre2 family transposase	transposase	NA	NA	NA	NA
WP_011232898.1|3471958_3472816_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_011232899.1|3472895_3474092_-	MFS transporter	NA	NA	NA	NA	NA
WP_011232900.1|3474214_3474532_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011232901.1|3474926_3476684_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011232902.1|3476700_3477561_+	phosphate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_011232903.1|3477634_3478570_+	phosphate ABC transporter permease subunit PstC	NA	NA	NA	NA	NA
WP_041468075.1|3478599_3479463_+	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_011232905.1|3480150_3481431_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_011229672.1|3481556_3481883_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_011231374.1|3481879_3482752_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	41.5	8.5e-46
WP_011232906.1|3482965_3484045_-|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
>prophage 15
NC_006510	Geobacillus kaustophilus HTA426, complete genome	3544776	3514219	3524039	3544776		uncultured_Mediterranean_phage(16.67%)	8	NA	NA
WP_011232933.1|3514219_3515440_-	trypsin-like peptidase domain-containing protein	NA	A0A1B1IT49	uncultured_Mediterranean_phage	28.8	6.1e-18
WP_011232934.1|3515541_3516336_-	MBL fold metallo-hydrolase	NA	A0A0C5AJ83	Bacteriophage	37.7	6.5e-45
WP_011232935.1|3516342_3517125_-	two-component system regulatory protein YycI	NA	NA	NA	NA	NA
WP_011232936.1|3517111_3518440_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011232937.1|3518432_3520262_-	cell wall metabolism sensor histidine kinase WalK	NA	A0A1V0SGX0	Hokovirus	27.0	1.2e-22
WP_011232938.1|3520268_3520982_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	41.4	1.7e-44
WP_011232939.1|3521170_3522457_-	adenylosuccinate synthase	NA	A0A2P1EKE7	Megavirus	36.7	8.6e-71
WP_011232940.1|3522674_3524039_-	replicative DNA helicase	NA	A0A1P8VVQ6	Streptococcus_phage	52.8	7.9e-123
