The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_012004	Streptococcus uberis 0140J, complete genome	1852352	150949	158266	1852352		Streptococcus_phage(57.14%)	9	NA	NA
WP_080502293.1|150949_151237_-	type II toxin-antitoxin system death-on-curing family toxin	NA	D0R0D2	Streptococcus_phage	64.2	3.6e-30
WP_012657702.1|151233_151491_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	A0A1X9I6A0	Streptococcus_phage	71.1	1.9e-25
WP_012657704.1|151683_152934_-	toxic anion resistance protein	NA	M1PLC8	Streptococcus_phage	65.9	8.2e-127
WP_012657705.1|152942_153803_-	hypothetical protein	NA	M1PFV6	Streptococcus_phage	37.8	1.5e-26
WP_012657706.1|154157_155450_+	adenylosuccinate synthase	NA	G5CQQ4	Megavirus	36.7	8.6e-71
WP_012657707.1|155573_155747_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012657708.1|155828_156185_+	DUF2200 domain-containing protein	NA	NA	NA	NA	NA
WP_012657709.1|156411_157455_+	BMP family protein	NA	A0A0A7DN02	Lactobacillus_phage	37.7	6.3e-56
WP_012657710.1|157492_158266_-	glycyl-radical enzyme activating protein	NA	B3RGQ1	Escherichia_phage	31.4	3.4e-06
>prophage 2
NC_012004	Streptococcus uberis 0140J, complete genome	1852352	428292	442949	1852352		Streptococcus_phage(85.71%)	20	NA	NA
WP_012657970.1|428292_429057_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.1	3.3e-17
WP_012657971.1|429056_429767_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.5	7.4e-16
WP_012657972.1|429836_430499_+	CBS domain-containing protein	NA	M1NSC5	Streptococcus_phage	57.9	2.7e-60
WP_012657973.1|430582_431218_+	dTMP kinase	NA	M1PSC7	Streptococcus_phage	63.8	2.3e-69
WP_012657974.1|431233_432109_+	DNA polymerase III subunit delta'	NA	M1NSC1	Streptococcus_phage	53.5	1.5e-79
WP_012657975.1|432105_432906_+	signal peptidase II	NA	NA	NA	NA	NA
WP_012657976.1|432895_433249_+	DNA replication initiation control protein YabA	NA	M1PFV3	Streptococcus_phage	57.5	2.3e-26
WP_012657977.1|433226_434090_+	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	72.4	6.5e-115
WP_012657978.1|434215_434611_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012657979.1|434644_435277_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012657980.1|435400_436495_+	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	76.9	1.5e-161
WP_012657981.1|436510_437059_+	N-acetyltransferase	NA	M1PSC3	Streptococcus_phage	53.9	3.3e-48
WP_012657982.1|437116_438292_+	phosphoglycerate dehydrogenase	NA	M1NSB9	Streptococcus_phage	77.4	1.3e-171
WP_012657983.1|438340_438817_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	54.2	4.5e-41
WP_012657984.1|438819_439173_+	arsenate reductase family protein	NA	M1PLC0	Streptococcus_phage	61.7	7.2e-36
WP_012657985.1|439205_440108_-	cation transporter	NA	M1Q1N9	Streptococcus_phage	48.3	2.9e-73
WP_012657986.1|440505_440922_-	VOC family protein	NA	NA	NA	NA	NA
WP_012657987.1|440943_441318_-	glyoxalase/bleomycin resistance/extradiol dioxygenase family protein	NA	NA	NA	NA	NA
WP_012657988.1|441457_442120_-	DNA alkylation repair protein	NA	NA	NA	NA	NA
WP_012657989.1|442121_442949_-	exodeoxyribonuclease III	NA	M1PSC0	Streptococcus_phage	78.4	1.5e-124
>prophage 4
NC_012004	Streptococcus uberis 0140J, complete genome	1852352	689852	698905	1852352		Streptococcus_phage(57.14%)	8	NA	NA
WP_041817757.1|689852_692030_-	LTA synthase family protein	NA	W6LM83	Streptococcus_phage	68.1	3.3e-264
WP_012658232.1|692164_693328_+	class I SAM-dependent rRNA methyltransferase	NA	W6LLI2	Streptococcus_phage	64.6	6.9e-136
WP_012658233.1|693324_694005_+	type I 3-dehydroquinate dehydratase	NA	W6LP76	Streptococcus_phage	72.9	3.2e-93
WP_012658234.1|694099_695266_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	33.9	7.9e-39
WP_012658235.1|695329_695668_+	YlbF/YmcA family competence regulator	NA	A0A1X9I5Y8	Streptococcus_phage	42.9	1.5e-19
WP_172631734.1|695746_697099_+	glutathione-disulfide reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	25.8	1.4e-34
WP_012658237.1|697128_697542_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012658238.1|697762_698905_+	cysteine desulfurase	NA	Q2XUY6	environmental_halophage	26.1	5.6e-21
>prophage 5
NC_012004	Streptococcus uberis 0140J, complete genome	1852352	1661145	1670113	1852352		Lactobacillus_phage(50.0%)	8	NA	NA
WP_015911975.1|1661145_1662513_-	DNA repair protein RadA	NA	A0A0A7NU39	Lactobacillus_phage	35.6	8.7e-05
WP_015911976.1|1662560_1663007_-	dUTP diphosphatase	NA	A0A1B1IMW3	Lactococcus_phage	49.0	7.9e-32
WP_015911977.1|1663121_1663481_-	YbaN family protein	NA	NA	NA	NA	NA
WP_015911978.1|1663669_1664272_+	NAD(P)H-dependent oxidoreductase	NA	A0A2P0ZL77	Lactobacillus_phage	53.2	3.8e-53
WP_015911979.1|1664290_1665538_+	NAD(P)H-dependent oxidoreductase	NA	A0A2P0ZL82	Lactobacillus_phage	57.7	3.5e-61
WP_155105294.1|1665802_1666336_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015911981.1|1666619_1668404_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	28.7	1.4e-42
WP_015911982.1|1668403_1670113_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	28.1	2.2e-37
>prophage 6
NC_012004	Streptococcus uberis 0140J, complete genome	1852352	1809857	1821822	1852352	integrase	Streptococcus_phage(72.73%)	18	1806684:1806743	1819201:1819262
1806684:1806743	attL	AAAAAAGCCTATTAAATAGGCTTTTAAAGTGTTTAATGTAAGAATTAAAGCATTTTGTTG	NA	NA	NA	NA
WP_015912108.1|1809857_1810049_-	hypothetical protein	NA	A0A1S5S919	Streptococcus_phage	65.1	2.5e-19
WP_015912110.1|1810910_1811210_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041817707.1|1811452_1811878_-	ArpU family transcriptional regulator	NA	J7KDQ1	Streptococcus_phage	57.7	2.4e-38
WP_015912113.1|1812226_1812715_-	hypothetical protein	NA	A0A1X9I5V2	Streptococcus_phage	46.5	3.2e-34
WP_041817819.1|1812788_1813295_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155105299.1|1813433_1814279_-	DnaD domain protein	NA	R9QM95	Lactococcus_phage	64.5	3.4e-31
WP_015912116.1|1814341_1814611_-	hypothetical protein	NA	A0A1X9I5U9	Streptococcus_phage	51.2	6.7e-18
WP_015912117.1|1814612_1814951_-	hypothetical protein	NA	A0A1X9I5Z6	Streptococcus_phage	45.2	3.1e-12
WP_015912119.1|1815134_1815317_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015912120.1|1815309_1815594_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015912121.1|1815886_1816180_-	hypothetical protein	NA	A0A2R3ZY45	Staphylococcus_phage	42.9	1.1e-05
WP_015912122.1|1816198_1816816_-	Rha family transcriptional regulator	NA	A0A192Y918	Salmonella_phage	40.5	6.1e-14
WP_015912123.1|1816827_1817013_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_015912124.1|1817174_1817876_+	helix-turn-helix domain-containing protein	NA	A0A1X9I723	Streptococcus_phage	34.8	4.6e-26
WP_015912125.1|1817987_1819154_+|integrase	site-specific integrase	integrase	A0A1X9I5Y5	Streptococcus_phage	70.4	2.7e-156
WP_015912126.1|1819244_1819856_-	30S ribosomal protein S4	NA	NA	NA	NA	NA
1819201:1819262	attR	AAAAAAGCCTATTAAATAGGCTTTTAAAGTGTTTAATGTAAGAATTAAAGCATTTTGTTGTA	NA	NA	NA	NA
WP_015912127.1|1820176_1820449_-	Veg family protein	NA	NA	NA	NA	NA
WP_015912128.1|1820460_1821822_-	replicative DNA helicase	NA	A0A1P8VVQ6	Streptococcus_phage	63.2	3.9e-154
