The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_009332	Streptococcus pyogenes str. Manfredo, complete genome	1841271	490302	555874	1841271	tRNA,holin,tail,terminase,portal,capsid	Temperate_phage(47.17%)	67	NA	NA
WP_002988958.1|490302_491238_+|tRNA	methionyl-tRNA formyltransferase	tRNA	M4QRX9	Synechococcus_phage	38.5	6.0e-05
WP_011184816.1|491227_492550_+	16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB	NA	NA	NA	NA	NA
WP_002983660.1|492587_493328_+	Stp1/IreP family PP2C-type Ser/Thr phosphatase	NA	NA	NA	NA	NA
WP_011888669.1|493324_495223_+	Stk1 family PASTA domain-containing Ser/Thr kinase	NA	B5LWE2	Feldmannia_species_virus	30.3	3.2e-21
WP_011888670.1|495345_496038_+	cell wall-active antibiotics response protein	NA	NA	NA	NA	NA
WP_002991890.1|496034_497039_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_011888671.1|497031_497673_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_011888672.1|497709_499110_+	bifunctional Cof-type HAD-IIB family hydrolase/peptidylprolyl isomerase	NA	A0A1V0S9I2	Catovirus	43.5	5.4e-26
WP_002991882.1|499109_499487_+	S1 RNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_011888673.1|499504_500446_-	cysteine synthase A	NA	A0A1X9I5F1	Streptococcus_phage	77.2	1.7e-129
WP_009880468.1|500573_501206_-	YigZ family protein	NA	A0A1X9I5T8	Streptococcus_phage	54.3	3.2e-63
WP_011184811.1|501261_502587_+	DEAD/DEAH box helicase	NA	A0A1X9I5S6	Streptococcus_phage	50.8	3.1e-116
WP_002983685.1|502558_503224_+	ComF family protein	NA	NA	NA	NA	NA
WP_002988974.1|503303_503852_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_002983693.1|511629_512163_-	DUF402 domain-containing protein	NA	NA	NA	NA	NA
WP_011888675.1|512242_513019_-	recombination regulator RecX	NA	NA	NA	NA	NA
WP_011888677.1|514515_515937_-	DUF4041 domain-containing protein	NA	M1PLF9	Streptococcus_phage	75.2	1.9e-140
WP_041174188.1|515951_516338_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A1P8VVK5	Streptococcus_phage	76.8	1.2e-52
WP_011888679.1|516321_516663_-	helix-turn-helix transcriptional regulator	NA	J7KJZ4	Streptococcus_phage	85.8	1.2e-48
WP_014635614.1|516860_517073_+	DNA-binding protein	NA	J7KBP9	Streptococcus_phage	95.7	9.2e-31
WP_011888681.1|517100_517820_+	phage antirepressor KilAC domain-containing protein	NA	M1Q1T4	Streptococcus_phage	70.3	7.4e-88
WP_011284879.1|517917_518157_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011054585.1|518323_518509_+	helix-turn-helix transcriptional regulator	NA	A0A1X9I6I3	Streptococcus_phage	72.1	3.3e-16
WP_011888682.1|518579_518831_+	hypothetical protein	NA	A0A1P8VVV6	Streptococcus_phage	97.6	2.6e-40
WP_011017881.1|518861_518999_+	hypothetical protein	NA	A0A097PAR2	Streptococcus_pyogenes_phage	100.0	3.4e-18
WP_011888683.1|519092_519809_+	replication initiator protein A	NA	A0A097PBE7	Streptococcus_pyogenes_phage	93.7	2.9e-129
WP_011888684.1|519795_520578_+	ATP-binding protein	NA	A0A097PAQ0	Streptococcus_pyogenes_phage	97.3	1.0e-143
WP_011285579.1|520718_521072_+	hypothetical protein	NA	A0A097PAU3	Streptococcus_pyogenes_phage	54.0	2.8e-16
WP_011018143.1|521052_521307_+	hypothetical protein	NA	Q938N0	Temperate_phage	98.8	3.7e-42
WP_011018142.1|521328_521811_+	siphovirus Gp157 family protein	NA	Q938M9	Temperate_phage	100.0	8.2e-51
WP_011106686.1|522908_523112_+	hypothetical protein	NA	Q938M6	Temperate_phage	100.0	4.7e-32
WP_011285574.1|523111_523552_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A097PAS0	Streptococcus_pyogenes_phage	97.9	4.5e-80
WP_011284873.1|523548_523905_+	hypothetical protein	NA	A0A097PAU4	Streptococcus_pyogenes_phage	100.0	2.9e-61
WP_002995955.1|524146_524383_+	DUF3310 domain-containing protein	NA	A0A097PAQ7	Streptococcus_pyogenes_phage	100.0	2.4e-40
WP_002995952.1|524379_524550_+	hypothetical protein	NA	Q938M0	Temperate_phage	87.1	7.9e-09
WP_011284869.1|524546_524831_+	hypothetical protein	NA	A0A097PAV1	Streptococcus_pyogenes_phage	86.2	2.6e-36
WP_011888685.1|524832_525465_+	SAM-dependent DNA methyltransferase	NA	L0P368	Streptococcus_phage	68.6	5.1e-85
WP_011888686.1|525469_525949_+	DUF1642 domain-containing protein	NA	A0A141E0J6	Streptococcus_phage	41.9	6.5e-24
WP_002987493.1|525945_526116_+	hypothetical protein	NA	A0A097PAS8	Streptococcus_pyogenes_phage	100.0	2.9e-27
WP_011888687.1|526399_526834_+	ArpU family transcriptional regulator	NA	J7KDQ1	Streptococcus_phage	94.4	1.7e-71
WP_010922073.1|528977_529454_+	hypothetical protein	NA	Q938L4	Temperate_phage	68.4	4.9e-48
WP_010922074.1|529536_530748_+|terminase	PBSX family phage terminase large subunit	terminase	Q938L3	Temperate_phage	99.7	3.7e-225
WP_010922075.1|530761_532264_+|portal	phage portal protein	portal	Q938L2	Temperate_phage	99.6	5.9e-281
WP_010922077.1|533761_533989_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011888689.1|534075_534342_+	hypothetical protein	NA	Q938K9	Temperate_phage	95.5	6.4e-37
WP_011888690.1|534467_535082_+	hypothetical protein	NA	Q938K8	Temperate_phage	93.1	3.8e-93
WP_011888691.1|535085_535904_+|capsid	N4-gp56 family major capsid protein	capsid	Q79S85	Temperate_phage	99.6	2.0e-145
WP_011888692.1|535957_536374_+	hypothetical protein	NA	Q938K7	Temperate_phage	98.2	9.6e-56
WP_011888693.1|536363_536696_+	hypothetical protein	NA	Q79S86	Temperate_phage	99.1	6.2e-58
WP_010922083.1|536695_537052_+	hypothetical protein	NA	Q79S88	Temperate_phage	100.0	4.5e-62
WP_011888694.1|537048_537447_+|capsid	phage capsid protein	capsid	Q79S87	Temperate_phage	98.5	6.5e-70
WP_011018120.1|537446_537908_+	hypothetical protein	NA	Q938K6	Temperate_phage	78.8	1.9e-60
WP_011888695.1|537951_538386_+	hypothetical protein	NA	Q938K5	Temperate_phage	97.9	4.2e-70
WP_011888696.1|538389_538971_+	hypothetical protein	NA	Q938K4	Temperate_phage	94.3	1.0e-100
WP_011888697.1|542211_542928_+|tail	phage tail family protein	tail	Q938K2	Temperate_phage	99.2	1.2e-135
WP_011888698.1|542924_545069_+|tail	phage tail protein	tail	Q938K1	Temperate_phage	95.1	0.0e+00
WP_011017589.1|545065_546076_+	hyaluronoglucosaminidase	NA	Q938K0	Temperate_phage	75.8	7.8e-136
WP_002983467.1|547985_548417_+	DUF1617 family protein	NA	Q938J8	Temperate_phage	89.5	1.3e-63
WP_011888699.1|548419_549052_+	hypothetical protein	NA	Q938J7	Temperate_phage	48.6	3.2e-42
WP_011184730.1|549061_549517_+|holin	phage holin family protein	holin	A0A0M4R3G6	Streptococcus_phage	81.5	2.3e-63
WP_011888700.1|549628_550834_+	glucosaminidase domain-containing protein	NA	Q938J4	Temperate_phage	83.5	1.8e-203
WP_011017840.1|550973_551498_+	DUF4065 domain-containing protein	NA	Q938J3	Temperate_phage	100.0	4.0e-99
WP_011888701.1|551485_552352_+	DUF334 domain-containing protein	NA	Q938J2	Temperate_phage	99.7	1.1e-133
WP_011888702.1|552401_552836_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011285611.1|553107_553908_-	streptodornase Sda3	NA	NA	NA	NA	NA
WP_011184907.1|554145_554328_+	hypothetical protein	NA	A3F673	Streptococcus_phage	83.3	4.4e-21
WP_011888703.1|554518_555874_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	33.2	5.1e-74
>prophage 2
NC_009332	Streptococcus pyogenes str. Manfredo, complete genome	1841271	631030	693862	1841271	transposase,tRNA,tail,protease,terminase,portal,integrase,capsid	Streptococcus_phage(56.45%)	81	654418:654437	690403:690422
WP_011888738.1|631030_633832_+|tRNA	isoleucine--tRNA ligase	tRNA	H2EEZ0	Moumouvirus	26.7	2.1e-69
WP_002983878.1|634095_634398_-	DUF1827 family protein	NA	NA	NA	NA	NA
WP_002989103.1|634448_634904_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_011888739.1|635031_637314_-|protease	ATP-dependent Clp protease ATP-binding subunit	protease	A0A2C9CYX3	Yersinia_phage	39.7	8.3e-125
WP_002983885.1|637611_637842_+	YkuJ family protein	NA	NA	NA	NA	NA
WP_002983887.1|637968_638655_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_011888740.1|638654_639389_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.8	1.6e-34
WP_011888741.1|639537_640947_+	deoxyribodipyrimidine photo-lyase	NA	A0A1V0SGL1	Hokovirus	33.1	2.6e-60
WP_011888742.1|640956_641955_-|transposase	IS30-like element IS1239 family transposase	transposase	H7BW61	unidentified_phage	34.6	1.0e-31
WP_011888743.1|642210_643905_+	phospho-sugar mutase	NA	A0A1X9I671	Streptococcus_phage	42.4	2.7e-128
WP_002989114.1|644112_644967_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase	NA	A0A249XZQ2	Enterococcus_phage	39.4	4.4e-39
WP_011017997.1|645119_646460_+	exodeoxyribonuclease VII large subunit	NA	A0A1V0SIT1	Klosneuvirus	30.9	8.2e-40
WP_002983901.1|646437_646653_+	exodeoxyribonuclease VII small subunit	NA	NA	NA	NA	NA
WP_011888744.1|646652_647525_+	polyprenyl synthetase family protein	NA	NA	NA	NA	NA
WP_011017996.1|647517_648345_+	TlyA family RNA methyltransferase	NA	NA	NA	NA	NA
WP_002983907.1|648331_648802_+	arginine repressor	NA	NA	NA	NA	NA
WP_011017995.1|648822_650484_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_011888745.1|650655_651594_+	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_002983913.1|651809_652661_+	DegV family protein	NA	A0A0N9SI50	Staphylococcus_phage	35.7	5.4e-13
WP_011888746.1|652653_653496_+	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
WP_002989129.1|653473_654061_+	YpmS family protein	NA	NA	NA	NA	NA
WP_002983920.1|654159_654435_+	HU family DNA-binding protein	NA	A7KV42	Bacillus_phage	73.0	2.6e-25
654418:654437	attL	AAAGACGCTGTTAAATAATT	NA	NA	NA	NA
WP_003051793.1|654524_655667_-|integrase	site-specific integrase	integrase	M1NRJ9	Streptococcus_phage	77.4	2.4e-173
WP_011285632.1|655790_656057_-	DUF4177 domain-containing protein	NA	NA	NA	NA	NA
WP_011888747.1|656068_656455_-	hypothetical protein	NA	M1PFJ2	Streptococcus_phage	55.5	3.3e-34
WP_011888748.1|656457_656808_-	helix-turn-helix transcriptional regulator	NA	C5J980	Streptococcus_phage	62.6	1.1e-33
WP_011888749.1|657115_657331_+	hypothetical protein	NA	M1Q1B4	Streptococcus_phage	81.2	4.1e-26
WP_011888751.1|657840_658026_+	helix-turn-helix transcriptional regulator	NA	J7KH19	Streptococcus_phage	85.2	8.1e-23
WP_002990080.1|658104_658416_+	hypothetical protein	NA	A0A1S5SA25	Streptococcus_phage	78.4	4.1e-43
WP_011888752.1|658417_658603_+	hypothetical protein	NA	Q938N3	Temperate_phage	91.8	1.8e-22
WP_002985388.1|659120_659507_+	DnaD domain-containing protein	NA	Q938N2	Temperate_phage	55.0	2.8e-25
WP_002985387.1|659487_659721_+	hypothetical protein	NA	Q938N1	Temperate_phage	94.8	6.1e-36
WP_011017992.1|659717_659858_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011017565.1|659866_660073_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011888754.1|660128_660458_+	hypothetical protein	NA	J7KGX3	Streptococcus_phage	87.2	3.8e-47
WP_011888755.1|660460_661237_+	phage recombination protein Bet	NA	A0A1S5SFP4	Streptococcus_phage	81.5	1.3e-114
WP_011888756.1|661246_662275_+	DUF1351 domain-containing protein	NA	E8ZD61	Streptococcus_phage	65.9	9.5e-121
WP_011888757.1|662470_662812_+	hypothetical protein	NA	M1NS23	Streptococcus_phage	38.7	3.1e-12
WP_011888758.1|662808_663321_+	hypothetical protein	NA	Q708P9	Streptococcus_phage	76.8	2.1e-65
WP_011888759.1|663520_663763_+	hypothetical protein	NA	A7J287	Streptococcus_phage	73.8	1.6e-23
WP_011888760.1|663752_664517_+	site-specific DNA-methyltransferase	NA	Q9MCL7	Streptococcus_virus	89.4	1.8e-129
WP_011888761.1|664564_664858_+	hypothetical protein	NA	A0A097PAR1	Streptococcus_pyogenes_phage	97.9	3.0e-48
WP_011888762.1|664854_665376_+	DUF1642 domain-containing protein	NA	Q938L9	Temperate_phage	77.5	1.5e-69
WP_002987493.1|665372_665543_+	hypothetical protein	NA	A0A097PAS8	Streptococcus_pyogenes_phage	100.0	2.9e-27
WP_011888763.1|665809_666229_+	DUF1492 domain-containing protein	NA	A0A1X9I5B5	Streptococcus_phage	79.9	1.9e-56
WP_010922469.1|666337_666682_+	HNH endonuclease	NA	M1Q0W7	Streptococcus_phage	68.5	5.5e-41
WP_002994106.1|666830_667187_+	hypothetical protein	NA	M1PRL3	Streptococcus_phage	57.8	2.4e-07
WP_011017979.1|667183_668452_+|portal	phage portal protein	portal	A0A1X9I693	Streptococcus_phage	76.2	2.4e-190
WP_011017978.1|668444_669938_+	hypothetical protein	NA	M1Q184	Streptococcus_phage	55.6	3.7e-89
WP_002994100.1|669943_670168_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011054687.1|670244_670397_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002986828.1|670389_670656_+	hypothetical protein	NA	Q938K9	Temperate_phage	95.5	6.4e-37
WP_011888764.1|670657_670894_+	hypothetical protein	NA	M1IRA5	Streptococcus_phage	80.3	1.2e-31
WP_011888765.1|670975_672391_+|terminase	terminase	terminase	A0A0B5A091	Streptococcus_phage	75.1	8.2e-216
WP_011888766.1|672461_672923_+	DUF4355 domain-containing protein	NA	M1Q1L0	Streptococcus_phage	52.6	1.7e-37
WP_011888767.1|672947_673859_+|capsid	phage major capsid protein	capsid	M1PFL0	Streptococcus_phage	66.7	1.4e-112
WP_010922460.1|673858_674059_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011054682.1|674068_674491_+	hypothetical protein	NA	A0A0B5A2F6	Streptococcus_phage	67.2	8.2e-47
WP_011054681.1|674450_674789_+	hypothetical protein	NA	A0A0B5A086	Streptococcus_phage	75.0	8.1e-45
WP_000032787.1|674781_675018_+	hypothetical protein	NA	A0A1P8BMT2	Lactococcus_phage	66.7	2.5e-21
WP_000573598.1|675018_675354_+	hypothetical protein	NA	A0A1P8BMR5	Lactococcus_phage	64.9	9.8e-35
WP_011888768.1|675365_675944_+	hypothetical protein	NA	A0A1X9I5X2	Streptococcus_phage	62.9	2.9e-58
WP_010922455.1|675954_676218_+	hypothetical protein	NA	A0A0B5A2F3	Streptococcus_phage	55.8	1.0e-18
WP_011528785.1|676232_676604_+	DUF5361 domain-containing protein	NA	M1PL84	Streptococcus_phage	59.2	1.2e-33
WP_011888769.1|676603_678961_+	hypothetical protein	NA	M1NRG5	Streptococcus_phage	50.9	2.5e-145
WP_011888770.1|678957_679653_+	hypothetical protein	NA	M1Q167	Streptococcus_phage	37.7	4.2e-40
WP_041174190.1|679634_681611_+|tail	phage tail protein	tail	M1PKG3	Streptococcus_phage	49.1	2.2e-97
WP_011888772.1|681607_682624_+	hyaluronoglucosaminidase	NA	Q938K0	Temperate_phage	81.4	4.5e-147
WP_011888773.1|682638_684423_+	hypothetical protein	NA	Q938J9	Temperate_phage	48.3	2.6e-97
WP_011888774.1|684434_684863_+	DUF1617 family protein	NA	Q938J8	Temperate_phage	88.6	2.4e-62
WP_011888775.1|684865_685498_+	hypothetical protein	NA	Q938J7	Temperate_phage	49.5	2.9e-43
WP_002988799.1|685508_685808_+	hypothetical protein	NA	Q938J6	Temperate_phage	82.3	3.5e-36
WP_011888776.1|685804_685990_+	hypothetical protein	NA	Q938J5	Temperate_phage	91.8	1.2e-23
WP_011888778.1|686103_687327_+	glucosaminidase domain-containing protein	NA	A0A1P8VVM5	Streptococcus_phage	60.5	3.7e-164
WP_011888780.1|687613_688585_+	Abi family protein	NA	A0A059NT88	Lactococcus_phage	42.3	3.3e-75
WP_011888781.1|688768_688969_+	CsbD family protein	NA	J7KJ36	Streptococcus_phage	81.8	5.3e-20
WP_011888782.1|689190_689985_+	DNA/RNA non-specific endonuclease	NA	A7J2B8	Streptococcus_phage	35.6	8.9e-26
WP_011888783.1|690050_690233_+	hypothetical protein	NA	A3F673	Streptococcus_phage	81.7	1.1e-21
WP_011888784.1|690764_692627_+	cadmium-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	34.1	7.0e-90
690403:690422	attR	AAAGACGCTGTTAAATAATT	NA	NA	NA	NA
WP_011017962.1|692698_692872_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011888785.1|692926_693862_-	dihydroorotate oxidase	NA	A0A1V0SH91	Hokovirus	45.5	7.9e-66
>prophage 3
NC_009332	Streptococcus pyogenes str. Manfredo, complete genome	1841271	1010354	1072678	1841271	transposase,head,tail,terminase,portal,integrase,capsid	Streptococcus_phage(70.59%)	67	1030089:1030137	1069906:1069954
WP_111677588.1|1010354_1010516_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_011888918.1|1010819_1012583_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	25.3	2.6e-33
WP_011017711.1|1012913_1014323_-	dihydrolipoamide acetyltransferase	NA	NA	NA	NA	NA
WP_041174208.1|1014507_1015506_-	alpha-ketoacid dehydrogenase subunit beta	NA	NA	NA	NA	NA
WP_002989983.1|1015564_1016533_-	thiamine pyrophosphate-dependent dehydrogenase E1 component subunit alpha	NA	NA	NA	NA	NA
WP_011888920.1|1016817_1018725_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	30.9	3.4e-55
WP_011017709.1|1018770_1019097_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002984871.1|1019126_1019912_-	esterase family protein	NA	NA	NA	NA	NA
WP_002984872.1|1020044_1021706_-	ribonuclease J	NA	NA	NA	NA	NA
WP_011017707.1|1021909_1022668_-	ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	28.3	5.9e-11
WP_002991975.1|1022664_1023534_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_011184452.1|1023878_1024877_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_011888922.1|1025230_1026883_+	PavA family fibronectin-binding protein Fbp54	NA	A0A1J0F9J4	Only_Syngen_Nebraska_virus	41.0	1.7e-07
WP_002984878.1|1026941_1028189_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_002990002.1|1028178_1029360_-	AI-2E family transporter	NA	NA	NA	NA	NA
WP_011017701.1|1029417_1029894_-	8-oxo-dGTP diphosphatase	NA	NA	NA	NA	NA
1030089:1030137	attL	TTGATATGACAAGGTTCTTTAATGTTTTATTTAATCACTTCTTGAGTTT	NA	NA	NA	NA
WP_010922229.1|1030497_1031208_-	streptococcal pyrogenic exotoxin SpeH	NA	NA	NA	NA	NA
WP_011888923.1|1032183_1033518_-	lysin	NA	Q5MY96	Streptococcus_phage	92.8	5.0e-247
WP_002990010.1|1033629_1033815_-	hypothetical protein	NA	Q938J5	Temperate_phage	95.1	1.9e-24
WP_002990012.1|1033811_1034108_-	hypothetical protein	NA	Q938J6	Temperate_phage	98.0	3.7e-46
WP_011888924.1|1034117_1034750_-	hypothetical protein	NA	Q938J7	Temperate_phage	50.0	5.2e-45
WP_011888925.1|1034752_1035181_-	DUF1617 family protein	NA	Q938J8	Temperate_phage	82.1	3.1e-57
WP_011888926.1|1035192_1037079_-	gp58-like family protein	NA	Q938J9	Temperate_phage	82.3	1.7e-208
WP_011888927.1|1037093_1038209_-	hyaluronoglucosaminidase	NA	Q938K0	Temperate_phage	74.9	1.6e-142
WP_011888928.1|1038205_1040185_-|tail	phage tail protein	tail	A7J2A7	Streptococcus_phage	92.8	0.0e+00
WP_011054865.1|1040194_1041037_-	hypothetical protein	NA	A7J2A6	Streptococcus_phage	97.9	8.8e-157
WP_011888929.1|1041048_1045431_-	tape measure protein	NA	A7J2A5	Streptococcus_phage	75.2	2.5e-226
WP_011888930.1|1045445_1045679_-	hypothetical protein	NA	A7J2A4	Streptococcus_phage	98.7	1.3e-33
WP_011888931.1|1045753_1046209_-	hypothetical protein	NA	A7J2A3	Streptococcus_phage	99.3	5.3e-76
WP_011054869.1|1046262_1046862_-|tail	phage major tail protein, TP901-1 family	tail	A7J2A2	Streptococcus_phage	97.1	1.7e-90
WP_011054870.1|1046873_1047233_-	hypothetical protein	NA	A7J2A1	Streptococcus_phage	98.3	1.2e-57
WP_011106640.1|1047236_1047581_-	HK97 gp10 family phage protein	NA	A7J2A0	Streptococcus_phage	98.2	5.1e-55
WP_011054872.1|1047577_1047856_-	hypothetical protein	NA	A7J299	Streptococcus_phage	100.0	1.9e-47
WP_011888932.1|1047866_1048223_-|head,tail	phage head-tail connector protein	head,tail	A7J298	Streptococcus_phage	99.2	7.9e-59
WP_002983429.1|1048234_1049122_-	hypothetical protein	NA	A7J297	Streptococcus_phage	100.0	2.1e-161
WP_011888933.1|1049134_1049704_-	DUF4355 domain-containing protein	NA	A7J296	Streptococcus_phage	100.0	1.9e-83
WP_011888934.1|1049865_1050132_-	hypothetical protein	NA	Q938K9	Temperate_phage	96.6	2.9e-37
WP_011054876.1|1050136_1050325_-	hypothetical protein	NA	A7J294	Streptococcus_phage	100.0	7.4e-24
WP_032465703.1|1050352_1051801_-|capsid	minor capsid protein	capsid	A7J293	Streptococcus_phage	99.8	1.2e-278
WP_011888936.1|1051760_1053293_-|portal	phage portal protein	portal	A7J292	Streptococcus_phage	99.6	2.2e-291
WP_011888937.1|1053308_1054586_-|terminase	PBSX family phage terminase large subunit	terminase	A7J291	Streptococcus_phage	99.8	6.9e-246
WP_011106637.1|1054575_1055028_-|terminase	terminase small subunit	terminase	A7J290	Streptococcus_phage	100.0	6.9e-76
WP_011888938.1|1055117_1055534_-	transcriptional regulator	NA	A7J289	Streptococcus_phage	98.6	9.5e-72
WP_011054882.1|1055666_1055939_-	hypothetical protein	NA	A7J287	Streptococcus_phage	73.3	5.7e-25
WP_023079587.1|1055931_1056102_-	hypothetical protein	NA	A7J285	Streptococcus_phage	98.1	2.8e-22
WP_011888939.1|1056102_1057425_-	DEAD/DEAH box helicase family protein	NA	A7J284	Streptococcus_phage	97.3	5.6e-251
WP_011054885.1|1057421_1057697_-	VRR-NUC domain-containing protein	NA	A7J283	Streptococcus_phage	96.7	2.9e-45
WP_011888940.1|1058082_1060467_-	DNA primase	NA	A7J282	Streptococcus_phage	94.2	1.6e-275
WP_011888941.1|1060471_1062394_-	DNA polymerase	NA	A7J280	Streptococcus_phage	99.1	0.0e+00
WP_086934854.1|1062436_1063000_-	DUF2815 family protein	NA	D2J040	Enterococcus_phage	58.5	3.3e-51
WP_011888943.1|1063008_1064166_-	DUF2800 domain-containing protein	NA	A7J278	Streptococcus_phage	98.2	1.0e-216
WP_002988708.1|1064165_1064465_-	hypothetical protein	NA	A7J277	Streptococcus_phage	100.0	1.8e-43
WP_002983407.1|1064552_1064756_-	hypothetical protein	NA	A7J276	Streptococcus_phage	100.0	9.4e-33
WP_012560645.1|1064901_1065288_-	hypothetical protein	NA	A7J274	Streptococcus_phage	89.0	4.3e-58
WP_012560644.1|1065284_1065488_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011888947.1|1065480_1065651_-	hypothetical protein	NA	A7J273	Streptococcus_phage	89.3	1.2e-20
WP_011888948.1|1065652_1065964_-	hypothetical protein	NA	A1EAC3	Streptococcus_phage	86.3	5.0e-49
WP_001112862.1|1066042_1066234_-	hypothetical protein	NA	A0A141DZR9	Streptococcus_phage	69.8	4.7e-18
WP_011888949.1|1066284_1067073_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011888950.1|1067098_1067269_-	hypothetical protein	NA	X2L066	Streptococcus_phage	55.8	5.1e-08
WP_011888951.1|1067564_1067915_+	helix-turn-helix transcriptional regulator	NA	M1PKY8	Streptococcus_phage	62.6	1.6e-35
WP_011888952.1|1067917_1068304_+	hypothetical protein	NA	M1PFJ2	Streptococcus_phage	55.5	7.3e-34
WP_011285632.1|1068315_1068582_+	DUF4177 domain-containing protein	NA	NA	NA	NA	NA
WP_011888953.1|1068709_1069849_+|integrase	site-specific integrase	integrase	A1EAB7	Streptococcus_phage	56.3	1.2e-119
WP_002984881.1|1069931_1070972_-	dTDP-glucose 4,6-dehydratase	NA	A0A1D7XFE8	Escherichia_phage	43.9	1.1e-68
1069906:1069954	attR	TTGATATGACAAGGTTCTTTAATGTTTTATTTAATCACTTCTTGAGTTT	NA	NA	NA	NA
WP_002990099.1|1071215_1071809_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	H9NC63	Sphingomonas_phage	28.2	3.7e-08
WP_002992970.1|1071808_1072678_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	K7QKA7	Escherichia_phage	64.6	2.4e-101
>prophage 4
NC_009332	Streptococcus pyogenes str. Manfredo, complete genome	1841271	1175890	1186493	1841271		Streptococcus_phage(57.14%)	9	NA	NA
WP_011889000.1|1175890_1177033_-	cysteine desulfurase	NA	A0A1X6WFP1	Pacmanvirus	27.5	6.3e-25
WP_011889001.1|1177267_1177708_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011889002.1|1177737_1179006_+	bifunctional folylpolyglutamate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_011889003.1|1179093_1180446_-	glutathione-disulfide reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	24.7	1.0e-29
WP_002985134.1|1180666_1181008_-	YlbF/YmcA family competence regulator	NA	A0A1X9I5Y8	Streptococcus_phage	40.2	5.9e-19
WP_011889004.1|1181068_1182235_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	32.8	5.8e-34
WP_002985140.1|1182328_1183015_-	type I 3-dehydroquinate dehydratase	NA	W6LP76	Streptococcus_phage	68.9	7.0e-88
WP_011889005.1|1183011_1184175_-	class I SAM-dependent rRNA methyltransferase	NA	W6LLI2	Streptococcus_phage	65.1	2.6e-143
WP_011889006.1|1184282_1186493_+	LTA synthase family protein	NA	W6LM83	Streptococcus_phage	68.9	6.5e-268
>prophage 5
NC_009332	Streptococcus pyogenes str. Manfredo, complete genome	1841271	1221921	1314683	1841271	head,tRNA,holin,tail,protease,terminase,portal,capsid	Streptococcus_phage(53.97%)	104	NA	NA
WP_011889021.1|1221921_1224327_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_003057440.1|1224536_1225580_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	34.3	4.6e-30
WP_011017613.1|1226761_1226950_-	DNA-directed RNA polymerase subunit beta	NA	NA	NA	NA	NA
WP_002994428.1|1226953_1228225_-	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_011889022.1|1228289_1228547_-	DUF1146 domain-containing protein	NA	NA	NA	NA	NA
WP_002994425.1|1228812_1229229_-	F0F1 ATP synthase subunit epsilon	NA	NA	NA	NA	NA
WP_003057452.1|1229241_1230648_-	F0F1 ATP synthase subunit beta	NA	NA	NA	NA	NA
WP_002985236.1|1230810_1231686_-	F0F1 ATP synthase subunit gamma	NA	NA	NA	NA	NA
WP_011889023.1|1231704_1233210_-	F0F1 ATP synthase subunit alpha	NA	NA	NA	NA	NA
WP_002985240.1|1233225_1233762_-	F0F1 ATP synthase subunit delta	NA	NA	NA	NA	NA
WP_002985242.1|1233761_1234256_-	F0F1 ATP synthase subunit B	NA	NA	NA	NA	NA
WP_011889024.1|1234273_1234990_-	F0F1 ATP synthase subunit A	NA	NA	NA	NA	NA
WP_002985249.1|1235024_1235222_-	F0F1 ATP synthase subunit C	NA	NA	NA	NA	NA
WP_011017609.1|1235613_1236636_-	diacylglycerol kinase family lipid kinase	NA	A0A1V0SBJ0	Catovirus	27.9	3.6e-19
WP_011017608.1|1236649_1238608_-	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	34.9	9.9e-103
WP_011017607.1|1238801_1239302_-	QueT transporter family protein	NA	E7DN70	Pneumococcus_phage	32.4	5.4e-05
WP_011889025.1|1239579_1242312_-	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_011889027.1|1242884_1244003_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_002985266.1|1243999_1245127_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_002990429.1|1245135_1246059_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	38.1	6.7e-33
WP_002985270.1|1246081_1246765_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002985272.1|1246761_1247433_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_011889028.1|1247407_1248766_-	YcaO-like family protein	NA	NA	NA	NA	NA
WP_002985275.1|1248785_1249844_-	streptolysin associated protein SagC	NA	NA	NA	NA	NA
WP_002990438.1|1249840_1250791_-	streptolysin S biosynthesis dehydrogenase SagB	NA	NA	NA	NA	NA
WP_002985285.1|1251012_1251174_-	TOMM family cytolysin streptolysin S	NA	NA	NA	NA	NA
WP_002985288.1|1251943_1253251_-	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	96.6	1.2e-240
WP_011889029.1|1253477_1253939_+	YueI family protein	NA	W6LLD2	Streptococcus_phage	39.5	1.1e-17
WP_011017601.1|1254070_1255795_-	septation ring formation regulator EzrA	NA	NA	NA	NA	NA
WP_011889030.1|1256162_1258115_-	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	45.9	8.9e-144
WP_002994056.1|1258115_1258685_-	hydrolase	NA	NA	NA	NA	NA
WP_002985298.1|1259699_1260047_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_011889031.1|1260161_1261424_-	chloride channel protein	NA	A0A1X9I5Z9	Streptococcus_phage	50.5	3.2e-94
WP_011889032.1|1261416_1261701_-	chorismate mutase	NA	NA	NA	NA	NA
WP_002985303.1|1261875_1262325_-	flavodoxin	NA	NA	NA	NA	NA
WP_011017597.1|1262718_1263660_+	bifunctional oligoribonuclease/PAP phosphatase NrnA	NA	NA	NA	NA	NA
WP_002985307.1|1263774_1264035_+	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_011889033.1|1264131_1265331_-	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_011889034.1|1265350_1266073_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011889035.1|1266229_1267777_-	zinc ABC transporter substrate-binding protein AdcA	NA	NA	NA	NA	NA
WP_038433138.1|1267928_1269347_-	C69 family dipeptidase	NA	NA	NA	NA	NA
WP_002985324.1|1269658_1270417_+	DNase Mf2	NA	NA	NA	NA	NA
WP_002985327.1|1270527_1271235_+	streptococcal pyrogenic exotoxin SpeC	NA	A0A097PAT7	Streptococcus_pyogenes_phage	27.1	3.9e-09
WP_002985329.1|1271302_1272508_-	glucosaminidase domain-containing protein	NA	Q938J4	Temperate_phage	83.3	1.6e-204
WP_000609113.1|1272623_1272851_-|holin	phage holin	holin	A7J2B3	Streptococcus_phage	98.7	5.8e-31
WP_002987582.1|1272847_1273123_-	hypothetical protein	NA	A7J2B2	Streptococcus_phage	100.0	2.6e-41
WP_011017592.1|1273132_1273750_-	DUF1366 domain-containing protein	NA	Q938J7	Temperate_phage	89.3	5.0e-77
WP_002983467.1|1273752_1274184_-	DUF1617 family protein	NA	Q938J8	Temperate_phage	89.5	1.3e-63
WP_011889036.1|1274195_1276082_-	gp58-like family protein	NA	Q938J9	Temperate_phage	84.6	3.4e-217
WP_011017589.1|1276094_1277105_-	hyaluronoglucosaminidase	NA	Q938K0	Temperate_phage	75.8	7.8e-136
WP_011527560.1|1277101_1279246_-|tail	phage tail protein	tail	Q938K1	Temperate_phage	94.7	0.0e+00
WP_011527559.1|1279242_1279950_-|tail	phage tail family protein	tail	Q938K2	Temperate_phage	71.9	6.8e-94
WP_002985338.1|1279949_1283873_-|tail	phage tail tape measure protein	tail	J7KDT4	Streptococcus_phage	48.5	1.9e-238
WP_021299462.1|1283885_1284035_-	hypothetical protein	NA	J7KBS0	Streptococcus_phage	85.7	1.7e-15
WP_011017586.1|1284082_1284409_-	hypothetical protein	NA	J7KK85	Streptococcus_phage	75.0	8.3e-39
WP_011017585.1|1284461_1285070_-	hypothetical protein	NA	J7KKC8	Streptococcus_phage	71.9	6.7e-74
WP_011017584.1|1285085_1285511_-	hypothetical protein	NA	J7KBZ9	Streptococcus_phage	84.4	7.2e-67
WP_011527557.1|1285507_1285885_-	HK97 gp10 family phage protein	NA	J7KDM3	Streptococcus_phage	72.8	1.8e-45
WP_011017582.1|1285881_1286229_-|head	phage head closure protein	head	J7KJ42	Streptococcus_phage	88.2	2.9e-50
WP_011017581.1|1286225_1286528_-|head,tail	phage head-tail connector protein	head,tail	J7KC36	Streptococcus_phage	88.8	1.3e-41
WP_011017580.1|1286672_1287860_-|capsid	phage major capsid protein	capsid	J7KJ82	Streptococcus_phage	74.7	1.3e-158
WP_011017579.1|1287884_1288550_-|protease	Clp protease ClpP	protease	M1Q115	Streptococcus_phage	78.1	3.5e-92
WP_011017578.1|1288527_1289748_-|portal	phage portal protein	portal	J7KDU3	Streptococcus_phage	81.9	6.9e-187
WP_002985363.1|1289781_1290006_-	hypothetical protein	NA	Q938K9	Temperate_phage	61.4	3.6e-17
WP_002985365.1|1289998_1290169_-	hypothetical protein	NA	J7KK43	Streptococcus_phage	62.5	2.3e-08
WP_024623442.1|1290165_1291920_-	amino acid transporter	NA	J7KKD1	Streptococcus_phage	96.1	0.0e+00
WP_002985368.1|1291923_1292154_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002985371.1|1292156_1292624_-|terminase	phage terminase small subunit P27 family	terminase	J7KC46	Streptococcus_phage	98.7	3.9e-82
WP_002985375.1|1292794_1293133_-	HNH endonuclease	NA	J7KH36	Streptococcus_phage	90.7	3.0e-55
WP_001132273.1|1293368_1293554_+	type II toxin-antitoxin system HicA family toxin	NA	D6PSW1	Lactobacillus_phage	54.0	1.7e-09
WP_002987543.1|1293605_1293983_+	type II toxin-antitoxin system HicB family antitoxin	NA	I3NLB2	Bifidobacterium_phage	44.0	3.3e-15
WP_011017575.1|1294109_1295039_-	DNA adenine methylase	NA	A0A126HAU2	Lactococcus_phage	71.8	4.9e-100
WP_011017574.1|1295621_1296059_-	DUF1492 domain-containing protein	NA	A0A097PBF1	Streptococcus_pyogenes_phage	97.9	6.7e-76
WP_002987471.1|1296328_1296964_-	SAM-dependent DNA methyltransferase	NA	L0P368	Streptococcus_phage	67.9	5.5e-87
WP_002987468.1|1296963_1297365_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011017571.1|1297555_1298038_-	class I SAM-dependent methyltransferase	NA	A0A097PAU8	Streptococcus_pyogenes_phage	98.8	9.6e-92
WP_011889038.1|1298041_1298326_-	hypothetical protein	NA	A0A097PAV1	Streptococcus_pyogenes_phage	88.3	1.0e-37
WP_011017569.1|1298322_1298736_-	hypothetical protein	NA	Q938M1	Temperate_phage	65.2	6.4e-36
WP_002987593.1|1298745_1299015_-	hypothetical protein	NA	A0A1P8VVR6	Streptococcus_phage	100.0	3.1e-47
WP_011017568.1|1299011_1299296_-	DUF3310 domain-containing protein	NA	A0A1P8VVP5	Streptococcus_phage	100.0	7.0e-50
WP_002985380.1|1299473_1299986_-	hypothetical protein	NA	Q708P9	Streptococcus_phage	73.2	8.4e-62
WP_002985383.1|1299982_1300324_-	hypothetical protein	NA	M1NS23	Streptococcus_phage	38.7	3.1e-12
WP_002988362.1|1300500_1301298_-	PD-(D/E)XK nuclease-like domain-containing protein	NA	J7KGZ1	Streptococcus_phage	83.8	6.6e-130
WP_000594115.1|1301290_1301491_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010922474.1|1301487_1302477_-	recombinase RecT	NA	A0A286QMX3	Streptococcus_phage	44.2	5.8e-59
WP_010922475.1|1302476_1302809_-	hypothetical protein	NA	J7KGX3	Streptococcus_phage	78.7	2.2e-42
WP_011017565.1|1302864_1303071_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011017992.1|1303079_1303220_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002985387.1|1303216_1303450_-	hypothetical protein	NA	Q938N1	Temperate_phage	94.8	6.1e-36
WP_002985388.1|1303430_1303817_-	DnaD domain-containing protein	NA	Q938N2	Temperate_phage	55.0	2.8e-25
WP_002985392.1|1304314_1304500_-	hypothetical protein	NA	Q938N3	Temperate_phage	83.6	2.0e-21
WP_002985395.1|1304501_1304639_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011889039.1|1304725_1304908_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002985404.1|1305048_1305810_-	phage repressor protein/antirepressor Ant	NA	A0A0C5AEJ9	Bacteriophage	61.9	1.6e-85
WP_002985407.1|1305858_1306047_-	helix-turn-helix transcriptional regulator	NA	A0A0B5A7F0	Streptococcus_phage	63.3	2.6e-13
WP_001008979.1|1306098_1306740_+	hypothetical protein	NA	J7KJ31	Streptococcus_phage	100.0	1.5e-116
WP_002985414.1|1306838_1306997_-	hypothetical protein	NA	J7KH24	Streptococcus_phage	88.5	7.1e-20
WP_002985417.1|1307356_1308121_+	helix-turn-helix transcriptional regulator	NA	E8ZDN4	Streptococcus_phage	64.5	2.0e-83
WP_002985420.1|1308130_1308436_+	membrane protein	NA	NA	NA	NA	NA
WP_011017563.1|1308558_1309974_+	recombinase family protein	NA	A5GZ62	Lactococcus_phage	47.2	1.4e-109
WP_011017562.1|1310150_1311062_-	DNA-binding protein WhiA	NA	Q7AWZ3	Streptococcus_phage	64.4	2.9e-105
WP_011889040.1|1311058_1312036_-	YvcK family protein	NA	A1IMD5	Streptococcus_phage	73.8	4.0e-137
WP_002985434.1|1312032_1312923_-	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	29.8	8.8e-06
WP_002985437.1|1313336_1314683_-|tRNA	asparagine--tRNA ligase	tRNA	A0A2P1EMB4	Moumouvirus	30.8	1.1e-55
>prophage 6
NC_009332	Streptococcus pyogenes str. Manfredo, complete genome	1841271	1387936	1394433	1841271	portal	Streptococcus_phage(66.67%)	12	NA	NA
WP_023077463.1|1387936_1388614_-	asparagine synthetase A	NA	A0A167RLM0	Powai_lake_megavirus	28.6	3.1e-11
WP_011017510.1|1388637_1388976_-	Fic family protein	NA	NA	NA	NA	NA
WP_009880563.1|1389392_1389701_-	hypothetical protein	NA	Q6DMT0	Streptococcus_phage	62.2	3.7e-20
WP_009880562.1|1389766_1390219_-|portal	phage portal protein	portal	E4ZFM3	Streptococcus_phage	85.6	4.4e-62
WP_002985604.1|1390322_1390595_-	hypothetical protein	NA	E4ZFM1	Streptococcus_phage	50.7	4.1e-07
WP_011889070.1|1390613_1390919_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_002991611.1|1390918_1391221_-	type II toxin-antitoxin system RelB/DinJ family antitoxin	NA	NA	NA	NA	NA
WP_014635353.1|1391275_1391452_-	hypothetical protein	NA	M1PSF2	Streptococcus_phage	86.2	1.2e-20
WP_162009224.1|1391476_1392361_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001176803.1|1392360_1392585_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002990647.1|1393760_1394234_+	DUF2326 domain-containing protein	NA	NA	NA	NA	NA
WP_011889073.1|1394223_1394433_+	helix-turn-helix domain-containing protein	NA	A0A2K5B263	Erysipelothrix_phage	60.0	4.8e-16
>prophage 7
NC_009332	Streptococcus pyogenes str. Manfredo, complete genome	1841271	1451035	1506731	1841271	bacteriocin,tRNA,protease	Streptococcus_phage(33.33%)	57	NA	NA
WP_002985729.1|1451035_1451236_-|bacteriocin	class IIb bacteriocin, lactobin A/cerein 7B family	bacteriocin	NA	NA	NA	NA
WP_002992018.1|1451248_1451476_-|bacteriocin	bacteriocin	bacteriocin	NA	NA	NA	NA
WP_002987564.1|1452670_1452853_-|bacteriocin	class IIb bacteriocin, lactobin A/cerein 7B family	bacteriocin	NA	NA	NA	NA
WP_002994504.1|1452867_1453113_-|bacteriocin	bacteriocin	bacteriocin	NA	NA	NA	NA
WP_002985741.1|1454070_1454547_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_002985743.1|1454566_1455463_-	GTPase Era	NA	NA	NA	NA	NA
WP_002985746.1|1455582_1455990_-	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_002985748.1|1455970_1456468_-	rRNA maturation RNase YbeY	NA	NA	NA	NA	NA
WP_002990783.1|1456626_1457202_-	uracil-DNA glycosylase family protein	NA	NA	NA	NA	NA
WP_002985751.1|1457247_1458300_-	PhoH family protein	NA	W8D063	Erwinia_phage	50.0	1.2e-46
WP_011889097.1|1458458_1460231_-	oleate hydratase	NA	NA	NA	NA	NA
WP_011889098.1|1460545_1461703_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A0E3XB61	Gordonia_phage	40.5	5.4e-16
WP_002985757.1|1461858_1462074_-	YozE family protein	NA	NA	NA	NA	NA
WP_002985759.1|1462070_1462580_-	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_011889099.1|1462652_1463510_-	S1 RNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_002985763.1|1463618_1464176_-	ribosome recycling factor	NA	NA	NA	NA	NA
WP_002985765.1|1464204_1464933_-	UMP kinase	NA	NA	NA	NA	NA
WP_002985768.1|1465254_1465944_-	50S ribosomal protein L1	NA	NA	NA	NA	NA
WP_002990800.1|1466049_1466475_-	50S ribosomal protein L11	NA	NA	NA	NA	NA
WP_086934860.1|1466699_1466996_+	DUF3397 domain-containing protein	NA	NA	NA	NA	NA
WP_011889100.1|1467065_1469471_-	DNA translocase FtsK	NA	S5VNE3	Mycobacterium_phage	51.7	3.8e-88
WP_002985776.1|1469687_1470494_+	peptidylprolyl isomerase	NA	A0A2H4UTF4	Bodo_saltans_virus	36.6	1.5e-20
WP_011889101.1|1470641_1471496_-	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_011889102.1|1471496_1472222_-	metal ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	33.0	4.8e-18
WP_011889103.1|1472285_1473218_-	metal ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_011184242.1|1473363_1474011_+	metal-dependent transcriptional regulator	NA	NA	NA	NA	NA
WP_011184241.1|1474109_1474451_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011889104.1|1474601_1475297_-	5'-methylthioadenosine/adenosylhomocysteine nucleosidase	NA	NA	NA	NA	NA
WP_002990826.1|1475316_1475568_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011889105.1|1475567_1476122_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_011889106.1|1476152_1477535_-	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A2K9L4K9	Tupanvirus	36.4	3.8e-32
WP_002993065.1|1477708_1479046_-	MFS transporter	NA	NA	NA	NA	NA
WP_011889107.1|1479378_1480338_-	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_011889108.1|1480413_1481112_-	3-oxoacyl-ACP reductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	25.2	1.0e-09
WP_002990844.1|1481104_1481341_-	DUF2829 domain-containing protein	NA	NA	NA	NA	NA
WP_011889109.1|1481703_1482204_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023077780.1|1482297_1482549_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011889111.1|1482744_1483209_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011889112.1|1483669_1484422_+	ADP-ribosyltransferase	NA	NA	NA	NA	NA
WP_011054229.1|1484626_1486807_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A8E2R1	Enterococcus_phage	43.2	1.2e-170
WP_002990870.1|1486773_1487262_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	R4JF54	Bacillus_phage	37.5	1.3e-11
WP_011889113.1|1487265_1488279_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	R4TBI6	Mycobacterium_phage	53.0	7.2e-97
WP_011184224.1|1488773_1490774_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SHR2	Klosneuvirus	35.1	4.6e-87
WP_010921939.1|1491013_1491721_-	DUF1275 domain-containing protein	NA	NA	NA	NA	NA
WP_011889116.1|1492492_1497433_-|protease	CXC chemokine-degrading serine protease SpyCEP	protease	NA	NA	NA	NA
WP_011889117.1|1497698_1498880_-	L-lactate oxidase	NA	NA	NA	NA	NA
WP_011889118.1|1499113_1499941_+	exodeoxyribonuclease III	NA	M1PSC0	Streptococcus_phage	79.3	4.5e-129
WP_002995120.1|1500014_1500371_-	arsenate reductase family protein	NA	M1PLC0	Streptococcus_phage	66.7	2.8e-40
WP_009880724.1|1500670_1501300_+	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_011889119.1|1501296_1501713_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002985836.1|1501739_1502603_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	75.0	1.7e-115
WP_002985838.1|1502607_1502931_-	DNA replication initiation control protein YabA	NA	M1PFV3	Streptococcus_phage	59.4	1.3e-28
WP_011017422.1|1503335_1503575_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011889120.1|1503593_1504469_-	DNA polymerase III subunit delta'	NA	M1NSC1	Streptococcus_phage	44.4	1.0e-62
WP_011017420.1|1504486_1505122_-	dTMP kinase	NA	M1PSC7	Streptococcus_phage	63.4	3.5e-65
WP_002985847.1|1505370_1505646_-	YlbG family protein	NA	NA	NA	NA	NA
WP_002985850.1|1506140_1506731_-|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	55.7	2.6e-54
>prophage 8
NC_009332	Streptococcus pyogenes str. Manfredo, complete genome	1841271	1761596	1781322	1841271	tRNA	Streptococcus_phage(60.0%)	22	NA	NA
WP_011889221.1|1761596_1763579_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	30.1	2.3e-62
WP_011889222.1|1765034_1766024_-	DUF3644 domain-containing protein	NA	A0A0N9RUA4	Staphylococcus_phage	47.0	2.8e-77
WP_011889223.1|1766049_1766325_-	helix-turn-helix domain-containing protein	NA	O48392	Streptococcus_phage	44.6	6.4e-16
WP_011889224.1|1766675_1767632_-	helix-turn-helix transcriptional regulator	NA	A0A060QNS7	Streptococcus_phage	39.3	3.6e-13
WP_011889225.1|1767786_1768020_+	helix-turn-helix transcriptional regulator	NA	X2KUC2	Streptococcus_phage	47.0	5.8e-10
WP_011889226.1|1768313_1768646_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011889227.1|1768645_1768837_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003045763.1|1768848_1769178_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011889228.1|1769180_1769453_+	hypothetical protein	NA	A0A1X9I5U9	Streptococcus_phage	58.8	5.2e-18
WP_011889229.1|1769453_1770320_+	primase C-terminal domain-containing protein	NA	A0A1X9I6L2	Streptococcus_phage	73.4	5.2e-120
WP_011889230.1|1770339_1771842_+	DNA primase	NA	Q9AZI5	Lactococcus_phage	37.5	7.0e-64
WP_011889231.1|1772155_1772329_+	hypothetical protein	NA	A0A1X9I5U0	Streptococcus_phage	59.6	5.1e-11
WP_011529113.1|1772334_1772508_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023077351.1|1772509_1773067_+	hypothetical protein	NA	A0A1X9I5U4	Streptococcus_phage	55.7	1.9e-30
WP_011889233.1|1773140_1773629_+	hypothetical protein	NA	A0A1X9I5V2	Streptococcus_phage	57.4	5.1e-48
WP_011889234.1|1774032_1774395_+	DUF1492 domain-containing protein	NA	A0A2H4JFS1	uncultured_Caudovirales_phage	31.6	1.2e-06
WP_011889235.1|1774369_1774753_+	ArpU family transcriptional regulator	NA	A0A286QPF1	Streptococcus_phage	34.7	6.8e-08
WP_011889236.1|1774954_1775617_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011185079.1|1776011_1778567_-	DNA mismatch repair protein MutS	NA	A0A1V0SGG8	Hokovirus	23.3	4.0e-43
WP_011889237.1|1778553_1778760_-	YlbF family regulator	NA	NA	NA	NA	NA
WP_002982171.1|1778902_1779340_-	arginine repressor	NA	NA	NA	NA	NA
WP_002991367.1|1779630_1781322_+|tRNA	arginine--tRNA ligase	tRNA	A0A2I2L3K1	Orpheovirus	32.2	2.4e-73
