The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_011000	Burkholderia cenocepacia J2315 chromosome 1, complete sequence	3870082	60763	171004	3870082	integrase,holin,plate,tail,transposase	Burkholderia_phage(61.11%)	99	100330:100360	125266:125296
WP_012492245.1|60763_61783_+|transposase	IS110-like element ISBcen5 family transposase	transposase	NA	NA	NA	NA
WP_006488477.1|62069_62858_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_006491543.1|62873_64304_+	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_006490876.1|64349_64922_-	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_006490878.1|64990_65422_-	Cd(II)/Pb(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_012492246.1|65503_68044_+	heavy metal translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	45.3	3.1e-133
WP_006489530.1|68054_68432_+	zinc ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_012492247.1|68590_69472_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_012492248.1|69747_71211_+	mechanosensitive ion channel	NA	NA	NA	NA	NA
WP_006489522.1|71400_72813_+	ethanolamine permease	NA	NA	NA	NA	NA
WP_006489528.1|72952_74350_+	ethanolamine ammonia-lyase subunit EutB	NA	NA	NA	NA	NA
WP_006489519.1|74346_75144_+	ethanolamine ammonia-lyase subunit EutC	NA	NA	NA	NA	NA
WP_012492249.1|75136_76021_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_020979463.1|76176_77799_+	MFS transporter	NA	NA	NA	NA	NA
WP_034178592.1|77941_78370_-	pyridoxamine 5'-phosphate oxidase family protein	NA	NA	NA	NA	NA
WP_006489874.1|78691_80218_+	aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_006489872.1|80394_80943_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006493582.1|81148_82165_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_006483320.1|82259_83357_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012492253.1|83353_85057_-	thiamine pyrophosphate-binding protein	NA	NA	NA	NA	NA
WP_006485674.1|85335_85797_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006485672.1|85793_86078_+	type II toxin-antitoxin system mRNA interferase toxin, RelE/StbE family	NA	NA	NA	NA	NA
WP_006485681.1|86235_87624_-	L-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_006485680.1|87654_88797_-	alginate lyase family protein	NA	NA	NA	NA	NA
WP_006485677.1|88948_91876_-	aminomethyl-transferring glycine dehydrogenase	NA	M4QFZ1	Prochlorococcus_phage	51.0	6.2e-258
WP_006485673.1|91934_92315_-	glycine cleavage system protein GcvH	NA	NA	NA	NA	NA
WP_006485675.1|92441_93560_-	glycine cleavage system aminomethyltransferase GcvT	NA	NA	NA	NA	NA
WP_006485676.1|94027_94390_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006485682.1|94593_95646_-	oxidoreductase	NA	NA	NA	NA	NA
WP_006496277.1|95947_96655_-	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
WP_012492254.1|96965_99053_+	UvrD-helicase domain-containing protein	NA	A7KV33	Bacillus_phage	35.7	1.8e-102
WP_006496275.1|99159_100047_-	cytochrome c5 family protein	NA	NA	NA	NA	NA
100330:100360	attL	CTCCGAAGGCAGGGGTTGCTGGTTCGATCCC	NA	NA	NA	NA
WP_006484045.1|100428_101505_-|integrase	site-specific integrase	integrase	A0A1S5NNJ1	Burkholderia_phage	81.7	7.2e-164
WP_034178513.1|101507_101780_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006484046.1|102199_104992_-	toprim domain-containing protein	NA	E5E3N5	Burkholderia_phage	90.9	0.0e+00
WP_006493879.1|104997_105255_-	hypothetical protein	NA	A4JWQ9	Burkholderia_virus	57.1	7.3e-14
WP_006485448.1|105382_105631_-	ogr/Delta-like zinc finger family protein	NA	K4PAZ0	Burkholderia_phage	91.5	3.5e-37
WP_006485450.1|105812_106028_-	hypothetical protein	NA	E5E3U1	Burkholderia_phage	80.0	4.4e-20
WP_077176263.1|106154_106610_+	helix-turn-helix transcriptional regulator	NA	E5E3U2	Burkholderia_phage	62.3	7.0e-44
WP_012492258.1|107181_108714_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	34.5	2.0e-34
WP_006485449.1|108841_109138_+	hypothetical protein	NA	E5E3U3	Burkholderia_phage	50.5	1.6e-12
WP_006485451.1|109325_110396_-	phage late control D family protein	NA	K4PAY4	Burkholderia_phage	70.6	1.1e-135
WP_006485447.1|110392_110824_-|tail	phage tail protein	tail	K4NXK5	Burkholderia_phage	67.4	8.2e-42
WP_012492260.1|110846_113417_-	hypothetical protein	NA	E5E3U6	Burkholderia_phage	46.7	2.2e-134
WP_006484104.1|113432_113546_-|tail	GpE family phage tail protein	tail	A0A089FGX3	Burkholderia_phage	85.7	1.1e-09
WP_171984197.1|113554_113890_-|tail	phage tail assembly protein	tail	K4NXA3	Burkholderia_phage	65.5	1.5e-27
WP_006484101.1|114002_114512_-|tail	phage major tail tube protein	tail	E5E3U9	Burkholderia_phage	74.6	1.5e-71
WP_006484096.1|114540_115713_-|tail	phage tail sheath protein	tail	A4JWS7	Burkholderia_virus	81.7	3.0e-187
WP_006484105.1|115767_116502_-|tail	tail assembly chaperone	tail	E5E3V1	Burkholderia_phage	84.2	1.8e-89
WP_006484087.1|116517_119169_-|tail	tail fiber protein	tail	E5E3V2	Burkholderia_phage	71.3	0.0e+00
WP_006484097.1|119175_119718_-|tail	phage tail protein I	tail	E5FFH2	Burkholderia_phage	70.9	5.2e-70
WP_006484106.1|119710_120625_-|plate	baseplate J/gp47 family protein	plate	E5FFH3	Burkholderia_phage	72.6	1.5e-117
WP_006484088.1|120621_120984_-	GPW/gp25 family protein	NA	K4PAX6	Burkholderia_phage	69.2	2.6e-41
WP_006484112.1|120980_121667_-|plate	phage baseplate assembly protein V	plate	K4NXJ5	Burkholderia_phage	69.2	2.0e-82
WP_006484113.1|122175_122625_-|tail	phage tail protein	tail	E5E3V9	Burkholderia_phage	54.2	1.5e-30
WP_006484109.1|122741_123182_-	protein lysB	NA	K4NXJ2	Burkholderia_phage	44.4	1.4e-17
WP_006484095.1|123178_124036_-	DUF3380 domain-containing protein	NA	A4JWZ0	Burkholderia_virus	65.8	1.7e-91
WP_006484102.1|124032_124299_-|holin	phage holin family protein	holin	E5E3W3	Burkholderia_phage	65.5	6.2e-24
WP_006484093.1|124300_124645_-	membrane protein	NA	A4JWU2	Burkholderia_virus	77.9	5.7e-38
WP_006484103.1|124661_124868_-|tail	tail protein X	tail	E5E3W5	Burkholderia_phage	64.7	5.1e-18
WP_006484107.1|125429_127049_+	TIGR04222 domain-containing membrane protein	NA	NA	NA	NA	NA
125266:125296	attR	CTCCGAAGGCAGGGGTTGCTGGTTCGATCCC	NA	NA	NA	NA
WP_034178448.1|127288_129232_+	glycosyltransferase family protein	NA	NA	NA	NA	NA
WP_006484098.1|129386_130529_-	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	A0A0P0CNN6	Ostreococcus_mediterraneus_virus	24.4	2.5e-13
WP_006484115.1|130558_132901_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_006484091.1|133157_133457_-	flagellar protein FliT	NA	NA	NA	NA	NA
WP_006484094.1|133482_134991_-	flagellar filament capping protein FliD	NA	NA	NA	NA	NA
WP_006484100.1|135123_136278_-	flagellin	NA	NA	NA	NA	NA
WP_006401410.1|136808_137021_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_006484092.1|137187_139311_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_006484111.1|139540_140776_+	PepSY domain-containing protein	NA	NA	NA	NA	NA
WP_006489711.1|140860_141463_-	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
WP_012492265.1|141604_142486_+	ATPase	NA	NA	NA	NA	NA
WP_006489316.1|142625_143450_+	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_006489324.1|143589_144333_-	aquaporin Z	NA	A0A1B1ISL4	uncultured_Mediterranean_phage	50.8	8.1e-05
WP_006489320.1|144632_144929_+	H-NS histone family protein	NA	F8TUP5	EBPR_podovirus	41.1	1.9e-10
WP_006489318.1|145032_146097_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_162470859.1|146412_146763_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006477348.1|146728_147082_+	flagellar transcriptional regulator FlhD	NA	NA	NA	NA	NA
WP_006493184.1|147174_147729_+	flagellar transcriptional regulator FlhC	NA	NA	NA	NA	NA
WP_006482649.1|147909_148770_+	flagellar motor stator protein MotA	NA	NA	NA	NA	NA
WP_006482647.1|148783_149803_+	flagellar motor protein MotB	NA	NA	NA	NA	NA
WP_006482646.1|149827_150205_+	response regulator	NA	NA	NA	NA	NA
WP_012492266.1|150238_152506_+	chemotaxis protein CheA	NA	NA	NA	NA	NA
WP_006486165.1|152553_153069_+	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_012492267.1|153106_155065_+	Tar ligand binding domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	41.7	1.4e-11
WP_006493442.1|155068_156061_+	chemotaxis protein CheR	NA	NA	NA	NA	NA
WP_006497454.1|156057_156816_+	chemoreceptor glutamine deamidase CheD	NA	NA	NA	NA	NA
WP_012492268.1|156812_157904_+	chemotaxis response regulator protein-glutamate methylesterase	NA	NA	NA	NA	NA
WP_006485893.1|157971_158367_+	chemotaxis response regulator CheY	NA	Q56AR1	Bacillus_thuringiensis_phage	31.9	6.0e-07
WP_006485885.1|158369_159101_+	protein phosphatase CheZ	NA	NA	NA	NA	NA
WP_012492269.1|159360_159864_+	DUF2844 domain-containing protein	NA	NA	NA	NA	NA
WP_006485888.1|161282_161780_+	VOC family protein	NA	NA	NA	NA	NA
WP_006485884.1|162209_163409_+	flagellar type III secretion system protein FlhB	NA	NA	NA	NA	NA
WP_006485892.1|163405_165508_+	flagellar biosynthesis protein FlhA	NA	NA	NA	NA	NA
WP_012492270.1|165504_167304_+	flagellar biosynthesis protein FlhF	NA	NA	NA	NA	NA
WP_006491878.1|167296_168115_+	flagellar biosynthesis protein FlhG	NA	NA	NA	NA	NA
WP_006484033.1|168137_168872_+	RNA polymerase sigma factor FliA	NA	NA	NA	NA	NA
WP_006484031.1|169123_170542_+	adenosylhomocysteinase	NA	S4VPF6	Pandoravirus	30.1	9.9e-44
WP_006477367.1|170650_171004_+|holin	phage holin family protein	holin	NA	NA	NA	NA
>prophage 2
NC_011000	Burkholderia cenocepacia J2315 chromosome 1, complete sequence	3870082	316768	373024	3870082	transposase,plate,protease	uncultured_Mediterranean_phage(40.0%)	59	NA	NA
WP_006490629.1|316768_317482_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_006490631.1|317770_322474_+	glutamate synthase subunit alpha	NA	NA	NA	NA	NA
WP_006490625.1|322559_324026_+	glutamate synthase subunit beta	NA	NA	NA	NA	NA
WP_006490627.1|324401_325892_+	alanine:cation symporter family protein	NA	NA	NA	NA	NA
WP_012492302.1|325888_326455_+	RNA 2',3'-cyclic phosphodiesterase	NA	NA	NA	NA	NA
WP_006482643.1|326487_327771_-	D-amino acid dehydrogenase	NA	NA	NA	NA	NA
WP_006482644.1|327796_329059_-	MFS transporter	NA	NA	NA	NA	NA
WP_012492303.1|329187_329964_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_006488528.1|329960_331730_-	ABC transporter ATP-binding protein/permease	NA	NA	NA	NA	NA
WP_006488532.1|332349_333486_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_006488534.1|333518_333716_+	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
WP_006488530.1|333754_334570_+	thiazole synthase	NA	NA	NA	NA	NA
WP_012492304.1|334566_335691_+	thiamine phosphate synthase	NA	NA	NA	NA	NA
WP_006477138.1|335775_336597_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	29.4	3.1e-21
WP_006486220.1|336593_337361_+	lipid asymmetry maintenance ABC transporter permease subunit MlaE	NA	NA	NA	NA	NA
WP_006486221.1|337385_337946_+	outer membrane lipid asymmetry maintenance protein MlaD	NA	NA	NA	NA	NA
WP_020979879.1|337977_338940_+	VacJ family lipoprotein	NA	NA	NA	NA	NA
WP_012492305.1|339051_339681_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_006485329.1|339677_339953_+	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_006485348.1|340145_341072_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.2	8.2e-23
WP_023476193.1|341128_341890_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_006477131.1|341943_342183_+	BolA family transcriptional regulator	NA	NA	NA	NA	NA
WP_006485350.1|342197_343547_+	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_006477129.1|343543_344197_+	ATP phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_006485330.1|344221_345538_+	histidinol dehydrogenase	NA	NA	NA	NA	NA
WP_006485351.1|345636_346710_+	histidinol-phosphate transaminase	NA	NA	NA	NA	NA
WP_006477126.1|346775_347363_+	imidazoleglycerol-phosphate dehydratase HisB	NA	NA	NA	NA	NA
WP_006485349.1|347424_348045_+	YchE family NAAT transporter	NA	NA	NA	NA	NA
WP_012492306.1|348041_348683_+	imidazole glycerol phosphate synthase subunit HisH	NA	NA	NA	NA	NA
WP_006477123.1|348846_349602_+	1-(5-phosphoribosyl)-5-[(5- phosphoribosylamino)methylideneamino]imidazole-4- carboxamide isomerase	NA	NA	NA	NA	NA
WP_006485327.1|349708_350482_+	imidazole glycerol phosphate synthase subunit HisF	NA	NA	NA	NA	NA
WP_012492307.1|350481_350898_+	phosphoribosyl-AMP cyclohydrolase	NA	NA	NA	NA	NA
WP_006485344.1|350894_351260_+	phosphoribosyl-ATP diphosphatase	NA	NA	NA	NA	NA
WP_006485332.1|351330_351723_+	membrane protein	NA	NA	NA	NA	NA
WP_006485352.1|351754_352120_+	histidine triad nucleotide-binding protein	NA	NA	NA	NA	NA
WP_006477115.1|352213_352444_+	Sec-independent protein translocase subunit TatA	NA	NA	NA	NA	NA
WP_006485331.1|352470_353010_+	Sec-independent protein translocase subunit TatB	NA	NA	NA	NA	NA
WP_006485341.1|353051_353840_+	twin-arginine translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	29.8	1.8e-26
WP_006485345.1|354049_355255_-	Do family serine endopeptidase	NA	A0A1B1IRD3	uncultured_Mediterranean_phage	34.3	1.9e-11
WP_006485336.1|355276_356023_+	Nif3-like dinuclear metal center hexameric protein	NA	NA	NA	NA	NA
WP_006491868.1|356241_356862_+	ubiquinol-cytochrome c reductase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_006485333.1|356861_358244_+	cytochrome bc complex cytochrome b subunit	NA	NA	NA	NA	NA
WP_006477108.1|358265_359024_+	cytochrome c1	NA	NA	NA	NA	NA
WP_006400565.1|359118_359730_+	glutathione S-transferase N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_006485328.1|359801_360323_+|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	52.0	9.6e-21
WP_006485326.1|360771_360975_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006485337.1|361084_361885_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_006485338.1|362166_362484_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006485334.1|362565_362901_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006491869.1|363014_363797_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_006477098.1|363793_365140_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_006485335.1|365245_365845_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_012492309.1|366231_366858_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006484395.1|366904_367420_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_006484397.1|367435_368926_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_006477093.1|368996_369500_+	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_006477092.1|369562_370048_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_006484396.1|370124_371960_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_006484394.1|371923_373024_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
>prophage 3
NC_011000	Burkholderia cenocepacia J2315 chromosome 1, complete sequence	3870082	1223098	1278229	3870082	transposase,integrase	Paenibacillus_phage(28.57%)	45	1215847:1215863	1234480:1234496
1215847:1215863	attL	GCGCGATTTCGGCGGCG	NA	NA	NA	NA
WP_012492455.1|1223098_1224301_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	50.8	1.3e-108
WP_006481795.1|1224367_1225225_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006481798.1|1225498_1225702_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012492456.1|1225705_1226032_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006481815.1|1226077_1227535_+	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
WP_012492458.1|1228248_1229448_+	inovirus-type Gp2 protein	NA	NA	NA	NA	NA
WP_085964347.1|1230089_1230907_-|transposase	IS5-like element IS402 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	35.0	1.1e-07
WP_006481789.1|1231980_1232850_-	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_006481786.1|1232842_1233166_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_006481809.1|1233333_1233498_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012492461.1|1233592_1234837_+	nucleotidyltransferase	NA	NA	NA	NA	NA
1234480:1234496	attR	GCGCGATTTCGGCGGCG	NA	NA	NA	NA
WP_012492462.1|1234837_1235308_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085964347.1|1235667_1236485_-|transposase	IS5-like element IS402 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	35.0	1.1e-07
WP_006492364.1|1237518_1238112_-	CGNR zinc finger domain-containing protein	NA	NA	NA	NA	NA
WP_006481826.1|1238250_1239141_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_158305052.1|1239201_1239915_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_085964349.1|1240205_1241334_+|transposase	IS3-like element ISBcen15 family transposase	transposase	S5WIU1	Leptospira_phage	43.4	6.2e-49
WP_006481836.1|1242602_1243580_+	DUF4105 domain-containing protein	NA	NA	NA	NA	NA
WP_006481833.1|1243657_1245031_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006481739.1|1245110_1246451_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_006481741.1|1246927_1248049_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_006481834.1|1248045_1248807_+	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_006481742.1|1248803_1250606_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006481779.1|1251003_1252008_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_006481806.1|1252016_1252754_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_006481747.1|1252796_1253699_-	transporter	NA	NA	NA	NA	NA
WP_006481775.1|1253722_1255252_-	aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_006481808.1|1255533_1256628_-	porin	NA	NA	NA	NA	NA
WP_043033214.1|1256838_1257540_-	Asp/Glu racemase	NA	NA	NA	NA	NA
WP_006481780.1|1257622_1258993_-	MFS transporter	NA	NA	NA	NA	NA
WP_006481824.1|1259004_1260144_-	FAD-dependent monooxygenase	NA	NA	NA	NA	NA
WP_006481807.1|1260155_1260638_-	thioesterase family protein	NA	NA	NA	NA	NA
WP_006481832.1|1260634_1262302_-	AMP-binding protein	NA	NA	NA	NA	NA
WP_006481769.1|1262323_1263205_-	VOC family protein	NA	NA	NA	NA	NA
WP_006492256.1|1263268_1264552_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006481792.1|1264681_1265407_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_077176183.1|1267179_1267554_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_006481817.1|1267550_1267889_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_006484960.1|1267952_1269506_+|transposase	IS66-like element ISBcen19 family transposase	transposase	A0A218MNE7	uncultured_virus	46.4	3.3e-125
WP_012492468.1|1270535_1273043_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	26.3	3.7e-33
WP_006481774.1|1273103_1275986_+	SH3 domain-containing protein	NA	NA	NA	NA	NA
WP_012492469.1|1275995_1276532_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012492470.1|1276544_1276796_+	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_041494516.1|1276864_1277098_+	hypothetical protein	NA	NA	NA	NA	NA
WP_102896096.1|1277108_1278229_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.9	2.1e-49
>prophage 4
NC_011000	Burkholderia cenocepacia J2315 chromosome 1, complete sequence	3870082	1377323	1426774	3870082	transposase,plate,protease	Bacillus_phage(21.43%)	40	NA	NA
WP_006490511.1|1377323_1379222_+|protease	ATP-dependent zinc metalloprotease FtsH	protease	M4QMW8	Micromonas_pusilla_virus	41.0	1.9e-111
WP_006493125.1|1379250_1380192_+	dihydropteroate synthase	NA	A0A0B5J4J5	Pandoravirus	33.0	8.3e-23
WP_006490564.1|1380219_1381575_+	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_006490565.1|1382014_1383049_+	phosphate ABC transporter substrate-binding protein PstS	NA	A0A1D7SRJ6	Cyanophage	35.6	1.5e-44
WP_006490596.1|1383143_1384130_+	phosphate ABC transporter permease PstC	NA	NA	NA	NA	NA
WP_034178403.1|1384126_1385020_+	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_006490515.1|1385035_1385884_+	phosphate ABC transporter ATP-binding protein PstB	NA	W8CYL7	Bacillus_phage	33.5	9.5e-18
WP_006490618.1|1385902_1386607_+	phosphate signaling complex protein PhoU	NA	NA	NA	NA	NA
WP_006750313.1|1386638_1387340_+	phosphate regulon transcriptional regulator PhoB	NA	W8CYM9	Bacillus_phage	37.3	1.7e-33
WP_006490622.1|1387397_1388717_+	phosphate regulon sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	36.0	4.6e-35
WP_006490552.1|1388804_1390868_-	polyphosphate kinase 1	NA	NA	NA	NA	NA
WP_006490522.1|1391147_1392662_+	exopolyphosphatase	NA	NA	NA	NA	NA
WP_012492497.1|1392768_1393209_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006490592.1|1393669_1394131_+	phosphohistidine phosphatase SixA	NA	NA	NA	NA	NA
WP_006490555.1|1394302_1395109_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_006476323.1|1395316_1395487_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006490588.1|1395622_1395805_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006490551.1|1395824_1397204_-	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_006493122.1|1397214_1397538_-	DUF2288 domain-containing protein	NA	NA	NA	NA	NA
WP_006490583.1|1397610_1399230_-	AMP-binding protein	NA	A0A2H4PQU7	Staphylococcus_phage	33.8	1.0e-60
WP_006490610.1|1399598_1400291_-	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A1W6JQH9	Corynebacterium_phage	38.1	6.2e-07
WP_006490569.1|1400423_1401335_-	aldose 1-epimerase	NA	NA	NA	NA	NA
WP_006490581.1|1401814_1402645_+	undecaprenyl-diphosphate phosphatase	NA	NA	NA	NA	NA
WP_012492498.1|1403501_1403879_+	DUF3592 domain-containing protein	NA	NA	NA	NA	NA
WP_012492499.1|1403903_1404476_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006490600.1|1404477_1406355_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_006490582.1|1406494_1408606_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	31.1	2.0e-64
WP_012492501.1|1408617_1409910_+	DUF2169 domain-containing protein	NA	NA	NA	NA	NA
WP_020979811.1|1409894_1411085_+	DUF4150 domain-containing protein	NA	NA	NA	NA	NA
WP_006490573.1|1411195_1411993_+	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_085964368.1|1412497_1413058_+	HNH/ENDO VII family nuclease	NA	NA	NA	NA	NA
WP_124714746.1|1413071_1413506_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012492505.1|1413508_1413943_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006490534.1|1414665_1416678_+	anti-phage defense ZorAB system ZorA	NA	NA	NA	NA	NA
WP_102896096.1|1417104_1418225_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.9	2.1e-49
WP_006490615.1|1418643_1420284_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006482411.1|1420373_1421147_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	56.9	4.2e-81
WP_006482449.1|1421143_1422172_-|transposase	IS21-like element ISBcen13 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	44.1	2.1e-72
WP_085964349.1|1423780_1424910_-|transposase	IS3-like element ISBcen15 family transposase	transposase	S5WIU1	Leptospira_phage	43.4	6.2e-49
WP_102896096.1|1425653_1426774_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.9	2.1e-49
>prophage 5
NC_011000	Burkholderia cenocepacia J2315 chromosome 1, complete sequence	3870082	1683684	1766346	3870082	capsid,holin,tail,plate,transposase,terminase	Burkholderia_phage(92.31%)	89	NA	NA
WP_127837586.1|1683684_1684125_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_006483501.1|1684226_1684688_-	DUF2147 domain-containing protein	NA	NA	NA	NA	NA
WP_006483487.1|1684862_1686548_-	ShlB/FhaC/HecB family hemolysin secretion/activation protein	NA	NA	NA	NA	NA
WP_012492564.1|1686692_1688117_-	collagen-like triple helix repeat-containing protein	NA	NA	NA	NA	NA
WP_012492565.1|1688157_1689831_-	collagen-like triple helix repeat-containing protein	NA	NA	NA	NA	NA
WP_006483497.1|1690508_1690679_+	Flp family type IVb pilin	NA	NA	NA	NA	NA
WP_006483488.1|1690766_1691261_+	prepilin peptidase	NA	NA	NA	NA	NA
WP_006483477.1|1691257_1691752_+	pilus assembly protein	NA	NA	NA	NA	NA
WP_006483496.1|1691846_1692752_+	Flp pilus assembly protein CpaB	NA	NA	NA	NA	NA
WP_006483494.1|1692774_1694106_+	type II and III secretion system protein family protein	NA	NA	NA	NA	NA
WP_006483491.1|1694181_1695420_+	fimbrial protein	NA	NA	NA	NA	NA
WP_006483500.1|1695423_1696776_+	CpaF family protein	NA	NA	NA	NA	NA
WP_012492566.1|1696768_1697749_+	type II secretion system F family protein	NA	NA	NA	NA	NA
WP_006483478.1|1697753_1698752_+	type II secretion system F family protein	NA	NA	NA	NA	NA
WP_006483480.1|1698781_1699609_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006483481.1|1699632_1699962_+	DUF3613 domain-containing protein	NA	NA	NA	NA	NA
WP_006483498.1|1699974_1701786_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006483492.1|1701799_1703191_+	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_034178628.1|1703245_1703953_+	DUF2968 domain-containing protein	NA	NA	NA	NA	NA
WP_012492570.1|1704034_1704601_-	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_012492571.1|1704896_1705181_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006485282.1|1705208_1706126_-	DUF1571 domain-containing protein	NA	NA	NA	NA	NA
WP_006485283.1|1706155_1707910_-	AMP-binding protein	NA	A0A2H4PQM9	Staphylococcus_phage	25.9	1.8e-39
WP_006485289.1|1708067_1708889_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_006495319.1|1709104_1710325_-	MFS transporter	NA	NA	NA	NA	NA
WP_006485286.1|1710606_1711149_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_006485279.1|1711274_1711901_+	chromosome partitioning protein ParB	NA	NA	NA	NA	NA
WP_006485288.1|1711926_1713657_+	SulP family inorganic anion transporter	NA	NA	NA	NA	NA
WP_006485285.1|1713690_1714626_-	carbohydrate kinase	NA	NA	NA	NA	NA
WP_006485275.1|1714760_1715705_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_006485281.1|1715805_1716843_-	ribose ABC transporter permease	NA	NA	NA	NA	NA
WP_006485287.1|1716885_1718439_-	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.5	1.2e-13
WP_006491498.1|1718425_1719673_-	ROK family protein	NA	NA	NA	NA	NA
WP_006484154.1|1720496_1721486_-	aliphatic sulfonate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_006484152.1|1722009_1724484_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	33.5	1.1e-69
WP_006484150.1|1724632_1725376_+	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_006484228.1|1725485_1726358_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A076YN96	Rhizobium_phage	29.7	1.3e-09
WP_006484224.1|1726450_1727146_+	ribose-5-phosphate isomerase RpiA	NA	NA	NA	NA	NA
WP_006484155.1|1727428_1728145_+	FadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_006484160.1|1729076_1729787_-	hypothetical protein	NA	B5TAB3	Burkholderia_phage	100.0	4.8e-132
WP_006484129.1|1729860_1732089_-	hypothetical protein	NA	B5TAB2	Burkholderia_phage	100.0	0.0e+00
WP_006484169.1|1732096_1733074_-	hypothetical protein	NA	B5TAB1	Burkholderia_phage	99.7	1.8e-185
WP_012492575.1|1733073_1733673_-	DUF2313 domain-containing protein	NA	B5TAB0	Burkholderia_phage	100.0	9.7e-110
WP_006484194.1|1733675_1734797_-|plate	baseplate J/gp47 family protein	plate	B5TAA9	Burkholderia_phage	100.0	5.2e-205
WP_006484137.1|1734793_1735375_-	phage GP46 family protein	NA	B5TAA8	Burkholderia_phage	100.0	1.9e-110
WP_006484159.1|1735459_1735981_-|plate	phage baseplate assembly protein	plate	B5TAA7	Burkholderia_phage	100.0	5.0e-94
WP_006484189.1|1735980_1737138_-	hypothetical protein	NA	B5TAA6	Burkholderia_phage	100.0	6.7e-224
WP_012492576.1|1737143_1738514_-	DNA circularization N-terminal domain-containing protein	NA	B5TAA5	Burkholderia_phage	99.8	3.2e-257
WP_006484120.1|1738513_1740949_-|tail	phage tail tape measure protein	tail	B5TAA4	Burkholderia_phage	100.0	0.0e+00
WP_006484197.1|1740997_1741552_-|tail	phage tail assembly protein	tail	B5TAA3	Burkholderia_phage	100.0	8.2e-95
WP_012492578.1|1741634_1742006_-	hypothetical protein	NA	B5TAA2	Burkholderia_phage	100.0	3.1e-66
WP_006484128.1|1742051_1743530_-|tail	tail sheath protein	tail	B5TAA1	Burkholderia_phage	100.0	4.6e-270
WP_006484122.1|1743573_1743852_-	hypothetical protein	NA	B5TAA0	Burkholderia_phage	100.0	4.3e-44
WP_006484182.1|1743835_1744438_-	DUF1834 family protein	NA	B5TA99	Burkholderia_phage	100.0	3.6e-112
WP_012492580.1|1744437_1744869_-	phage virion morphogenesis protein	NA	B5TA98	Burkholderia_phage	100.0	1.3e-76
WP_006484126.1|1744865_1745369_-	DUF1320 family protein	NA	B5TA97	Burkholderia_phage	100.0	2.4e-93
WP_006484139.1|1745365_1745755_-	hypothetical protein	NA	B5TA96	Burkholderia_phage	100.0	4.6e-28
WP_006484206.1|1745829_1746777_-	hypothetical protein	NA	B5TA95	Burkholderia_phage	100.0	2.5e-176
WP_006484162.1|1746827_1747184_-	DUF2190 family protein	NA	B5TA94	Burkholderia_phage	100.0	2.0e-54
WP_006484117.1|1747229_1748375_-	hypothetical protein	NA	B5TA92	Burkholderia_phage	100.0	1.0e-216
WP_006484119.1|1748588_1748987_-	hypothetical protein	NA	B5TA91	Burkholderia_phage	100.0	1.1e-69
WP_006484158.1|1748983_1749424_-	regulatory protein GemA	NA	B5TA90	Burkholderia_phage	100.0	2.6e-75
WP_006484225.1|1749425_1749746_-	hypothetical protein	NA	B5TA89	Burkholderia_phage	100.0	5.3e-54
WP_006484220.1|1749745_1749913_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006484140.1|1749909_1750743_-	hypothetical protein	NA	B5TA88	Burkholderia_phage	100.0	9.3e-159
WP_006484135.1|1750819_1751092_-	HU family DNA-binding protein	NA	B5TA87	Burkholderia_phage	100.0	3.1e-39
WP_006484203.1|1751154_1751547_-	hypothetical protein	NA	B5TA86	Burkholderia_phage	100.0	2.4e-72
WP_006484130.1|1751557_1752184_-	DUF3164 family protein	NA	B5TA85	Burkholderia_phage	100.0	8.3e-112
WP_006484204.1|1752180_1752768_-	hypothetical protein	NA	B5TA84	Burkholderia_phage	100.0	7.6e-91
WP_006484217.1|1752754_1753060_-	hypothetical protein	NA	B5TA83	Burkholderia_phage	100.0	1.3e-46
WP_006484199.1|1753056_1753245_-	hypothetical protein	NA	B5TA82	Burkholderia_phage	100.0	7.2e-27
WP_006484208.1|1753252_1754245_-	AAA family ATPase	NA	B5TA81	Burkholderia_phage	100.0	5.3e-185
WP_012492581.1|1754254_1755880_-|transposase	Mu transposase C-terminal domain-containing protein	transposase	B5TA80	Burkholderia_phage	100.0	0.0e+00
WP_012492582.1|1755919_1756972_-	hypothetical protein	NA	B5TA79	Burkholderia_phage	100.0	8.9e-191
WP_006484183.1|1756968_1757160_-	DNA-binding protein	NA	B5TA78	Burkholderia_phage	100.0	3.5e-29
WP_012492584.1|1757241_1757712_+	helix-turn-helix transcriptional regulator	NA	B5TA77	Burkholderia_phage	100.0	2.6e-78
WP_006484125.1|1757766_1758300_+	hypothetical protein	NA	B5TA76	Burkholderia_phage	100.0	1.9e-93
WP_012492585.1|1758292_1758901_+	hypothetical protein	NA	B5TA75	Burkholderia_phage	100.0	7.6e-110
WP_006491508.1|1759042_1759417_+|holin	putative holin	holin	B5TA74	Burkholderia_phage	98.4	8.0e-62
WP_006484177.1|1759413_1760085_+	lytic transglycosylase domain-containing protein	NA	B5TA73	Burkholderia_phage	100.0	1.4e-112
WP_006484148.1|1760081_1760543_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006484200.1|1760514_1760658_+	hypothetical protein	NA	B5TA72	Burkholderia_phage	100.0	4.5e-21
WP_012492586.1|1760647_1760872_+	TraR/DksA C4-type zinc finger protein	NA	B5TA71	Burkholderia_phage	100.0	4.5e-36
WP_006484156.1|1760868_1761159_+	hypothetical protein	NA	B5TA70	Burkholderia_phage	100.0	2.8e-46
WP_006484211.1|1761162_1761660_+	DUF1804 family protein	NA	B5TA69	Burkholderia_phage	100.0	9.6e-87
WP_006484219.1|1761666_1763283_+|terminase	phage terminase large subunit	terminase	B5TA68	Burkholderia_phage	100.0	0.0e+00
WP_012492587.1|1763272_1764808_+	DUF935 family protein	NA	B5TA67	Burkholderia_phage	99.8	6.3e-278
WP_006484136.1|1764852_1765113_+	hypothetical protein	NA	B5TA66	Burkholderia_phage	100.0	5.1e-39
WP_006484205.1|1765113_1766346_+|capsid	minor capsid protein	capsid	B5TA65	Burkholderia_phage	100.0	4.4e-242
>prophage 6
NC_011000	Burkholderia cenocepacia J2315 chromosome 1, complete sequence	3870082	2730638	2770761	3870082	transposase,plate,protease	Escherichia_phage(28.57%)	37	NA	NA
WP_006487668.1|2730638_2731139_-|protease	serine protease inhibitor ecotin	protease	NA	NA	NA	NA
WP_006478153.1|2731282_2731609_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006487627.1|2731807_2732212_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006487642.1|2732329_2732710_+	DUF5594 family protein	NA	NA	NA	NA	NA
WP_006487638.1|2732895_2734263_+	MFS transporter	NA	NA	NA	NA	NA
WP_006487659.1|2734293_2734887_-	AAA family ATPase	NA	A0A219VHB7	Ochrobactrum_phage	64.0	3.0e-26
WP_006487666.1|2734879_2736304_-	alpha,alpha-trehalose-phosphate synthase (UDP-forming)	NA	NA	NA	NA	NA
WP_006487640.1|2736442_2736652_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006487661.1|2736940_2737492_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006497148.1|2737488_2737983_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052288951.1|2738516_2738951_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012492761.1|2739023_2739275_-	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_077181119.1|2739303_2739786_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006482449.1|2741642_2742671_+|transposase	IS21-like element ISBcen13 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	44.1	2.1e-72
WP_006482411.1|2742667_2743441_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	56.9	4.2e-81
WP_085964347.1|2745006_2745823_+|transposase	IS5-like element IS402 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	35.0	1.1e-07
WP_012492764.1|2745967_2746234_+	XapX domain-containing protein	NA	NA	NA	NA	NA
WP_012492765.1|2746483_2747656_-	porin	NA	NA	NA	NA	NA
WP_012492766.1|2747652_2749836_-	FUSC family protein	NA	NA	NA	NA	NA
WP_006481910.1|2749852_2750452_-	LUD domain-containing protein	NA	NA	NA	NA	NA
WP_006481909.1|2750448_2751822_-	lactate utilization protein	NA	NA	NA	NA	NA
WP_006481907.1|2751818_2752562_-	(Fe-S)-binding protein	NA	NA	NA	NA	NA
WP_012492768.1|2752618_2754367_-	D-lactate dehydrogenase	NA	NA	NA	NA	NA
WP_006481906.1|2754736_2755648_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012492769.1|2755951_2756815_-	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_006491232.1|2757926_2758262_+	PepSY domain-containing protein	NA	NA	NA	NA	NA
WP_012492770.1|2758318_2758915_+	undecaprenyl-diphosphatase	NA	NA	NA	NA	NA
WP_006486529.1|2758984_2759767_+	membrane protein	NA	NA	NA	NA	NA
WP_012492771.1|2759795_2760248_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006486551.1|2760264_2761023_+	membrane protein	NA	NA	NA	NA	NA
WP_085964354.1|2761105_2761914_-|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	34.3	6.7e-05
WP_006482764.1|2761903_2763163_-|transposase	IS256-like element IS1356 family transposase	transposase	A0A218MNI5	uncultured_virus	44.4	1.1e-43
WP_065814644.1|2763338_2764565_-	ATP-binding protein	NA	A0A2H4J2R8	uncultured_Caudovirales_phage	49.0	1.7e-100
WP_012492773.1|2765320_2765806_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006486496.1|2765809_2767567_-	DUF4150 domain-containing protein	NA	NA	NA	NA	NA
WP_006486541.1|2767559_2768903_-	DUF2169 domain-containing protein	NA	NA	NA	NA	NA
WP_171984383.1|2770116_2770761_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
>prophage 7
NC_011000	Burkholderia cenocepacia J2315 chromosome 1, complete sequence	3870082	2800483	2859770	3870082	transposase,integrase	Leptospira_phage(28.57%)	52	2811583:2811599	2864631:2864647
WP_102896096.1|2800483_2801603_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.9	2.1e-49
WP_006486497.1|2802192_2802981_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_006489014.1|2803110_2804037_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_006489025.1|2804178_2804754_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_085964374.1|2804839_2805484_-	glutathione S-transferase	NA	NA	NA	NA	NA
WP_006489030.1|2806054_2806948_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012492794.1|2807051_2807930_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_006489039.1|2807948_2809367_+	3-isopropylmalate dehydratase large subunit	NA	NA	NA	NA	NA
WP_006489026.1|2809363_2809999_+	3-isopropylmalate dehydratase small subunit	NA	NA	NA	NA	NA
WP_012492795.1|2810151_2810769_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012492796.1|2810916_2812143_+	MFS transporter	NA	NA	NA	NA	NA
2811583:2811599	attL	GCCGCGCTGTTCGCGGC	NA	NA	NA	NA
WP_006489029.1|2812166_2812373_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012492797.1|2812877_2813315_+	TIGR03757 family integrating conjugative element protein	NA	NA	NA	NA	NA
WP_006488999.1|2814226_2815624_+	integrating conjugative element protein	NA	NA	NA	NA	NA
WP_012492798.1|2815620_2815971_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006489021.1|2815984_2817502_+	conjugal transfer protein TraG	NA	NA	NA	NA	NA
WP_006489024.1|2817519_2817897_-	DUF3742 family protein	NA	NA	NA	NA	NA
WP_006489018.1|2817952_2818366_-	putative toxin-antitoxin system toxin component, PIN family	NA	NA	NA	NA	NA
WP_006489017.1|2818365_2818584_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_006489004.1|2818915_2820712_+	TraI domain-containing protein	NA	NA	NA	NA	NA
WP_006489022.1|2820776_2821295_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006489015.1|2821291_2822215_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_009618094.1|2822211_2822661_-	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_009618091.1|2822781_2823081_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_006489045.1|2823185_2823809_+	LysR family substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_006397350.1|2824401_2825151_-	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	60.7	4.8e-82
WP_012492800.1|2825167_2826724_-|transposase	IS21-like element IS408 family transposase	transposase	K4I413	Acidithiobacillus_phage	54.9	1.6e-159
WP_012492801.1|2827323_2827839_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006489001.1|2827886_2828669_+	UPF0489 family protein	NA	NA	NA	NA	NA
WP_006405724.1|2828755_2829544_+	UPF0489 family protein	NA	NA	NA	NA	NA
WP_006405725.1|2829562_2829964_-	DUF4113 domain-containing protein	NA	NA	NA	NA	NA
WP_034178583.1|2830401_2830980_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006405727.1|2831182_2832142_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_006489008.1|2832264_2832831_+	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_006489046.1|2832803_2833919_+	acyl-CoA/acyl-ACP dehydrogenase	NA	NA	NA	NA	NA
WP_006489020.1|2833915_2834710_+	ABC transporter ATP-binding protein	NA	A0A285PWH2	Cedratvirus	26.9	3.4e-09
WP_006488996.1|2835904_2836732_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_006405733.1|2837023_2837785_-	DJ-1/PfpI family protein	NA	NA	NA	NA	NA
WP_006405734.1|2837871_2838675_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_006405735.1|2838835_2839753_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_006489005.1|2842268_2843060_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_012492804.1|2843803_2844853_+	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
WP_006489036.1|2844904_2845858_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_012492805.1|2846086_2846962_+	transporter	NA	NA	NA	NA	NA
WP_006489043.1|2847119_2848502_+|transposase	IS1182 family transposase	transposase	NA	NA	NA	NA
WP_102896096.1|2849953_2851073_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.9	2.1e-49
WP_006476181.1|2853120_2854086_+|transposase	IS110-like element ISBcen8 family transposase	transposase	Q75QL1	Wolbachia_phage	34.2	1.3e-23
WP_006482148.1|2854504_2855974_-	DUF3987 domain-containing protein	NA	A0A0K0N7B1	Gordonia_phage	23.2	3.4e-07
WP_006482143.1|2856197_2856545_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006482147.1|2856608_2856821_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012492806.1|2857436_2858378_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006482144.1|2858405_2859770_-|integrase	integrase family protein	integrase	NA	NA	NA	NA
2864631:2864647	attR	GCCGCGAACAGCGCGGC	NA	NA	NA	NA
>prophage 8
NC_011000	Burkholderia cenocepacia J2315 chromosome 1, complete sequence	3870082	3418039	3426169	3870082	transposase	Enterobacteria_phage(33.33%)	8	NA	NA
WP_085964347.1|3418039_3418856_+|transposase	IS5-like element IS402 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	35.0	1.1e-07
WP_006485123.1|3419148_3420414_-	glycosyltransferase	NA	A0A1V0SAH6	Catovirus	36.0	6.4e-10
WP_006485127.1|3420442_3421585_-	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	NA	NA	NA	NA
WP_012492907.1|3421646_3422960_-	ABC transporter ATP-binding protein	NA	M1HV27	Acanthocystis_turfacea_Chlorella_virus	27.9	6.4e-05
WP_006485117.1|3422949_3423756_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_006485121.1|3423823_3424732_-	dTDP-4-dehydrorhamnose reductase	NA	I7HXC9	Enterobacteria_phage	33.8	1.9e-24
WP_006485116.1|3424739_3425291_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	54.7	1.5e-51
WP_006485115.1|3425275_3426169_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	A0A291LA53	Escherichia_phage	59.2	1.8e-96
>prophage 9
NC_011000	Burkholderia cenocepacia J2315 chromosome 1, complete sequence	3870082	3571060	3580110	3870082		unidentified_phage(16.67%)	7	NA	NA
WP_006484964.1|3571060_3572611_+	polynucleotide adenylyltransferase PcnB	NA	H7BUW3	unidentified_phage	31.3	9.5e-24
WP_006476832.1|3572646_3573189_+	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_006484932.1|3573185_3573872_+	deoxynucleoside kinase	NA	A0A0M3UL55	Enterococcus_phage	26.4	7.2e-08
WP_006485002.1|3573915_3574731_+	3-methyl-2-oxobutanoate hydroxymethyltransferase	NA	A0A0N7HVJ8	Ostreococcus_lucimarinus_virus	34.2	1.8e-37
WP_006484970.1|3574841_3576764_-	aminodeoxychorismate synthase component I	NA	S4VT78	Pandoravirus	37.0	2.4e-56
WP_006476837.1|3576767_3577904_-	molecular chaperone DnaJ	NA	A0A1V0SBY2	Catovirus	26.9	5.0e-22
WP_006484920.1|3578157_3580110_-	molecular chaperone DnaK	NA	A0A1V0SH73	Hokovirus	50.3	2.5e-146
>prophage 1
NC_011001	Burkholderia cenocepacia J2315 chromosome 2, complete sequence	3217062	1138118	1184795	3217062	integrase,plate,terminase,capsid	Burkholderia_phage(41.86%)	66	1138581:1138597	1165850:1165866
WP_006488884.1|1138118_1140044_+	selenocysteine-specific translation elongation factor	NA	A0A2K9KZ60	Tupanvirus	31.5	4.1e-16
1138581:1138597	attL	GGCGTCGCCGCGCTGAA	NA	NA	NA	NA
WP_012493219.1|1140269_1141259_-|integrase	site-specific integrase	integrase	A0A221SAN4	Ralstonia_phage	33.3	3.2e-09
WP_006488850.1|1141474_1141807_-	hypothetical protein	NA	A9YWU9	Burkholderia_phage	59.4	3.0e-12
WP_006488822.1|1141803_1142325_-	DUF1643 domain-containing protein	NA	A0A218L3S7	Pseudomonas_phage	59.8	2.7e-47
WP_012493220.1|1142321_1142789_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012493221.1|1142805_1143129_-	hypothetical protein	NA	Q5QF38	Pseudomonas_virus	43.8	4.7e-10
WP_012493222.1|1143125_1143410_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006488909.1|1143406_1143712_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006488864.1|1143708_1143951_-	helix-turn-helix domain-containing protein	NA	F8TVE5	EBPR_siphovirus	43.2	2.0e-05
WP_006488915.1|1143947_1144337_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006488885.1|1144326_1144620_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012493223.1|1144612_1145524_-	hypothetical protein	NA	Q3HQW1	Burkholderia_phage	49.3	3.1e-06
WP_006488851.1|1145507_1146017_-	hypothetical protein	NA	H9C170	Pectobacterium_phage	60.5	1.4e-53
WP_006492894.1|1146894_1147575_-	YqaJ viral recombinase family protein	NA	A0A0U2BXF3	Paracoccus_phage	38.5	6.0e-31
WP_006488820.1|1147567_1148425_-	hypothetical protein	NA	A0A2H4J1F0	uncultured_Caudovirales_phage	60.9	6.6e-59
WP_006488837.1|1148472_1149786_-	hypothetical protein	NA	I6NMK7	Burkholderia_virus	35.8	2.5e-17
WP_006488910.1|1149946_1150108_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006488853.1|1150104_1150425_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006488889.1|1150421_1150811_-	hypothetical protein	NA	Q3HQW8	Burkholderia_phage	46.7	6.7e-11
WP_006488844.1|1150859_1151096_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006488865.1|1151160_1151316_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006492886.1|1151535_1151826_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006488862.1|1152483_1152867_-	type II toxin-antitoxin system death-on-curing family toxin	NA	A0A222YZ88	Escherichia_phage	44.8	3.3e-18
WP_006488905.1|1152867_1153044_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012493229.1|1153137_1154670_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	34.5	2.0e-34
WP_012493231.1|1155355_1155760_-	hypothetical protein	NA	NA	NA	NA	NA
WP_034178308.1|1155843_1156092_+	hypothetical protein	NA	K7PHA1	Enterobacteria_phage	54.8	2.6e-16
WP_006492900.1|1156295_1156538_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006488823.1|1156690_1156966_+	hypothetical protein	NA	E5E3P2	Burkholderia_phage	56.6	7.3e-20
WP_006488817.1|1156950_1157880_+	DUF1376 domain-containing protein	NA	NA	NA	NA	NA
WP_034178303.1|1157848_1158469_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006488872.1|1158465_1158936_+	RusA family crossover junction endodeoxyribonuclease	NA	A9YWY9	Burkholderia_phage	80.1	1.2e-62
WP_006488874.1|1158946_1159276_+	hypothetical protein	NA	A9YWZ0	Burkholderia_phage	59.2	7.2e-22
WP_012493233.1|1159272_1159866_+	hypothetical protein	NA	A9YWZ1	Burkholderia_phage	78.4	1.6e-80
WP_006492883.1|1159974_1160154_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012493234.1|1160234_1160549_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012493235.1|1160499_1162047_+|terminase	phage terminase large subunit	terminase	H9C0C7	Vibrio_phage	45.1	6.0e-111
WP_006488827.1|1162043_1163627_+	DUF1073 domain-containing protein	NA	A0A0P0I486	Acinetobacter_phage	61.7	5.0e-153
WP_143274665.1|1163556_1164207_+|capsid	minor capsid protein	capsid	A9YWZ8	Burkholderia_phage	76.3	2.7e-89
WP_006488880.1|1164208_1165525_+	DUF2213 domain-containing protein	NA	A0A0P0IRE1	Acinetobacter_phage	47.6	1.1e-73
WP_006488861.1|1165537_1166026_+	hypothetical protein	NA	A0A0P0I8F3	Acinetobacter_phage	56.2	1.4e-37
1165850:1165866	attR	GGCGTCGCCGCGCTGAA	NA	NA	NA	NA
WP_006488835.1|1166036_1167074_+	DUF2184 domain-containing protein	NA	A0A0N7IRF2	Acinetobacter_phage	67.7	1.7e-125
WP_006488891.1|1167083_1167509_+	hypothetical protein	NA	A0A2H4J9M7	uncultured_Caudovirales_phage	40.5	7.9e-05
WP_006488870.1|1167564_1167948_+	DUF4054 domain-containing protein	NA	A9YX25	Burkholderia_phage	75.6	9.1e-53
WP_006488871.1|1167976_1168459_+	hypothetical protein	NA	A9YX26	Burkholderia_phage	86.2	1.9e-71
WP_006488908.1|1168462_1168834_+	hypothetical protein	NA	A9YX28	Burkholderia_phage	89.4	1.3e-59
WP_006488819.1|1168838_1169429_+	hypothetical protein	NA	A9YX29	Burkholderia_phage	86.7	5.1e-95
WP_006488916.1|1169438_1171250_+	DUF3383 family protein	NA	A0A0P0I492	Acinetobacter_phage	37.6	2.0e-89
WP_006488900.1|1171267_1171708_+	DUF3277 family protein	NA	A0A0P0IKY2	Acinetobacter_phage	58.2	1.4e-41
WP_006488838.1|1171710_1172163_+	hypothetical protein	NA	A0A0N7IRF3	Acinetobacter_phage	37.0	3.5e-19
WP_006488906.1|1172159_1172345_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006488896.1|1172337_1174125_+	glucosaminidase domain-containing protein	NA	A0A0M4REK7	Salmonella_phage	33.7	9.9e-25
WP_006488828.1|1174121_1174727_+	hypothetical protein	NA	A0A0P0IKS1	Acinetobacter_phage	37.1	2.6e-17
WP_006488856.1|1174726_1175041_+	hypothetical protein	NA	A0A0M4R5B7	Salmonella_phage	48.4	3.3e-16
WP_143284610.1|1175303_1175537_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006488877.1|1175706_1176684_+	hypothetical protein	NA	A9YX04	Burkholderia_phage	60.0	3.1e-97
WP_006488811.1|1176680_1177094_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006488810.1|1177107_1177899_+	hypothetical protein	NA	A9YX06	Burkholderia_phage	53.6	7.6e-70
WP_006488821.1|1177906_1178257_+	hypothetical protein	NA	A9YX11	Burkholderia_phage	70.9	7.6e-38
WP_006488913.1|1178253_1179441_+|plate	baseplate J/gp47 family protein	plate	A9YX12	Burkholderia_phage	69.4	8.9e-147
WP_006488854.1|1179442_1180159_+	DUF2612 domain-containing protein	NA	A9YX13	Burkholderia_phage	62.0	4.2e-75
WP_006488881.1|1180215_1181214_+	hypothetical protein	NA	A9YX14	Burkholderia_phage	42.2	3.0e-31
WP_006488895.1|1181229_1181808_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006488897.1|1181825_1183382_+	pectate lyase	NA	NA	NA	NA	NA
WP_006488833.1|1183385_1183778_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006488859.1|1184090_1184795_+	chitinase class I domain protein	NA	A0A059VA40	Pseudomonas_phage	41.7	2.4e-27
>prophage 2
NC_011001	Burkholderia cenocepacia J2315 chromosome 2, complete sequence	3217062	2103273	2136490	3217062	integrase,plate,transposase,terminase	Escherichia_phage(55.56%)	34	2120246:2120260	2142425:2142439
WP_006483923.1|2103273_2104215_+|terminase	terminase small subunit	terminase	Q6V7Q7	Burkholderia_virus	29.4	6.2e-18
WP_012493420.1|2104189_2105500_+|terminase	putative phage terminase large subunit	terminase	NA	NA	NA	NA
WP_006483920.1|2105509_2106970_+	hypothetical protein	NA	A0A0U2S5X9	Escherichia_phage	31.3	4.6e-52
WP_006483917.1|2107546_2107984_+	hypothetical protein	NA	NA	NA	NA	NA
WP_127837577.1|2108249_2108981_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006483930.1|2109002_2109779_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006483941.1|2109902_2110448_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006483925.1|2110577_2111600_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006483921.1|2111795_2112299_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006493766.1|2112338_2112809_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006483932.1|2112941_2113262_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006483949.1|2113406_2114039_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006483915.1|2114618_2115107_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006483914.1|2115236_2116589_+	hypothetical protein	NA	A0A0U2KD19	Escherichia_phage	32.7	4.7e-51
WP_012493428.1|2116679_2117120_+	hypothetical protein	NA	A0A0U2S616	Escherichia_phage	37.3	2.8e-21
WP_012493429.1|2117201_2117735_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006483947.1|2117890_2119933_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085964393.1|2120048_2120865_+|transposase	IS5-like element IS402 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	35.0	1.5e-07
2120246:2120260	attL	GACTTGCTGGCGACG	NA	NA	NA	NA
WP_012493432.1|2120892_2121555_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012493433.1|2121564_2121852_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012493434.1|2121856_2123032_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012493435.1|2123033_2123459_+	hypothetical protein	NA	A0A0U2RTA8	Escherichia_phage	34.9	3.6e-10
WP_077181431.1|2123576_2123891_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012493437.1|2123894_2125103_+|plate	baseplate J/gp47 family protein	plate	A0A0U2RJZ0	Escherichia_phage	34.2	4.8e-55
WP_006483926.1|2125173_2126739_+	SPRY domain protein	NA	NA	NA	NA	NA
WP_102896096.1|2128809_2129929_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.9	2.1e-49
WP_006482779.1|2130014_2131601_+	hypothetical protein	NA	C5IHQ4	Burkholderia_virus	58.0	2.2e-15
WP_006482782.1|2131576_2132182_+	lysozyme	NA	NA	NA	NA	NA
WP_034178565.1|2132195_2132411_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012493440.1|2132495_2132912_-	DUF4279 domain-containing protein	NA	NA	NA	NA	NA
WP_012493441.1|2132918_2133680_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006482778.1|2133743_2134412_-	hypothetical protein	NA	NA	NA	NA	NA
WP_127837578.1|2134948_2135443_+	replication/maintenance protein RepL	NA	NA	NA	NA	NA
WP_127837579.1|2135677_2136490_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
2142425:2142439	attR	GACTTGCTGGCGACG	NA	NA	NA	NA
>prophage 1
NC_011002	Burkholderia cenocepacia J2315 chromosome 3, complete sequence	875977	573365	609590	875977	capsid,plate,tail,integrase,transposase,holin	Burkholderia_phage(90.2%)	51	591524:591540	608050:608066
WP_006485378.1|573365_574499_+	acyltransferase	NA	Q6QI96	Burkholderia_phage	100.0	3.6e-214
WP_006485406.1|574699_577057_-	hypothetical protein	NA	Q6QI97	Burkholderia_phage	100.0	0.0e+00
WP_012493761.1|577056_577638_-|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	100.0	1.4e-105
WP_006485373.1|577630_578782_-|plate	baseplate J/gp47 family protein	plate	Q6QI99	Burkholderia_phage	99.7	2.7e-209
WP_006485365.1|578778_579132_-	GPW/gp25 family protein	NA	Q6QIA0	Burkholderia_phage	100.0	6.9e-63
WP_006485402.1|579185_579788_-|plate	phage baseplate assembly protein V	plate	Q6QIA1	Burkholderia_phage	100.0	8.1e-88
WP_006485372.1|579784_580990_-	phage late control D family protein	NA	Q6QIA2	Burkholderia_phage	100.0	2.0e-218
WP_006485366.1|580977_581187_-|tail	tail protein X	tail	Q6QIA3	Burkholderia_phage	100.0	4.4e-33
WP_006485408.1|581186_582077_-|tail	phage tail protein	tail	Q6QIA4	Burkholderia_phage	100.0	8.8e-107
WP_006485356.1|582078_584619_-|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	91.8	0.0e+00
WP_006485393.1|584648_584891_+	hypothetical protein	NA	A4JWK9	Burkholderia_virus	96.2	4.6e-34
WP_012493763.1|584893_585097_-	hypothetical protein	NA	Q6QIA7	Burkholderia_phage	100.0	3.4e-30
WP_006485398.1|585023_585353_-|tail	phage tail assembly protein	tail	Q6QIA8	Burkholderia_phage	100.0	6.2e-50
WP_006485397.1|585474_585999_-|tail	phage major tail tube protein	tail	Q6QIA9	Burkholderia_phage	100.0	5.9e-95
WP_006485369.1|586001_587435_-|tail	phage tail sheath subtilisin-like domain-containing protein	tail	A4JWK5	Burkholderia_virus	98.7	2.6e-270
WP_006485405.1|587438_587684_-	hypothetical protein	NA	Q6QIB1	Burkholderia_phage	100.0	3.1e-38
WP_006485353.1|587680_588145_-	Gp37 family protein	NA	Q6QIB2	Burkholderia_phage	100.0	3.0e-82
WP_006485358.1|588144_588597_-	DUF1320 domain-containing protein	NA	Q6QIB3	Burkholderia_phage	100.0	5.5e-81
WP_006485381.1|588598_588931_-	DUF2190 family protein	NA	Q6QIB4	Burkholderia_phage	100.0	3.0e-52
WP_006485371.1|589005_589929_-	hypothetical protein	NA	A4JWK0	Burkholderia_virus	95.1	5.6e-165
WP_006485410.1|589974_591093_-	hypothetical protein	NA	Q6QIB7	Burkholderia_phage	100.0	2.3e-213
WP_034178535.1|591307_591841_-	phage virion morphogenesis protein	NA	Q6QIB8	Burkholderia_phage	99.4	4.8e-92
591524:591540	attL	CGAGACGCTCGCGGCCA	NA	NA	NA	NA
WP_006485383.1|591831_592668_-|capsid	minor capsid protein	capsid	Q6QIB9	Burkholderia_phage	100.0	2.7e-166
WP_006485375.1|592660_594136_-	DUF935 domain-containing protein	NA	Q6QIC0	Burkholderia_phage	100.0	1.3e-285
WP_006485377.1|594132_595635_-	hypothetical protein	NA	Q6QIC1	Burkholderia_phage	100.0	6.1e-294
WP_006485391.1|595631_596177_-	DUF3486 family protein	NA	Q6QIC2	Burkholderia_phage	100.0	8.6e-89
WP_006485389.1|596178_596511_-	hypothetical protein	NA	Q6QIC3	Burkholderia_phage	100.0	8.7e-60
WP_006485409.1|596507_596846_-	hypothetical protein	NA	Q6QIC4	Burkholderia_phage	100.0	2.1e-53
WP_006485363.1|596842_597442_-	hypothetical protein	NA	Q6QIC6	Burkholderia_phage	100.0	9.8e-94
WP_006485414.1|597438_598050_-	transglycosylase SLT domain-containing protein	NA	Q6QIC7	Burkholderia_phage	100.0	7.4e-113
WP_006485400.1|598052_598400_-|holin	putative holin	holin	Q6QIC8	Burkholderia_phage	100.0	8.0e-56
WP_006485403.1|598466_598691_-	hypothetical protein	NA	Q6QIC9	Burkholderia_phage	100.0	8.5e-35
WP_006485413.1|598755_599292_-	hypothetical protein	NA	Q6QID0	Burkholderia_phage	100.0	6.7e-94
WP_006485386.1|599272_599461_-	hypothetical protein	NA	A4JWP0	Burkholderia_virus	93.5	3.3e-24
WP_006485360.1|599533_600316_-	hypothetical protein	NA	Q6QID1	Burkholderia_phage	100.0	1.3e-143
WP_012493766.1|600312_600729_-	helix-turn-helix transcriptional regulator	NA	Q6QID2	Burkholderia_phage	100.0	7.1e-67
WP_006485399.1|600856_601099_+	DNA-binding protein	NA	Q6QID3	Burkholderia_phage	100.0	4.4e-37
WP_012493768.1|601147_601384_-	hypothetical protein	NA	Q6QID5	Burkholderia_phage	100.0	3.6e-36
WP_012493770.1|601504_601984_+	hypothetical protein	NA	Q6QID6	Burkholderia_phage	100.0	2.9e-88
WP_006485394.1|601980_602283_+	helix-turn-helix domain-containing protein	NA	Q6QID7	Burkholderia_phage	100.0	7.0e-48
WP_012493771.1|602293_602506_+	hypothetical protein	NA	Q6QID8	Burkholderia_phage	100.0	2.2e-32
WP_006485380.1|602516_603470_+	hypothetical protein	NA	Q6QID9	Burkholderia_phage	100.0	3.9e-169
WP_006485354.1|603487_605287_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	Q6QIE0	Burkholderia_phage	100.0	0.0e+00
WP_034178537.1|605286_606498_+	AAA family ATPase	NA	Q6QIE1	Burkholderia_phage	100.0	1.2e-223
WP_006485359.1|606499_606829_+	hypothetical protein	NA	Q6QIE2	Burkholderia_phage	100.0	4.4e-56
WP_012493772.1|606864_607287_+	hypothetical protein	NA	Q6QIE3	Burkholderia_phage	100.0	5.9e-77
WP_006485364.1|607409_608027_+	DUF3164 family protein	NA	Q6QIE4	Burkholderia_phage	100.0	1.3e-112
WP_006485362.1|608090_608363_+	HU family DNA-binding protein	NA	Q6QIE5	Burkholderia_phage	100.0	6.7e-42
608050:608066	attR	TGGCCGCGAGCGTCTCG	NA	NA	NA	NA
WP_006485374.1|608393_608798_+	DUF2528 family protein	NA	Q6QIE6	Burkholderia_phage	100.0	4.9e-73
WP_006485388.1|608781_609222_+	regulatory protein GemA	NA	Q6QIE7	Burkholderia_phage	100.0	3.0e-76
WP_006485401.1|609218_609590_+	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	100.0	8.5e-64
