The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_017333	Staphylococcus aureus subsp. aureus ST398, complete genome	2872582	370474	417309	2872582	integrase,plate,terminase,capsid,protease,tail,head,holin,portal	Staphylococcus_phage(92.19%)	65	370364:370381	417540:417557
370364:370381	attL	ATCTTACAAGGGTGGGAT	NA	NA	NA	NA
WP_000264185.1|370474_371680_-|integrase	site-specific integrase	integrase	A7YGM7	Staphylococcus_virus	99.8	2.9e-222
WP_000191464.1|371790_372405_+	hypothetical protein	NA	M9QRQ8	Staphylococcus_phage	99.5	2.5e-105
WP_001795334.1|372401_372548_-	hypothetical protein	NA	A0A2I6PEK8	Staphylococcus_phage	100.0	1.2e-16
WP_000825948.1|372777_373362_-	hypothetical protein	NA	A0A2I6PD77	Staphylococcus_phage	100.0	1.4e-68
WP_000525004.1|373379_373841_-	hypothetical protein	NA	A0A2K9VBR7	Staphylococcus_phage	100.0	1.2e-83
WP_000333630.1|373853_374168_-	helix-turn-helix transcriptional regulator	NA	A0A0N9BAW4	Staphylococcus_phage	100.0	9.8e-53
WP_001121027.1|374319_374556_+	helix-turn-helix transcriptional regulator	NA	A0A2I6PD81	Staphylococcus_phage	100.0	1.5e-37
WP_001148544.1|374569_375346_+	Rha family transcriptional regulator	NA	A0A2I6PD87	Staphylococcus_phage	100.0	1.1e-140
WP_000939498.1|375373_375517_+	hypothetical protein	NA	W5R8I6	Staphylococcus_phage	100.0	2.5e-16
WP_000642492.1|375506_375716_-	hypothetical protein	NA	W5R9J5	Staphylococcus_phage	100.0	1.2e-30
WP_001025401.1|375771_376017_+	DUF2829 domain-containing protein	NA	A0A2I6PF15	Staphylococcus_phage	100.0	5.1e-41
WP_001128433.1|375985_376351_-	hypothetical protein	NA	A0A2I6PF07	Staphylococcus_phage	100.0	2.4e-63
WP_001124158.1|376644_376908_+	helix-turn-helix domain-containing protein	NA	A7TWG0	Staphylococcus_phage	97.7	6.3e-45
WP_001285954.1|376920_377082_+	DUF1270 domain-containing protein	NA	A7TWM3	Staphylococcus_phage	100.0	8.6e-21
WP_000174994.1|377160_377484_+	hypothetical protein	NA	A0A2I6PF12	Staphylococcus_phage	100.0	5.9e-53
WP_000985976.1|377498_377861_+	hypothetical protein	NA	A0A2I6PF03	Staphylococcus_phage	100.0	4.9e-56
WP_000762523.1|377857_379024_+	DUF2800 domain-containing protein	NA	B5WZM3	Staphylococcus_phage	98.5	5.0e-219
WP_000645042.1|379049_379607_+	DUF2815 family protein	NA	A0A2I6PF05	Staphylococcus_phage	100.0	1.8e-97
WP_078096488.1|379675_381628_+	DNA polymerase	NA	A0A2I6PF18	Staphylococcus_phage	99.1	0.0e+00
WP_000113974.1|381824_382226_+	PVL family protein	NA	A0A2I6PEL5	Staphylococcus_phage	100.0	1.2e-68
WP_000022727.1|382225_382480_+	DUF3310 domain-containing protein	NA	A0A2I6PEN5	Staphylococcus_phage	100.0	1.6e-42
WP_001802342.1|382479_382728_+	hypothetical protein	NA	A0A2I6PDB4	Staphylococcus_phage	95.1	1.3e-39
WP_000693989.1|382741_382948_+	hypothetical protein	NA	A0A2K9VBT9	Staphylococcus_phage	100.0	3.0e-34
WP_000695771.1|382950_383358_+	hypothetical protein	NA	M9NST1	Staphylococcus_phage	98.5	2.6e-74
WP_000983950.1|383354_383549_+	hypothetical protein	NA	A0A0U2A067	Staphylococcus_phage	96.8	1.4e-25
WP_000982714.1|383545_383983_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001105602.1|383979_384345_+	hypothetical protein	NA	A0A0F6N3K4	Staphylococcus_phage	97.3	7.4e-52
WP_001065067.1|384337_384586_+	DUF1024 family protein	NA	Q9B0F3	Staphylococcus_virus	93.9	1.7e-36
WP_000185680.1|384578_385115_+	dUTP diphosphatase	NA	A0A1P8L6E0	Staphylococcus_phage	100.0	2.1e-95
WP_000195803.1|385151_385358_+	DUF1381 domain-containing protein	NA	A0A0H3U2R7	Staphylococcus_phage	100.0	1.3e-29
WP_000592221.1|385354_385741_+	hypothetical protein	NA	A7TWI1	Staphylococcus_phage	100.0	1.0e-64
WP_000595260.1|385737_385890_+	transcriptional activator RinB	NA	A7TWI2	Staphylococcus_phage	100.0	2.6e-19
WP_000265253.1|385957_386158_+	DUF1514 family protein	NA	A0A2I6PEP5	Staphylococcus_phage	98.5	4.9e-26
WP_000884855.1|386445_388893_+	virulence-associated E family protein	NA	R4WAL1	Staphylococcus_phage	99.1	0.0e+00
WP_001801650.1|389001_389100_-	hypothetical protein	NA	A0A2I6PDP6	Staphylococcus_phage	100.0	3.7e-11
WP_000665203.1|389233_389524_+	VRR-NUC domain-containing protein	NA	A0A2I6PEN7	Staphylococcus_phage	100.0	6.5e-51
WP_078096486.1|389504_390872_+	DEAD/DEAH box helicase	NA	A0A2I6PE95	Staphylococcus_phage	99.1	8.1e-261
WP_000513702.1|390884_391322_+	transcriptional regulator	NA	B7T0I6	Staphylococcus_virus	100.0	6.1e-77
WP_000160693.1|391478_391793_+	HNH endonuclease	NA	A0A2I6PF37	Staphylococcus_phage	100.0	2.5e-56
WP_000778933.1|391920_392226_+|terminase	P27 family phage terminase small subunit	terminase	A0A2I6PEQ6	Staphylococcus_phage	100.0	2.9e-49
WP_000153550.1|392215_393907_+|terminase	terminase large subunit	terminase	A0A2I6PE99	Staphylococcus_phage	98.6	0.0e+00
WP_001100664.1|393911_395150_+|portal	phage portal protein	portal	A0A2I6PER5	Staphylococcus_phage	100.0	6.9e-235
WP_000061867.1|395133_395907_+|protease	Clp protease ClpP	protease	A0A2I6PEQ7	Staphylococcus_phage	99.6	9.2e-137
WP_001142738.1|395918_397082_+|capsid	phage major capsid protein	capsid	M9QQM0	Staphylococcus_phage	100.0	4.2e-218
WP_000050973.1|397150_397429_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2I6PEQ1	Staphylococcus_phage	100.0	2.1e-46
WP_000395503.1|397440_397773_+	hypothetical protein	NA	M9QX19	Staphylococcus_phage	99.1	1.4e-57
WP_000110018.1|397769_398171_+	hypothetical protein	NA	A0A0K1LL98	Staphylococcus_phage	99.2	5.2e-67
WP_001023808.1|398171_398567_+	DUF3168 domain-containing protein	NA	A0A0K1LKC0	Staphylococcus_phage	100.0	5.1e-67
WP_000807542.1|398601_399243_+|tail	tail protein	tail	A0A2I6PE59	Staphylococcus_phage	99.1	5.0e-120
WP_000169130.1|399334_399790_+	Ig domain-containing protein	NA	Q9B0D4	Staphylococcus_phage	98.7	3.1e-76
WP_000589167.1|399847_400198_+	hypothetical protein	NA	A0A2I6PEQ2	Staphylococcus_phage	100.0	1.1e-55
WP_000438833.1|400239_400398_+	hypothetical protein	NA	A0A2I6PES8	Staphylococcus_phage	100.0	1.2e-19
WP_001190533.1|406610_407435_+|tail	phage tail family protein	tail	A0A2I6PER3	Staphylococcus_phage	100.0	4.1e-159
WP_000384460.1|407443_409027_+|tail	phage tail protein	tail	Q4ZD01	Staphylococcus_virus	99.8	3.5e-308
WP_000179864.1|409026_409317_+	hypothetical protein	NA	R4WEC3	Staphylococcus_phage	100.0	2.1e-49
WP_000429556.1|409332_411243_+	hypothetical protein	NA	A0A2I6PF35	Staphylococcus_phage	99.2	0.0e+00
WP_000067142.1|411242_412709_+|plate	phage baseplate upper protein	plate	A0A2I6PES7	Staphylococcus_phage	99.4	8.4e-272
WP_001166598.1|412708_413098_+	DUF2977 domain-containing protein	NA	M9QYR4	Staphylococcus_phage	99.2	9.9e-63
WP_000916021.1|413090_413255_+	XkdX family protein	NA	Q4ZCZ6	Staphylococcus_virus	100.0	4.9e-24
WP_000466775.1|413300_413600_+	DUF2951 family protein	NA	M9QRV2	Staphylococcus_phage	98.0	5.9e-31
WP_000339141.1|413735_414038_+|holin	phage holin	holin	A0A2I6PF56	Staphylococcus_phage	100.0	3.1e-48
WP_000930254.1|414049_415504_+	N-acetylmuramoyl-L-alanine amidase	NA	A7TWL1	Staphylococcus_phage	96.9	1.8e-282
WP_000201920.1|416192_416372_+	hypothetical protein	NA	M9QYR8	Staphylococcus_phage	100.0	4.1e-24
WP_000455172.1|416393_416921_+	DUF4065 domain-containing protein	NA	M9QX37	Staphylococcus_phage	99.4	1.3e-97
WP_043854724.1|416892_417309_+	hypothetical protein	NA	M9QRV7	Staphylococcus_phage	99.3	5.4e-75
417540:417557	attR	ATCTTACAAGGGTGGGAT	NA	NA	NA	NA
>prophage 2
NC_017333	Staphylococcus aureus subsp. aureus ST398, complete genome	2872582	481428	493273	2872582	integrase	Staphylococcus_phage(33.33%)	14	484450:484470	497955:497975
WP_000264071.1|481428_482895_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	40.5	5.2e-96
WP_000424968.1|482919_484461_+	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	32.6	1.2e-23
484450:484470	attL	GAGTGGGAATAATTATATATA	NA	NA	NA	NA
WP_000592970.1|484554_485691_-|integrase	site-specific integrase	integrase	A0A1S5S7K9	Streptococcus_phage	42.5	1.7e-75
WP_000819103.1|485774_486560_-	helix-turn-helix transcriptional regulator	NA	A0A1S5S8T5	Streptococcus_phage	58.6	1.2e-09
WP_000494396.1|486676_486904_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000080597.1|486949_487210_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000773833.1|487256_487403_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001058503.1|487395_487620_+	hypothetical protein	NA	A0A1W6JPA6	Staphylococcus_phage	61.8	3.0e-16
WP_001103964.1|487620_487920_+	DUF1474 family protein	NA	Q4ZE75	Staphylococcus_phage	76.8	1.1e-37
WP_000985238.1|488010_490374_+	primase	NA	A0A2H4JCU9	uncultured_Caudovirales_phage	39.2	4.4e-137
WP_001081424.1|490795_491140_+	hypothetical protein	NA	A0A1W6JQD5	Staphylococcus_phage	65.2	9.4e-41
WP_000884055.1|491364_491571_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000657541.1|491557_492616_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000253082.1|492781_493273_+	hypothetical protein	NA	A0A2H4JB26	uncultured_Caudovirales_phage	39.2	6.7e-24
497955:497975	attR	GAGTGGGAATAATTATATATA	NA	NA	NA	NA
>prophage 3
NC_017333	Staphylococcus aureus subsp. aureus ST398, complete genome	2872582	818487	826307	2872582		Hokovirus(16.67%)	10	NA	NA
WP_000244415.1|818487_819543_-	two-component system sensor histidine kinase SaeS	NA	A0A1V0SGX0	Hokovirus	29.8	3.6e-14
WP_000149344.1|819542_820229_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_001037805.1|820203_820677_-	DoxX family protein	NA	NA	NA	NA	NA
WP_001093559.1|821017_821458_-	DM13 domain-containing protein	NA	NA	NA	NA	NA
WP_000637685.1|821738_822323_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001062967.1|822421_823135_-	7-carboxy-7-deazaguanine synthase QueE	NA	A0A1U9WRB6	Streptococcus_virus	43.5	5.0e-52
WP_000941336.1|823138_823558_-	6-carboxytetrahydropterin synthase QueD	NA	S4U060	uncultured_phage	28.7	6.3e-07
WP_000446724.1|823559_824228_-	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	57.5	9.6e-66
WP_000604516.1|824578_825172_+	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	44.0	3.1e-39
WP_001217786.1|825155_826307_+	anthranilate synthase component I family protein	NA	S4VNU7	Pandoravirus	36.1	2.1e-23
>prophage 4
NC_017333	Staphylococcus aureus subsp. aureus ST398, complete genome	2872582	838277	852593	2872582		uncultured_Caudovirales_phage(50.0%)	13	NA	NA
WP_000663034.1|838277_839336_+	histidinol-phosphate transaminase	NA	A0A0H3TLT9	Faustovirus	26.9	1.5e-20
WP_000197271.1|839494_840037_+	5'-3'-deoxyribonucleotidase	NA	NA	NA	NA	NA
WP_000429003.1|840773_841691_-	diacylglycerol kinase family lipid kinase	NA	A0A1V0SBJ0	Catovirus	22.0	2.8e-07
WP_014936998.1|841781_841889_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000193750.1|841960_843466_-	peptide MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	32.2	2.0e-58
WP_000930016.1|843805_844306_-	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	E7DN65	Pneumococcus_phage	66.2	2.7e-52
WP_001068490.1|844325_845192_-	DMT family transporter	NA	NA	NA	NA	NA
WP_000692521.1|845993_846392_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A2H4J545	uncultured_Caudovirales_phage	72.0	1.2e-52
WP_000855505.1|846354_848460_+	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A0A2H4J2N6	uncultured_Caudovirales_phage	91.7	0.0e+00
WP_000562498.1|848579_849551_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	A0A2H4J4P3	uncultured_Caudovirales_phage	91.3	4.2e-171
WP_000876311.1|849920_850892_+	ABC transporter permease	NA	A0A2H4IY97	uncultured_Caudovirales_phage	80.2	7.8e-141
WP_001245567.1|850878_851835_+	iron chelate uptake ABC transporter family permease subunit	NA	A0A2H4J116	uncultured_Caudovirales_phage	57.8	1.6e-05
WP_000616865.1|851831_852593_+	ABC transporter ATP-binding protein	NA	Q9EMR9	Amsacta_moorei_entomopoxvirus	30.1	7.2e-17
>prophage 5
NC_017333	Staphylococcus aureus subsp. aureus ST398, complete genome	2872582	992242	1015467	2872582	integrase	Streptococcus_phage(94.74%)	23	980699:980716	1019742:1019759
980699:980716	attL	GCGGGGCCCCAACACAGA	NA	NA	NA	NA
WP_000154905.1|992242_995896_+	helicase-exonuclease AddAB subunit AddA	NA	A7KV33	Bacillus_phage	24.7	7.0e-25
WP_000670757.1|996061_996964_+	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_000902814.1|997290_997680_+	YisL family protein	NA	NA	NA	NA	NA
WP_001291561.1|997944_999162_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1S5SEW7	Streptococcus_phage	100.0	3.7e-233
WP_000814511.1|999243_999447_-	excisionase	NA	A0A1S5SF07	Streptococcus_phage	100.0	4.0e-31
WP_000857133.1|999907_1000138_-	helix-turn-helix domain-containing protein	NA	A0A1S5SEX1	Streptococcus_phage	100.0	2.7e-36
WP_000804885.1|1000134_1000557_-	sigma-70 family RNA polymerase sigma factor	NA	A0A1S5SEW0	Streptococcus_phage	100.0	2.5e-72
WP_001227347.1|1001061_1001415_+	helix-turn-helix domain-containing protein	NA	A0A1S5SFA6	Streptococcus_phage	100.0	1.3e-58
WP_000336323.1|1001474_1001642_-	cysteine-rich KTR domain-containing protein	NA	D0R0F6	Streptococcus_phage	68.0	1.6e-14
WP_000691736.1|1001760_1003680_-	tetracycline resistance ribosomal protection protein Tet(M)	NA	A0A1S5SF82	Streptococcus_phage	99.5	0.0e+00
WP_001814923.1|1003695_1003812_-	tetracycline resistance determinant leader peptide	NA	NA	NA	NA	NA
WP_001224318.1|1004056_1004989_-	conjugal transfer protein	NA	A0A1S5SF22	Streptococcus_phage	99.4	3.1e-171
WP_000769868.1|1004985_1005987_-	lysozyme family protein	NA	A0A1S5SEZ8	Streptococcus_phage	100.0	5.0e-191
WP_000804748.1|1005983_1008161_-	membrane protein	NA	A0A1S5SF30	Streptococcus_phage	100.0	0.0e+00
WP_000331163.1|1008163_1010611_-	ATP-binding protein	NA	A0A1S5SF64	Streptococcus_phage	99.9	0.0e+00
WP_000506270.1|1010594_1011101_-	conjugal transfer protein	NA	A0A1S5SEX7	Streptococcus_phage	100.0	8.6e-91
WP_000342539.1|1011075_1011573_-	antirestriction protein ArdA	NA	A0A1S5SF25	Streptococcus_phage	100.0	1.7e-91
WP_001009056.1|1011689_1011911_-	hypothetical protein	NA	A0A1S5SEY0	Streptococcus_phage	100.0	4.3e-31
WP_000398286.1|1011953_1013159_-	replication initiation factor domain-containing protein	NA	A0A1S5SEX3	Streptococcus_phage	99.8	1.1e-232
WP_000879507.1|1013181_1013334_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000813488.1|1013336_1014722_-	DNA translocase FtsK	NA	A0A1S5SFB5	Streptococcus_phage	100.0	1.1e-265
WP_000985015.1|1014750_1015137_-	YdcP family protein	NA	A0A1S5SF96	Streptococcus_phage	100.0	3.0e-64
WP_000420682.1|1015152_1015467_-	YdcP family protein	NA	A0A1S5SF38	Streptococcus_phage	100.0	5.2e-54
1019742:1019759	attR	TCTGTGTTGGGGCCCCGC	NA	NA	NA	NA
>prophage 6
NC_017333	Staphylococcus aureus subsp. aureus ST398, complete genome	2872582	1042333	1094347	2872582	bacteriocin,protease,holin,tRNA	Streptococcus_phage(40.0%)	52	NA	NA
WP_000448934.1|1042333_1043323_-|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_000258003.1|1043617_1044013_+	transcriptional regulator Spx	NA	NA	NA	NA	NA
WP_001217731.1|1044383_1045103_+	adaptor protein MecA	NA	NA	NA	NA	NA
WP_000959279.1|1045223_1046210_+	competence protein CoiA	NA	NA	NA	NA	NA
WP_000082727.1|1046257_1048066_+	oligoendopeptidase F	NA	A0A1X9I5X5	Streptococcus_phage	24.4	1.2e-46
WP_000896695.1|1048525_1049332_-	DsbA family protein	NA	NA	NA	NA	NA
WP_000214070.1|1049354_1049720_-	truncated hemoglobin	NA	NA	NA	NA	NA
WP_000224612.1|1049823_1050417_-	CYTH domain-containing protein	NA	NA	NA	NA	NA
WP_001242104.1|1050602_1050950_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001077683.1|1050966_1051602_+	GTP pyrophosphokinase family protein	NA	NA	NA	NA	NA
WP_001270834.1|1051618_1052428_+	NAD kinase	NA	NA	NA	NA	NA
WP_000669942.1|1052424_1053279_+	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
WP_000062407.1|1053299_1054685_+	magnesium transporter	NA	NA	NA	NA	NA
WP_000395150.1|1054694_1056539_+	monovalent cation:proton antiporter family protein	NA	NA	NA	NA	NA
WP_000933200.1|1056816_1057587_+	enoyl-ACP reductase FabI	NA	NA	NA	NA	NA
WP_000933105.1|1057783_1058869_-	AI-2E family transporter	NA	NA	NA	NA	NA
WP_000570705.1|1059210_1060779_+	alanine:cation symporter family protein	NA	NA	NA	NA	NA
WP_000889181.1|1060920_1061679_+	esterase family protein	NA	NA	NA	NA	NA
WP_000600387.1|1061872_1062382_+	2'-5' RNA ligase family protein	NA	NA	NA	NA	NA
WP_001154224.1|1062494_1063685_-	MFS transporter	NA	NA	NA	NA	NA
WP_000258650.1|1063662_1064838_-	diglucosyl diacylglycerol synthase	NA	NA	NA	NA	NA
WP_000340124.1|1065268_1066753_+	UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--L- lysine ligase	NA	NA	NA	NA	NA
WP_072434963.1|1066733_1066994_+	YueH family protein	NA	NA	NA	NA	NA
WP_001049947.1|1066993_1068556_+	peptide chain release factor 3	NA	A0A1S5SF82	Streptococcus_phage	28.0	3.8e-36
WP_000928413.1|1068857_1069661_+	TerC family protein	NA	S5MAL1	Bacillus_phage	40.5	1.6e-30
WP_014937014.1|1069879_1072204_+|protease	serine protease	protease	W5SAB9	Pithovirus	27.4	2.1e-11
WP_000021872.1|1072220_1073579_+	TrkH family potassium uptake protein	NA	NA	NA	NA	NA
WP_000414168.1|1073717_1075229_+	bifunctional metallophosphatase/5'-nucleotidase	NA	NA	NA	NA	NA
WP_000287260.1|1075717_1076287_-	competence protein ComK	NA	NA	NA	NA	NA
WP_000876826.1|1076496_1076715_+	IDEAL domain-containing protein	NA	NA	NA	NA	NA
WP_000668814.1|1076795_1077782_-	lipoate--protein ligase	NA	NA	NA	NA	NA
WP_000214898.1|1077980_1078157_+	YkvS family protein	NA	NA	NA	NA	NA
WP_001033867.1|1078171_1078774_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_099119695.1|1079073_1079151_+|holin	putative holin-like toxin	holin	NA	NA	NA	NA
WP_000790905.1|1079785_1080070_+|bacteriocin	lactococcin 972 family bacteriocin	bacteriocin	NA	NA	NA	NA
WP_000870811.1|1080113_1082078_+|bacteriocin	bacteriocin-associated integral membrane family protein	bacteriocin	NA	NA	NA	NA
WP_000668623.1|1082080_1082401_+	YxeA family protein	NA	NA	NA	NA	NA
WP_000571192.1|1082397_1083039_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.7	1.0e-19
WP_001796515.1|1083126_1083417_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157958947.1|1083506_1083695_+	poly(glycerol-phosphate) alpha-glucosyltransferase	NA	NA	NA	NA	NA
WP_000766009.1|1083783_1084140_-	DoxX family protein	NA	NA	NA	NA	NA
WP_001081332.1|1084630_1085590_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001794249.1|1085638_1085770_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000867362.1|1085833_1086049_-	TM2 domain-containing protein	NA	NA	NA	NA	NA
WP_000620945.1|1086213_1086765_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000070966.1|1086815_1087754_-	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_000190616.1|1087935_1089297_+	isochorismate synthase MenF	NA	NA	NA	NA	NA
WP_000526673.1|1089283_1090957_+	2-succinyl-5-enolpyruvyl-6-hydroxy-3- cyclohexene-1-carboxylic-acid synthase	NA	NA	NA	NA	NA
WP_000150215.1|1090943_1091747_+	2-succinyl-6-hydroxy-2, 4-cyclohexadiene-1-carboxylate synthase	NA	NA	NA	NA	NA
WP_000184947.1|1091739_1092561_+	1,4-dihydroxy-2-naphthoyl-CoA synthase	NA	NA	NA	NA	NA
WP_000284455.1|1092798_1093128_-	staphostatin B	NA	NA	NA	NA	NA
WP_001088778.1|1093165_1094347_-|protease	cysteine protease staphopain B	protease	NA	NA	NA	NA
>prophage 7
NC_017333	Staphylococcus aureus subsp. aureus ST398, complete genome	2872582	1114130	1122603	2872582		Synechococcus_phage(33.33%)	9	NA	NA
WP_001807816.1|1114130_1114613_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	44.7	6.2e-22
WP_001010409.1|1114599_1115724_+	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_000174055.1|1115727_1116432_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	M4R1E8	Synechococcus_phage	42.1	2.1e-47
WP_000848351.1|1116431_1116695_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_000666799.1|1116696_1117368_+	phosphoribosylformylglycinamidine synthase I	NA	NA	NA	NA	NA
WP_000032750.1|1117360_1119550_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	39.4	1.3e-140
WP_000483707.1|1119528_1121013_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	31.7	8.5e-46
WP_000030815.1|1121005_1122034_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	41.1	2.9e-61
WP_000238668.1|1122036_1122603_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	40.1	2.7e-29
>prophage 8
NC_017333	Staphylococcus aureus subsp. aureus ST398, complete genome	2872582	1378776	1383964	2872582		Staphylococcus_phage(66.67%)	8	NA	NA
WP_001807853.1|1378776_1378974_+	hypothetical protein	NA	A0A1W6JNK0	Staphylococcus_phage	50.0	9.9e-11
WP_074347689.1|1379660_1379888_+	hypothetical protein	NA	A0A1W6JNK0	Staphylococcus_phage	72.1	1.9e-18
WP_001002341.1|1380188_1380395_+	hypothetical protein	NA	A0A2H4PQT0	Staphylococcus_phage	55.2	5.5e-12
WP_001788716.1|1381095_1381206_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000006110.1|1381598_1381784_+	hypothetical protein	NA	A0A0F6N3H3	Staphylococcus_phage	78.7	2.4e-19
WP_000477490.1|1382294_1382711_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000974166.1|1383142_1383727_-	ATP-binding protein	NA	A0A059NT77	Lactococcus_phage	42.6	4.4e-30
WP_001215406.1|1383790_1383964_-	hypothetical protein	NA	A0A059NT83	Lactococcus_phage	51.9	3.6e-09
>prophage 9
NC_017333	Staphylococcus aureus subsp. aureus ST398, complete genome	2872582	1560497	1648879	2872582	integrase,plate,capsid,terminase,protease,tail,head,holin,tRNA,portal	Staphylococcus_phage(74.03%)	105	1595434:1595451	1646112:1646129
WP_000858789.1|1560497_1561790_-|tRNA	asparagine--tRNA ligase	tRNA	A0A2P1EMB4	Moumouvirus	30.0	1.9e-54
WP_000525056.1|1562111_1564805_-	ATP-dependent helicase	NA	A0A1X9I5C8	Streptococcus_phage	34.3	1.4e-46
WP_000049916.1|1564828_1565800_-	biotin--[acetyl-CoA-carboxylase] ligase	NA	NA	NA	NA	NA
WP_000361538.1|1565786_1566989_-|tRNA	CCA tRNA nucleotidyltransferase	tRNA	H7BUW3	unidentified_phage	43.3	7.1e-35
WP_000690021.1|1566993_1568136_-	N-acetyl-alpha-D-glucosaminyl L-malate synthase BshA	NA	NA	NA	NA	NA
WP_000839926.1|1568379_1568697_-	nucleotide pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_031774809.1|1569031_1569712_-	zinc metallopeptidase	NA	NA	NA	NA	NA
WP_000154694.1|1569783_1570371_-	DUF1405 domain-containing protein	NA	NA	NA	NA	NA
WP_000005219.1|1570360_1570936_-	YpiB family protein	NA	G3MAV7	Bacillus_virus	27.2	9.3e-09
WP_000389530.1|1570949_1572194_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000245908.1|1572200_1573499_-	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_000776339.1|1573508_1574573_-	3-dehydroquinate synthase	NA	NA	NA	NA	NA
WP_001269939.1|1574598_1575765_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	32.3	2.6e-34
WP_000789522.1|1576151_1576352_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000442480.1|1576557_1577007_-	nucleoside-diphosphate kinase	NA	D2E8E1	Anguillid_herpesvirus	43.8	2.4e-28
WP_001096479.1|1577098_1578058_-	polyprenyl synthetase family protein	NA	A0A1V0SE37	Indivirus	24.4	1.3e-10
WP_000774681.1|1578059_1578785_-	demethylmenaquinone methyltransferase	NA	NA	NA	NA	NA
WP_000450555.1|1578787_1579360_-	heptaprenyl diphosphate synthase component 1	NA	NA	NA	NA	NA
WP_001043863.1|1579790_1580063_-	HU family DNA-binding protein	NA	A7KV42	Bacillus_phage	73.3	4.2e-28
WP_000161737.1|1580233_1581232_-	NAD(P)H-dependent glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_000165530.1|1581248_1582559_-	ribosome biogenesis GTPase Der	NA	NA	NA	NA	NA
WP_000133960.1|1582780_1583956_-	30S ribosomal protein S1	NA	NA	NA	NA	NA
WP_001825307.1|1584212_1584404_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001807839.1|1584520_1584637_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000644390.1|1584667_1585327_-	(d)CMP kinase	NA	NA	NA	NA	NA
WP_000681742.1|1585403_1586372_+	asparaginase	NA	NA	NA	NA	NA
WP_001174257.1|1586486_1587473_-	YpdA family putative bacillithiol disulfide reductase	NA	NA	NA	NA	NA
WP_001807838.1|1587633_1587750_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000069278.1|1587875_1589330_-	elastin-binding protein EbpS	NA	NA	NA	NA	NA
WP_000902104.1|1589482_1590862_-	ATP-dependent DNA helicase RecQ	NA	L7RCS0	Acanthamoeba_polyphaga_moumouvirus	33.3	6.4e-56
WP_001163801.1|1590851_1591805_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001151997.1|1591912_1592161_+	ferredoxin	NA	A0A127AYY7	Bacillus_phage	48.0	8.3e-15
WP_001186909.1|1592266_1592812_-	ECF transporter S component	NA	NA	NA	NA	NA
WP_001825312.1|1593215_1594148_-	DUF1672 domain-containing protein	NA	NA	NA	NA	NA
WP_001807840.1|1594602_1595499_-	DUF1672 domain-containing protein	NA	NA	NA	NA	NA
1595434:1595451	attL	TTCCATCGTGGAACATCC	NA	NA	NA	NA
WP_001825313.1|1595553_1596483_-	DUF1672 domain-containing protein	NA	NA	NA	NA	NA
WP_000126130.1|1596573_1596789_-	hypothetical protein	NA	A0ZS61	Staphylococcus_virus	100.0	2.0e-25
WP_043854724.1|1597004_1597421_-	hypothetical protein	NA	M9QRV7	Staphylococcus_phage	99.3	5.4e-75
WP_000201920.1|1597940_1598120_-	hypothetical protein	NA	M9QYR8	Staphylococcus_phage	100.0	4.1e-24
WP_001148129.1|1599020_1600466_-	SH3 domain-containing protein	NA	Q4ZB16	Staphylococcus_virus	96.9	1.7e-288
WP_000354117.1|1600446_1600884_-|holin	phage holin	holin	M9QTA6	Staphylococcus_phage	97.9	3.8e-71
WP_000466774.1|1601019_1601319_-	DUF2951 family protein	NA	M9QRV2	Staphylococcus_phage	100.0	2.6e-31
WP_000916022.1|1601364_1601529_-	XkdX family protein	NA	M9QX31	Staphylococcus_phage	98.1	1.9e-23
WP_000378889.1|1601521_1601914_-	DUF2977 domain-containing protein	NA	Q4ZCZ7	Staphylococcus_virus	92.4	8.4e-54
WP_000466776.1|1601832_1602138_-	DUF2951 family protein	NA	M9QRV2	Staphylococcus_phage	97.8	8.9e-27
WP_000916021.1|1602183_1602348_-	XkdX family protein	NA	Q4ZCZ6	Staphylococcus_virus	100.0	4.9e-24
WP_001166606.1|1602340_1602730_-	DUF2977 domain-containing protein	NA	Q4ZCZ7	Staphylococcus_virus	95.3	5.4e-61
WP_000067142.1|1602801_1604268_-|plate	phage baseplate upper protein	plate	A0A2I6PES7	Staphylococcus_phage	99.4	8.4e-272
WP_000429556.1|1604267_1606178_-	hypothetical protein	NA	A0A2I6PF35	Staphylococcus_phage	99.2	0.0e+00
WP_000179864.1|1606193_1606484_-	hypothetical protein	NA	R4WEC3	Staphylococcus_phage	100.0	2.1e-49
WP_000384460.1|1606483_1608067_-|tail	phage tail protein	tail	Q4ZD01	Staphylococcus_virus	99.8	3.5e-308
WP_001190533.1|1608075_1608900_-|tail	phage tail family protein	tail	A0A2I6PER3	Staphylococcus_phage	100.0	4.1e-159
WP_000438833.1|1615112_1615271_-	hypothetical protein	NA	A0A2I6PES8	Staphylococcus_phage	100.0	1.2e-19
WP_000589167.1|1615312_1615663_-	hypothetical protein	NA	A0A2I6PEQ2	Staphylococcus_phage	100.0	1.1e-55
WP_000169130.1|1615720_1616176_-	Ig domain-containing protein	NA	Q9B0D4	Staphylococcus_phage	98.7	3.1e-76
WP_000807542.1|1616267_1616909_-|tail	tail protein	tail	A0A2I6PE59	Staphylococcus_phage	99.1	5.0e-120
WP_001023808.1|1616943_1617339_-	DUF3168 domain-containing protein	NA	A0A0K1LKC0	Staphylococcus_phage	100.0	5.1e-67
WP_000110018.1|1617339_1617741_-	hypothetical protein	NA	A0A0K1LL98	Staphylococcus_phage	99.2	5.2e-67
WP_000395503.1|1617737_1618070_-	hypothetical protein	NA	M9QX19	Staphylococcus_phage	99.1	1.4e-57
WP_000050973.1|1618081_1618360_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2I6PEQ1	Staphylococcus_phage	100.0	2.1e-46
WP_001142738.1|1618428_1619592_-|capsid	phage major capsid protein	capsid	M9QQM0	Staphylococcus_phage	100.0	4.2e-218
WP_000061867.1|1619603_1620377_-|protease	Clp protease ClpP	protease	A0A2I6PEQ7	Staphylococcus_phage	99.6	9.2e-137
WP_001100664.1|1620360_1621599_-|portal	phage portal protein	portal	A0A2I6PER5	Staphylococcus_phage	100.0	6.9e-235
WP_000153552.1|1621603_1623295_-|terminase	terminase large subunit	terminase	A0A2I6PE99	Staphylococcus_phage	98.8	0.0e+00
WP_000778933.1|1623284_1623590_-|terminase	P27 family phage terminase small subunit	terminase	A0A2I6PEQ6	Staphylococcus_phage	100.0	2.9e-49
WP_000160693.1|1623717_1624032_-	HNH endonuclease	NA	A0A2I6PF37	Staphylococcus_phage	100.0	2.5e-56
WP_014532488.1|1624093_1624627_-	transcriptional regulator	NA	A0A2I6PEN3	Staphylococcus_phage	99.3	1.9e-72
WP_001793488.1|1624639_1626007_-	DEAD/DEAH box helicase	NA	A0A2I6PE95	Staphylococcus_phage	100.0	1.7e-263
WP_000665203.1|1625987_1626278_-	VRR-NUC domain-containing protein	NA	A0A2I6PEN7	Staphylococcus_phage	100.0	6.5e-51
WP_001801650.1|1626411_1626510_+	hypothetical protein	NA	A0A2I6PDP6	Staphylococcus_phage	100.0	3.7e-11
WP_000884855.1|1626618_1629066_-	virulence-associated E family protein	NA	R4WAL1	Staphylococcus_phage	99.1	0.0e+00
WP_000265253.1|1629353_1629554_-	DUF1514 family protein	NA	A0A2I6PEP5	Staphylococcus_phage	98.5	4.9e-26
WP_000595260.1|1629621_1629774_-	transcriptional activator RinB	NA	A7TWI2	Staphylococcus_phage	100.0	2.6e-19
WP_000592221.1|1629770_1630157_-	hypothetical protein	NA	A7TWI1	Staphylococcus_phage	100.0	1.0e-64
WP_000195803.1|1630153_1630360_-	DUF1381 domain-containing protein	NA	A0A0H3U2R7	Staphylococcus_phage	100.0	1.3e-29
WP_000185680.1|1630396_1630933_-	dUTP diphosphatase	NA	A0A1P8L6E0	Staphylococcus_phage	100.0	2.1e-95
WP_001065067.1|1630925_1631174_-	DUF1024 family protein	NA	Q9B0F3	Staphylococcus_virus	93.9	1.7e-36
WP_001105602.1|1631166_1631532_-	hypothetical protein	NA	A0A0F6N3K4	Staphylococcus_phage	97.3	7.4e-52
WP_000982714.1|1631528_1631966_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000983950.1|1631962_1632157_-	hypothetical protein	NA	A0A0U2A067	Staphylococcus_phage	96.8	1.4e-25
WP_000695771.1|1632153_1632561_-	hypothetical protein	NA	M9NST1	Staphylococcus_phage	98.5	2.6e-74
WP_000693989.1|1632563_1632770_-	hypothetical protein	NA	A0A2K9VBT9	Staphylococcus_phage	100.0	3.0e-34
WP_001802342.1|1632783_1633032_-	hypothetical protein	NA	A0A2I6PDB4	Staphylococcus_phage	95.1	1.3e-39
WP_000022727.1|1633031_1633286_-	DUF3310 domain-containing protein	NA	A0A2I6PEN5	Staphylococcus_phage	100.0	1.6e-42
WP_000113974.1|1633285_1633687_-	PVL family protein	NA	A0A2I6PEL5	Staphylococcus_phage	100.0	1.2e-68
WP_078096488.1|1633883_1635836_-	DNA polymerase	NA	A0A2I6PF18	Staphylococcus_phage	99.1	0.0e+00
WP_000645042.1|1635904_1636462_-	DUF2815 family protein	NA	A0A2I6PF05	Staphylococcus_phage	100.0	1.8e-97
WP_000762524.1|1636487_1637654_-	DUF2800 domain-containing protein	NA	Q8SDR9	Staphylococcus_virus	99.7	9.1e-221
WP_000985976.1|1637650_1638013_-	hypothetical protein	NA	A0A2I6PF03	Staphylococcus_phage	100.0	4.9e-56
WP_000174994.1|1638027_1638351_-	hypothetical protein	NA	A0A2I6PF12	Staphylococcus_phage	100.0	5.9e-53
WP_001285954.1|1638429_1638591_-	DUF1270 domain-containing protein	NA	A7TWM3	Staphylococcus_phage	100.0	8.6e-21
WP_001124158.1|1638603_1638867_-	helix-turn-helix domain-containing protein	NA	A7TWG0	Staphylococcus_phage	97.7	6.3e-45
WP_001128433.1|1639160_1639526_+	hypothetical protein	NA	A0A2I6PF07	Staphylococcus_phage	100.0	2.4e-63
WP_001025401.1|1639494_1639740_-	DUF2829 domain-containing protein	NA	A0A2I6PF15	Staphylococcus_phage	100.0	5.1e-41
WP_000642492.1|1639795_1640005_+	hypothetical protein	NA	W5R9J5	Staphylococcus_phage	100.0	1.2e-30
WP_000939498.1|1639994_1640138_-	hypothetical protein	NA	W5R8I6	Staphylococcus_phage	100.0	2.5e-16
WP_000435360.1|1640152_1640596_-	hypothetical protein	NA	W5R971	Staphylococcus_phage	100.0	1.5e-75
WP_000213811.1|1640643_1640856_-	helix-turn-helix transcriptional regulator	NA	A7TWF1	Staphylococcus_phage	100.0	1.6e-30
WP_000511091.1|1641007_1641739_+	helix-turn-helix transcriptional regulator	NA	S4SVC5	Staphylococcus_phage	98.8	2.9e-132
WP_000705240.1|1641809_1641992_+	hypothetical protein	NA	A0A2I6PDR4	Staphylococcus_phage	100.0	5.3e-27
WP_000173647.1|1641988_1643185_+|integrase	site-specific integrase	integrase	A0A2I6PEN0	Staphylococcus_phage	99.7	9.7e-218
WP_014532489.1|1643227_1645255_-	hypothetical protein	NA	B5WZK7	Staphylococcus_phage	95.3	2.7e-111
WP_001825329.1|1645247_1646177_-	DUF1672 domain-containing protein	NA	NA	NA	NA	NA
1646112:1646129	attR	TTCCATCGTGGAACATCC	NA	NA	NA	NA
WP_000987760.1|1646421_1648173_-	two-component system sensor histidine kinase SrrB	NA	A0A1V0SGX0	Hokovirus	33.3	1.3e-21
WP_000064078.1|1648153_1648879_-	two-component system response regulator SrrA	NA	W8CYM9	Bacillus_phage	43.0	3.5e-45
>prophage 10
NC_017333	Staphylococcus aureus subsp. aureus ST398, complete genome	2872582	1704001	1712313	2872582	tRNA	Staphylococcus_phage(16.67%)	7	NA	NA
WP_001213908.1|1704001_1704787_-	metal ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.3	8.0e-19
WP_000924214.1|1704912_1705803_-	deoxyribonuclease IV	NA	A0A2H4UU70	Bodo_saltans_virus	33.1	2.0e-26
WP_001062170.1|1705812_1707159_-	DEAD/DEAH box helicase	NA	A0A1V0SIR5	Klosneuvirus	33.7	3.4e-54
WP_000683941.1|1707272_1708373_-	Nif3-like dinuclear metal center hexameric protein	NA	A0A1S5V250	Saudi_moumouvirus	30.6	1.0e-08
WP_000624563.1|1708375_1709053_-|tRNA	tRNA (adenine-N(1))-methyltransferase	tRNA	NA	NA	NA	NA
WP_001283055.1|1709183_1710290_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	38.1	1.1e-37
WP_001217255.1|1710513_1712313_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	36.0	3.5e-54
>prophage 11
NC_017333	Staphylococcus aureus subsp. aureus ST398, complete genome	2872582	1781737	1790780	2872582	tRNA	uncultured_Mediterranean_phage(50.0%)	7	NA	NA
WP_000364542.1|1781737_1782256_-	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	46.5	5.6e-29
WP_000595008.1|1782277_1784551_-	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	29.3	2.1e-64
WP_000749801.1|1784753_1787033_-	protein translocase subunit SecDF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	35.8	1.8e-31
WP_001160682.1|1787307_1787568_-	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	35.3	8.2e-05
WP_001112045.1|1787586_1788726_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	44.7	5.4e-85
WP_001019177.1|1788748_1789774_-|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_001005766.1|1789775_1790780_-	Holliday junction branch migration DNA helicase RuvB	NA	B3GAM6	uncultured_virus	29.1	1.7e-05
>prophage 12
NC_017333	Staphylococcus aureus subsp. aureus ST398, complete genome	2872582	1925432	1985591	2872582	transposase,protease	Staphylococcus_phage(83.33%)	70	NA	NA
WP_000526541.1|1925432_1926386_+	TIGR01212 family radical SAM protein	NA	A0A2H4PQV5	Staphylococcus_phage	99.3	6.4e-79
WP_000764426.1|1926382_1926946_+	class I SAM-dependent methyltransferase	NA	A0A2H4PQV0	Staphylococcus_phage	95.7	7.3e-99
WP_000757543.1|1927064_1927466_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000266096.1|1928038_1928866_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_014937042.1|1928868_1928988_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001196354.1|1929099_1930101_+	proline dehydrogenase	NA	A0A2H4PQT6	Staphylococcus_phage	99.7	9.0e-185
WP_001008555.1|1930228_1930687_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	97.4	4.1e-68
WP_001159034.1|1930699_1931881_-	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	99.7	1.9e-226
WP_000493892.1|1931891_1932524_-	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	99.5	1.7e-112
WP_000077346.1|1932530_1933574_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	99.1	3.1e-196
WP_001261672.1|1934054_1935557_-	FAD/NAD(P)-binding protein	NA	A0A2H4PQX2	Staphylococcus_phage	98.6	5.0e-30
WP_000221190.1|1936207_1936522_+	winged helix-turn-helix transcriptional regulator	NA	A0A2H4PQT4	Staphylococcus_phage	98.1	1.3e-52
WP_000989103.1|1936521_1937814_+	arsenite efflux transporter membrane subunit ArsB	NA	A0A2H4PQU3	Staphylococcus_phage	94.7	7.5e-216
WP_001032832.1|1937900_1938755_-	glucosaminidase domain-containing protein	NA	Q4ZCC7	Staphylococcus_virus	38.6	9.8e-39
WP_000384171.1|1939030_1939255_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000671058.1|1939453_1939924_+	RNA polymerase sigma factor	NA	A0A2H4PQT5	Staphylococcus_phage	84.6	5.0e-69
WP_001153741.1|1940036_1940480_+	competence protein ComK	NA	NA	NA	NA	NA
WP_001030474.1|1940466_1940910_-	hypothetical protein	NA	A0A2H4PQT8	Staphylococcus_phage	77.9	1.4e-49
WP_001168915.1|1941207_1941843_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_000492903.1|1942009_1942630_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_001096494.1|1943192_1943906_-	transaldolase	NA	M1PR54	Cyanophage	35.3	5.5e-19
WP_000091443.1|1944164_1944467_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001200546.1|1944721_1945087_+	fluoride efflux transporter CrcB	NA	A0A2H4PQR0	Staphylococcus_phage	98.3	6.9e-58
WP_000623484.1|1945083_1945437_+	CrcB family protein	NA	A0A2H4PQQ7	Staphylococcus_phage	82.1	2.3e-18
WP_000453302.1|1945686_1946520_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	98.9	1.7e-157
WP_000366160.1|1946731_1947640_-	NERD domain-containing protein	NA	A0A2H4PQQ8	Staphylococcus_phage	99.3	1.3e-137
WP_000933822.1|1947764_1948958_-	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	99.7	1.9e-218
WP_000109913.1|1949329_1950922_+	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	99.6	0.0e+00
WP_016187361.1|1951218_1951965_-	S9 family peptidase	NA	A0A2H4PQM6	Staphylococcus_phage	98.0	7.8e-141
WP_000672013.1|1951969_1952443_-	nucleoside triphosphatase YtkD	NA	A0A2H4PQM4	Staphylococcus_phage	98.7	7.2e-84
WP_000718107.1|1952508_1952766_+	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	100.0	7.2e-46
WP_000778553.1|1952762_1953764_-	o-succinylbenzoate synthase	NA	A0A2H4PQM0	Staphylococcus_phage	86.5	3.3e-163
WP_000348381.1|1953768_1955247_-	o-succinylbenzoate--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	95.5	6.7e-277
WP_016187363.1|1955405_1955861_-	DUF4909 domain-containing protein	NA	A0A2H4PQN7	Staphylococcus_phage	96.6	8.3e-77
WP_078096487.1|1956684_1957158_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	45.0	8.7e-29
WP_001085423.1|1957138_1957669_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_000166623.1|1957780_1958143_-	cystatin-like fold lipoprotein	NA	NA	NA	NA	NA
WP_000850646.1|1958189_1958783_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000247482.1|1958788_1959817_-	CHAP domain-containing protein	NA	NA	NA	NA	NA
WP_000875438.1|1959806_1961738_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000274938.1|1961837_1962239_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001251196.1|1962243_1963602_-	cell division protein FtsK	NA	A0A1S5SFB5	Streptococcus_phage	30.1	2.7e-46
WP_000696096.1|1963606_1963939_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000990409.1|1963935_1964166_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000217371.1|1964169_1964388_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000364354.1|1964399_1966895_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_000358151.1|1966929_1967319_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000369240.1|1967324_1967585_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001225822.1|1967589_1968666_-	conjugal transfer protein	NA	NA	NA	NA	NA
WP_001059817.1|1968740_1969103_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000019150.1|1969282_1970422_-	replication initiation factor domain-containing protein	NA	NA	NA	NA	NA
WP_001007543.1|1970587_1971013_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000595049.1|1971034_1971358_-	DUF961 family protein	NA	NA	NA	NA	NA
WP_000070644.1|1972369_1973365_+	DUF4352 domain-containing protein	NA	A0A2H4PQN2	Staphylococcus_phage	94.8	1.3e-69
WP_000669036.1|1973440_1974067_+	hypothetical protein	NA	A0A2H4PQM7	Staphylococcus_phage	84.1	9.9e-81
WP_000627549.1|1974107_1974452_+	DUF3969 family protein	NA	A0A2H4PQN6	Staphylococcus_phage	96.5	5.1e-55
WP_000414230.1|1974549_1975122_+	hypothetical protein	NA	A0A2H4PQN4	Staphylococcus_phage	93.1	3.5e-24
WP_000864133.1|1975319_1975877_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A2H4PQN8	Staphylococcus_phage	98.1	1.1e-78
WP_000375476.1|1976247_1976424_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000070813.1|1976434_1976818_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000196442.1|1977266_1977548_-|transposase	IS3 family transposase	transposase	A0A0C5AJ30	Paenibacillus_phage	63.4	3.2e-23
WP_000731425.1|1977790_1978234_-	DUF1433 domain-containing protein	NA	NA	NA	NA	NA
WP_000747800.1|1978233_1978677_-	DUF1433 domain-containing protein	NA	NA	NA	NA	NA
WP_000221417.1|1979211_1981635_+	polysaccharide lyase 8 family protein	NA	NA	NA	NA	NA
WP_001034579.1|1981760_1982138_-	DUF1433 domain-containing protein	NA	NA	NA	NA	NA
WP_000439997.1|1982346_1982790_-	DUF1433 domain-containing protein	NA	NA	NA	NA	NA
WP_000877848.1|1982832_1983138_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014532497.1|1983207_1983597_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000566444.1|1983576_1984221_-	ATP-binding protein	NA	A0A059NT77	Lactococcus_phage	46.6	4.6e-49
WP_001215402.1|1984355_1985591_-|transposase	IS21 family transposase	transposase	A0A059NT83	Lactococcus_phage	49.1	2.8e-103
>prophage 13
NC_017333	Staphylococcus aureus subsp. aureus ST398, complete genome	2872582	2067352	2109840	2872582	integrase,protease,transposase,tRNA	Bacillus_virus(27.27%)	38	2073269:2073284	2111715:2111730
WP_000545368.1|2067352_2068780_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB	tRNA	NA	NA	NA	NA
WP_000027924.1|2068792_2070250_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA	tRNA	NA	NA	NA	NA
WP_000170162.1|2070251_2070554_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC	tRNA	NA	NA	NA	NA
WP_000957030.1|2070920_2072459_+	sodium/proline symporter PutP	NA	NA	NA	NA	NA
WP_000831695.1|2072547_2073747_-	CamS family sex pheromone protein	NA	NA	NA	NA	NA
2073269:2073284	attL	TTTTCTGCAATCTTTT	NA	NA	NA	NA
WP_000774571.1|2073759_2075763_-	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	36.1	4.4e-114
WP_000992924.1|2075766_2077959_-	DNA helicase PcrA	NA	A7KV33	Bacillus_phage	42.2	1.0e-135
WP_000272065.1|2077955_2078648_-	heptaprenylglyceryl phosphate synthase	NA	NA	NA	NA	NA
WP_001165363.1|2078819_2079122_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000572878.1|2079230_2080526_-	adenylosuccinate lyase	NA	A0A1B3B081	Gordonia_phage	32.9	1.6e-16
WP_000827738.1|2081374_2082541_+|protease	cysteine protease staphopain A	protease	NA	NA	NA	NA
WP_000434536.1|2082571_2082895_+	staphostatin A	NA	NA	NA	NA	NA
WP_000669861.1|2083187_2083361_-	NETI motif-containing protein	NA	NA	NA	NA	NA
WP_000011542.1|2083341_2083944_-	DUF2179 domain-containing protein	NA	NA	NA	NA	NA
WP_000040870.1|2084213_2085035_-	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	53.1	6.1e-70
WP_000284428.1|2085027_2086497_-	nicotinate phosphoribosyltransferase	NA	G3MA18	Bacillus_virus	44.9	1.7e-107
WP_000897642.1|2086680_2087757_+	nitric oxide synthase oxygenase	NA	NA	NA	NA	NA
WP_001177819.1|2087776_2088571_+	prephenate dehydratase	NA	NA	NA	NA	NA
WP_001802312.1|2088642_2088750_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000323172.1|2088760_2090323_-	SLC13 family permease	NA	NA	NA	NA	NA
WP_000275718.1|2090527_2091625_-	pectate lyase	NA	U5PWM6	Bacillus_phage	34.6	3.3e-47
WP_000149686.1|2091996_2092557_+	cysteine hydrolase	NA	G3MA16	Bacillus_virus	41.2	2.0e-32
WP_001140871.1|2092609_2093539_+	manganese-dependent inorganic pyrophosphatase	NA	NA	NA	NA	NA
WP_001826057.1|2093731_2093905_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001021224.1|2093956_2095336_+	aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_000181321.1|2095455_2096484_-	lactonase family protein	NA	NA	NA	NA	NA
WP_001284658.1|2096943_2097324_-	penicillinase repressor BlaI	NA	NA	NA	NA	NA
WP_001096367.1|2097313_2099071_-	beta-lactam sensor/signal transducer BlaR1	NA	NA	NA	NA	NA
WP_000733622.1|2099177_2100023_+	penicillin-hydrolyzing class A beta-lactamase BlaZ	NA	A0A1B0VBP7	Salmonella_phage	33.9	4.4e-31
WP_000612779.1|2100336_2100747_+	YolD-like family protein	NA	U3PG23	Staphylococcus_phage	53.5	3.1e-30
WP_000368919.1|2100789_2102160_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000410574.1|2102164_2102530_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_000026850.1|2102538_2104602_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_000706213.1|2104604_2105717_-|integrase	tyrosine-type recombinase/integrase	integrase	P97010	Streptococcus_pyogenes_phage	31.6	1.7e-11
WP_000267034.1|2106263_2106437_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001188070.1|2106887_2107928_+	linear amide C-N hydrolase	NA	NA	NA	NA	NA
WP_078055982.1|2108819_2109356_-|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	43.6	7.6e-29
WP_000746371.1|2109336_2109840_-|transposase	transposase	transposase	NA	NA	NA	NA
2111715:2111730	attR	TTTTCTGCAATCTTTT	NA	NA	NA	NA
