The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_008800	Yersinia enterocolitica subsp. enterocolitica 8081, complete genome	4615899	957484	1011295	4615899	head,transposase,tail,tRNA,portal,terminase,integrase,plate,capsid,holin	Cronobacter_phage(50.0%)	57	981208:981230	1012603:1012625
WP_005166743.1|957484_957793_+|transposase	transposase	transposase	Q716C1	Shigella_phage	45.0	2.6e-18
WP_005167422.1|958841_959345_+	recombination regulator RecX	NA	NA	NA	NA	NA
WP_011815643.1|959486_962114_+|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	36.7	1.6e-79
WP_002209449.1|962367_962553_+	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	66.7	3.8e-12
WP_005167426.1|963795_964362_+	fructose-1-phosphate/6-phosphogluconate phosphatase	NA	NA	NA	NA	NA
WP_011815644.1|964358_964787_+	DedA family protein	NA	NA	NA	NA	NA
WP_013649243.1|964830_966429_+	glutamate--cysteine ligase	NA	NA	NA	NA	NA
WP_004877244.1|966595_967111_+	S-ribosylhomocysteine lyase	NA	NA	NA	NA	NA
WP_005167430.1|967197_968475_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_005167431.1|968547_969339_-	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_005167432.1|969504_970866_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_005166006.1|971218_971467_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_005166009.1|971488_972037_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_004393426.1|972075_972816_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_005167434.1|972896_973259_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_005167436.1|973466_974234_-	DUF481 domain-containing protein	NA	NA	NA	NA	NA
WP_005167439.1|974470_975814_-	anaerobic C4-dicarboxylate transporter	NA	NA	NA	NA	NA
WP_011815646.1|976156_976873_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_005167443.1|977107_978187_+	3-deoxy-7-phosphoheptulonate synthase	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.4	2.0e-89
WP_005167445.1|978189_979311_+	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_011815647.1|979670_980828_-	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
981208:981230	attL	TCAATAAAAAACGCGCCCAAAGG	NA	NA	NA	NA
WP_011815648.1|981319_982318_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0F7LBR0	Escherichia_phage	59.9	1.3e-111
WP_011815649.1|982384_982684_-	helix-turn-helix transcriptional regulator	NA	Q1JS29	Enterobacteria_phage	70.7	7.4e-34
WP_011815650.1|982792_983149_+	bacteriophage regulatory protein	NA	NA	NA	NA	NA
WP_042661602.1|983196_983388_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011815652.1|983454_983820_+	phage-like protein	NA	NA	NA	NA	NA
WP_011815653.1|983848_984070_+	DUF2724 domain-containing protein	NA	NA	NA	NA	NA
WP_011815654.1|984078_984429_+	DUF5347 family protein	NA	E5G6L5	Salmonella_phage	32.7	3.3e-09
WP_042661318.1|984499_984736_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011815656.1|984735_985404_+	DUF3850 domain-containing protein	NA	R9TML3	Aeromonas_phage	50.7	2.8e-12
WP_162484185.1|985414_985768_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011815659.1|988353_988602_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011815660.1|988740_989850_+	phage-like membrane protein	NA	NA	NA	NA	NA
WP_011815661.1|989891_990536_+	phage-like membrane protein	NA	NA	NA	NA	NA
WP_011815662.1|990586_990916_-	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_011815663.1|990919_992017_-|portal	phage portal protein	portal	F1BUM7	Cronobacter_phage	61.8	1.3e-123
WP_011815665.1|994052_995009_+|capsid	GPO family capsid scaffolding protein	capsid	A5X9H4	Aeromonas_virus	54.3	1.2e-37
WP_011815666.1|995091_996258_+|capsid	phage major capsid protein, P2 family	capsid	F1BUM2	Cronobacter_phage	50.3	2.1e-84
WP_011815667.1|996272_996926_+|terminase	terminase	terminase	F1BUM0	Cronobacter_phage	43.5	2.2e-46
WP_011815668.1|997059_997512_+|head	head completion/stabilization protein	head	F1BUL8	Cronobacter_phage	48.7	7.3e-33
WP_011815669.1|997508_998045_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_011815670.1|998034_998730_+	hypothetical protein	NA	F1BUL6	Cronobacter_phage	44.3	1.3e-44
WP_011815671.1|998726_999905_+	DUF2586 family protein	NA	F1BUL5	Cronobacter_phage	54.4	6.8e-107
WP_011815672.1|999906_1000365_+	DUF2597 family protein	NA	A5X9I1	Aeromonas_virus	55.3	3.3e-41
WP_042661606.1|1000374_1000689_+|holin	holin	holin	C7BGD7	Burkholderia_phage	44.8	2.0e-13
WP_011815674.1|1000685_1001027_+	M15 family metallopeptidase	NA	F1BUL3	Cronobacter_phage	81.2	9.0e-44
WP_011815675.1|1001026_1001398_+	hypothetical protein	NA	F1BUL2	Cronobacter_phage	40.7	7.6e-12
WP_011815676.1|1001512_1001788_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011815677.1|1001984_1004042_+|tail	phage tail tape measure protein	tail	F1BUK9	Cronobacter_phage	39.7	2.2e-132
WP_011815678.1|1004038_1004365_+	DUF2590 family protein	NA	Q1I0Y6	Pasteurella_virus	57.4	6.6e-28
WP_011815679.1|1004364_1005549_+|plate	baseplate J/gp47 family protein	plate	F1BUK6	Cronobacter_phage	59.9	1.3e-129
WP_011815680.1|1005541_1006165_+	hypothetical protein	NA	F1BUK5	Cronobacter_phage	60.7	1.6e-59
WP_011815681.1|1006174_1007719_+|tail	phage tail protein	tail	F1BUK3	Cronobacter_phage	48.3	3.4e-74
WP_011815682.1|1007718_1008357_+|tail	tail fiber assembly protein	tail	Q9MCR5	Enterobacteria_phage	33.5	2.4e-26
WP_011815683.1|1008346_1009054_+	hypothetical protein	NA	Q94MX8	Haemophilus_virus	25.9	1.3e-12
WP_042661320.1|1009046_1009601_+	hypothetical protein	NA	F1BUJ9	Cronobacter_phage	47.3	7.5e-32
WP_011815685.1|1009597_1011295_+	hypothetical protein	NA	F1BUJ7	Cronobacter_phage	49.6	8.3e-130
1012603:1012625	attR	TCAATAAAAAACGCGCCCAAAGG	NA	NA	NA	NA
>prophage 2
NC_008800	Yersinia enterocolitica subsp. enterocolitica 8081, complete genome	4615899	1577851	1585634	4615899	transposase	Enterobacterial_phage(33.33%)	6	NA	NA
WP_011815979.1|1577851_1579639_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	48.9	6.2e-11
WP_005159352.1|1581063_1581306_-	DinI family protein	NA	K7PKM2	Enterobacterial_phage	70.9	5.1e-25
WP_011815980.1|1581738_1582461_-	LexA family transcriptional regulator	NA	F1C599	Cronobacter_phage	51.9	1.1e-62
WP_011815981.1|1582735_1583215_+	antitermination protein Q	NA	K7PGW2	Enterobacterial_phage	62.4	4.7e-38
WP_005171486.1|1583324_1583603_+	hypothetical protein	NA	H6WRZ3	Salmonella_phage	46.0	2.1e-14
WP_011815982.1|1584440_1585634_+|transposase	IS4 family transposase	transposase	S5FM71	Shigella_phage	61.5	6.8e-139
>prophage 3
NC_008800	Yersinia enterocolitica subsp. enterocolitica 8081, complete genome	4615899	1791979	1889063	4615899	head,transposase,tail,tRNA,portal,terminase,integrase,lysis,plate,capsid,holin	Salmonella_phage(41.03%)	102	1785404:1785419	1898791:1898806
1785404:1785419	attL	CCAGTCAGGCCAGATA	NA	NA	NA	NA
WP_154231222.1|1791979_1793348_+|transposase	IS3-like element IS1664 family transposase	transposase	A0A1B1P773	Bacillus_phage	49.4	2.0e-70
WP_005160102.1|1793398_1793716_-	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_172667459.1|1793778_1794969_-	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	W6LLI2	Streptococcus_phage	26.6	4.6e-26
WP_005170847.1|1795218_1795428_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005160110.1|1795440_1795806_+	DUF1622 domain-containing protein	NA	NA	NA	NA	NA
WP_005170844.1|1795825_1796104_+	acylphosphatase	NA	NA	NA	NA	NA
WP_005170840.1|1796131_1796461_-	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_005170826.1|1798137_1798872_+	LuxR family transcriptional regulator YenR	NA	NA	NA	NA	NA
WP_042661387.1|1798864_1799509_-	acyl-homoserine-lactone synthase	NA	NA	NA	NA	NA
WP_005170821.1|1799808_1800741_+	DMT family transporter	NA	NA	NA	NA	NA
WP_005170818.1|1800851_1802579_-	potassium/proton antiporter	NA	NA	NA	NA	NA
WP_005170817.1|1802898_1803144_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011816063.1|1803354_1804494_-	glucans biosynthesis protein MdoC	NA	NA	NA	NA	NA
WP_011816064.1|1804826_1806380_+	glucan biosynthesis protein G	NA	NA	NA	NA	NA
WP_042661388.1|1806372_1808955_+	glucans biosynthesis glucosyltransferase MdoH	NA	NA	NA	NA	NA
WP_023517650.1|1809047_1809308_+	YceK/YidQ family lipoprotein	NA	NA	NA	NA	NA
WP_023517651.1|1809325_1809760_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011816066.1|1810021_1811557_-	peptide MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	59.4	1.1e-160
WP_011816067.1|1811990_1813235_-	multidrug efflux MFS transporter MdtG	NA	NA	NA	NA	NA
WP_005170794.1|1813530_1813965_-	DoxX family protein	NA	NA	NA	NA	NA
WP_011816068.1|1814332_1815265_-	LpxL/LpxP family Kdo(2)-lipid IV(A) lauroyl/palmitoleoyl acyltransferasee	NA	A0A1W6JP29	Morganella_phage	42.9	1.2e-61
WP_005170790.1|1815508_1816093_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_011816070.1|1816070_1817831_-	PhnD/SsuA/transferrin family substrate-binding protein	NA	NA	NA	NA	NA
WP_005170783.1|1817969_1818704_+	tetrathionate reductase subunit TtrB	NA	A0A077SL61	Escherichia_phage	37.5	4.2e-22
WP_005170780.1|1818700_1819786_+	tetrathionate reductase subunit TtrC	NA	NA	NA	NA	NA
WP_011816071.1|1819778_1822862_+	tetrathionate reductase subunit TtrA	NA	NA	NA	NA	NA
WP_005157903.1|1823002_1823161_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011816072.1|1823338_1824391_+	rhodanese-related sulfurtransferase	NA	NA	NA	NA	NA
WP_005170771.1|1824491_1825553_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_005179400.1|1825632_1825746_-	DUF2770 family protein	NA	NA	NA	NA	NA
WP_005157909.1|1826062_1826647_-	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005170765.1|1826905_1828027_-	N-methyl-L-tryptophan oxidase	NA	NA	NA	NA	NA
WP_005157914.1|1828290_1828545_-	biofilm formation regulator BssS	NA	NA	NA	NA	NA
WP_005157917.1|1828907_1829153_-	DNA damage-inducible protein I	NA	K7PM44	Enterobacteria_phage	52.6	4.1e-14
WP_011816073.1|1829269_1830316_-	dihydroorotase	NA	NA	NA	NA	NA
WP_005170755.1|1830564_1830852_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_193343196.1|1830921_1834443_-	ribonuclease E	NA	NA	NA	NA	NA
WP_005157930.1|1835028_1835988_+	23S rRNA pseudouridine(955/2504/2580) synthase RluC	NA	NA	NA	NA	NA
WP_005170743.1|1836038_1836620_-	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_004709643.1|1836761_1837292_+	23S rRNA accumulation protein YceD	NA	NA	NA	NA	NA
WP_002210931.1|1837297_1837465_+	50S ribosomal protein L32	NA	NA	NA	NA	NA
WP_005170740.1|1837501_1838536_+	phosphate acyltransferase PlsX	NA	NA	NA	NA	NA
WP_005170737.1|1838542_1839508_+	ketoacyl-ACP synthase III	NA	NA	NA	NA	NA
WP_011816075.1|1839561_1840491_+	ACP S-malonyltransferase	NA	NA	NA	NA	NA
WP_004389704.1|1840504_1841239_+	3-oxoacyl-ACP reductase FabG	NA	Q06VL0	Trichoplusia_ni_ascovirus	33.9	3.1e-17
WP_002220787.1|1841392_1841629_+	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	45.6	7.7e-10
WP_011816076.1|1841723_1842962_+	beta-ketoacyl-ACP synthase II	NA	NA	NA	NA	NA
WP_011816077.1|1843199_1844024_+	aminodeoxychorismate lyase	NA	NA	NA	NA	NA
WP_011816078.1|1844085_1845111_+	endolytic transglycosylase MltG	NA	NA	NA	NA	NA
WP_005170710.1|1845100_1845739_+	dTMP kinase	NA	Q2Z0N0	Pseudomonas_phage	34.8	1.9e-26
WP_005170707.1|1845738_1846746_+	DNA polymerase III subunit delta'	NA	NA	NA	NA	NA
WP_011816079.1|1846760_1847570_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_005157966.1|1847877_1849311_+	PTS glucose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_011816081.1|1849791_1850901_-	phage late control D family protein	NA	A0A0M4REC6	Salmonella_phage	67.2	5.4e-130
WP_011816082.1|1851042_1852221_+|tail	phage tail sheath protein	tail	A0A0M4S6M1	Salmonella_phage	67.5	5.2e-155
WP_011816083.1|1852232_1852748_+|tail	phage major tail tube protein	tail	A0A0M5M1I5	Salmonella_phage	71.9	8.8e-67
WP_011816085.1|1852763_1853087_+|tail	phage tail assembly protein	tail	A0A0M4RCV2	Salmonella_phage	61.5	4.9e-23
WP_071881783.1|1853083_1853215_+|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_052491317.1|1853218_1855003_+|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	47.8	2.7e-131
WP_144405160.1|1854981_1856430_+	hypothetical protein	NA	A0A0M4R2V3	Salmonella_phage	31.7	2.7e-36
WP_011816086.1|1856432_1856843_+|tail	phage tail protein	tail	A0A1J0I2L5	Salmonella_phage	60.9	7.0e-43
WP_011816087.1|1856944_1857232_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011816088.1|1857368_1857551_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042661390.1|1857642_1857837_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011816090.1|1857890_1858259_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080326929.1|1858405_1859314_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	51.9	4.5e-74
WP_005170412.1|1859519_1859696_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011816092.1|1860140_1860461_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042661392.1|1860450_1860657_-	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_005170069.1|1860803_1861208_-|tRNA	tRNA(fMet)-specific endonuclease VapC	tRNA	NA	NA	NA	NA
WP_005170066.1|1861207_1861441_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_011816093.1|1861922_1862537_-|tail	tail fiber assembly protein	tail	A0A0A0YSY3	Erwinia_phage	42.0	2.1e-06
WP_011816095.1|1863915_1864458_-|tail	phage tail protein I	tail	F1BUP2	Erwinia_phage	76.7	2.3e-81
WP_011816096.1|1864450_1865359_-|plate	baseplate assembly protein	plate	F1BUP3	Erwinia_phage	74.2	2.5e-117
WP_162484209.1|1865355_1865691_-	GPW/gp25 family protein	NA	F1BUP4	Erwinia_phage	53.3	9.2e-25
WP_042661393.1|1865702_1866341_-|plate	phage baseplate assembly protein V	plate	A0A0M3ULA5	Salmonella_phage	53.9	5.1e-48
WP_011816099.1|1866457_1867045_-	putative adenosine monophosphate-protein transferase Fic	NA	NA	NA	NA	NA
WP_042661620.1|1867041_1867230_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011816100.1|1867323_1867941_-	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	39.5	9.6e-36
WP_011816101.1|1867983_1868454_-|tail	phage tail protein	tail	A0A0M4R2U5	Salmonella_phage	54.5	6.0e-38
WP_011816102.1|1868552_1868978_-|lysis	LysB family phage lysis regulatory protein	lysis	E5G6N2	Salmonella_phage	44.0	4.3e-19
WP_011816103.1|1868982_1869378_-	M15 family metallopeptidase	NA	A9DET4	Yersinia_phage	66.9	3.6e-44
WP_011816104.1|1869364_1869751_-|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_011816105.1|1869788_1869992_-|tail	tail protein X	tail	E5G6M9	Salmonella_phage	65.7	1.4e-20
WP_011816106.1|1869992_1870475_-|head	head completion/stabilization protein	head	A0A1S5NNA6	Burkholderia_phage	51.6	4.4e-36
WP_011816107.1|1870595_1871306_-|terminase	phage terminase/endonuclease subunit	terminase	A0A0M4R523	Salmonella_phage	46.3	1.3e-49
WP_011816108.1|1871334_1872381_-|capsid	phage major capsid protein, P2 family	capsid	A0A0M3ULA3	Salmonella_phage	58.0	2.1e-115
WP_011816109.1|1872413_1873268_-|capsid	GPO family capsid scaffolding protein	capsid	A0A1J0I2E9	Salmonella_phage	52.6	1.6e-57
WP_011816110.1|1873425_1875144_+|terminase	terminase	terminase	A0A0M4S6K7	Salmonella_phage	60.2	4.5e-192
WP_162484210.1|1875215_1876187_+|portal	phage portal protein	portal	A0A0M5M1H6	Salmonella_phage	66.1	3.7e-127
WP_011816112.1|1876565_1877924_-	DNA cytosine methyltransferase	NA	K4HZD0	Acidithiobacillus_phage	36.1	4.8e-56
WP_011816113.1|1878008_1878452_-	hypothetical protein	NA	A0A2I7SA79	Vibrio_phage	34.5	8.4e-18
WP_011816114.1|1878467_1879427_-	response regulator	NA	NA	NA	NA	NA
WP_011816115.1|1879423_1881802_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_011816117.1|1884419_1884644_-	TraR/DksA family transcriptional regulator	NA	A0A218M4I6	Erwinia_phage	52.1	2.9e-14
WP_011816118.1|1884643_1884871_-	DUF2732 family protein	NA	NA	NA	NA	NA
WP_042661395.1|1884948_1885278_-	DUF5347 family protein	NA	NA	NA	NA	NA
WP_011816121.1|1885528_1885795_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_011816122.1|1885884_1886184_+	helix-turn-helix transcriptional regulator	NA	Q1JS21	Enterobacteria_phage	56.4	2.6e-23
WP_011816123.1|1886247_1887231_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0F7LBR0	Escherichia_phage	50.6	1.1e-89
WP_042661396.1|1887234_1888287_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011815747.1|1888604_1889063_+|transposase	IS200/IS605-like element IS1541D family transposase	transposase	I4AZI8	Saccharomonospora_phage	33.9	2.4e-15
1898791:1898806	attR	TATCTGGCCTGACTGG	NA	NA	NA	NA
>prophage 4
NC_008800	Yersinia enterocolitica subsp. enterocolitica 8081, complete genome	4615899	1985628	2006431	4615899	lysis,transposase,holin,portal	Escherichia_phage(37.5%)	22	NA	NA
WP_011816173.1|1985628_1986633_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_011816174.1|1987169_1988126_+	prolyl aminopeptidase	NA	NA	NA	NA	NA
WP_004389928.1|1988175_1988409_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	58.8	1.7e-14
WP_005170444.1|1988792_1989302_+	non-heme ferritin	NA	NA	NA	NA	NA
WP_005170441.1|1989692_1990079_+	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_005170439.1|1990080_1990965_+	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_005170437.1|1991061_1991403_+	YebY family protein	NA	NA	NA	NA	NA
WP_011816177.1|1992829_1993099_-	excisionase	NA	A0A2H4J5E1	uncultured_Caudovirales_phage	41.6	3.4e-14
WP_050942006.1|1993205_1993532_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011816179.1|1993531_1993870_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011816181.1|1995933_1996935_+|portal	phage portal protein	portal	F1BUR7	Erwinia_phage	77.7	8.5e-151
WP_011816182.1|1996991_1997513_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005170307.1|1997544_1997865_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005170304.1|1998215_2000696_-	Eco57I restriction-modification methylase domain-containing protein	NA	A0A0P0ZG22	Escherichia_phage	58.1	4.8e-110
WP_005170303.1|2000970_2001126_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144405164.1|2001433_2002472_+|transposase	IS3-like element ISYen3 family transposase	transposase	S5WIU1	Leptospira_phage	36.9	7.5e-41
WP_144405165.1|2002908_2003148_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011816186.1|2003308_2003704_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005166766.1|2003703_2004000_+|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	37.7	1.9e-05
WP_005166765.1|2003986_2004529_+	glycoside hydrolase family 108 protein	NA	A0A0U2S643	Escherichia_phage	79.3	1.6e-82
WP_011816187.1|2004574_2005024_+|lysis	lysis protein	lysis	B0FEE8	Escherichia_phage	49.0	3.5e-27
WP_011816188.1|2005426_2006431_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
>prophage 5
NC_008800	Yersinia enterocolitica subsp. enterocolitica 8081, complete genome	4615899	2009674	2053968	4615899	transposase,coat,protease,terminase,holin	Shigella_phage(25.0%)	42	NA	NA
WP_080326916.1|2009674_2010661_+|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	55.5	6.3e-98
WP_011816192.1|2010665_2011838_+	DUF4055 domain-containing protein	NA	G8C7P4	Escherichia_phage	65.8	1.7e-145
WP_005166743.1|2012691_2013000_-|transposase	transposase	transposase	Q716C1	Shigella_phage	45.0	2.6e-18
WP_005170287.1|2013889_2014438_-	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_005170283.1|2014496_2016329_-	excinuclease ABC subunit UvrC	NA	NA	NA	NA	NA
WP_005160181.1|2016321_2016978_-	UvrY/SirA/GacA family response regulator transcription factor	NA	NA	NA	NA	NA
WP_005160184.1|2017669_2017894_+	DUF2594 family protein	NA	NA	NA	NA	NA
WP_005170280.1|2018005_2018344_+	GlpM family protein	NA	NA	NA	NA	NA
WP_005170278.1|2018374_2018629_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005170276.1|2019470_2019890_-	helix-turn-helix domain-containing protein	NA	K7PM35	Enterobacteria_phage	33.3	4.4e-16
WP_005170274.1|2020220_2020403_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005170273.1|2020828_2021248_+	antitermination protein Q	NA	U5P0A5	Shigella_phage	62.2	1.2e-37
WP_005170265.1|2021425_2021602_-	GhoT/OrtT family toxin	NA	NA	NA	NA	NA
WP_005161370.1|2021828_2022005_+|holin	phage holin family protein	holin	B6SD15	Bacteriophage	60.7	2.2e-14
WP_005170262.1|2022006_2022489_+	lysozyme	NA	A0A2H4JCH1	uncultured_Caudovirales_phage	63.1	5.5e-55
WP_005170261.1|2022861_2023746_+	triacylglycerol lipase	NA	NA	NA	NA	NA
WP_011816193.1|2024539_2025412_+	23S rRNA pseudouridine(2604) synthase RluF	NA	NA	NA	NA	NA
WP_005170255.1|2026483_2026678_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011816194.1|2026784_2027630_-	EamA family transporter	NA	NA	NA	NA	NA
WP_005170251.1|2027864_2028122_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005170249.1|2028283_2029324_+	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_011816195.1|2029505_2030141_+	glutathione transferase	NA	NA	NA	NA	NA
WP_005170245.1|2030210_2030759_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_005170244.1|2031266_2031500_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005170242.1|2032222_2032612_+	ASCH domain-containing protein	NA	NA	NA	NA	NA
WP_005164922.1|2032729_2032972_-	DUF1480 family protein	NA	NA	NA	NA	NA
WP_011816196.1|2033084_2034794_-	sensor domain-containing diguanylate cyclase	NA	NA	NA	NA	NA
WP_011816197.1|2035016_2036027_-|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
WP_011816198.1|2036057_2038499_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_011816199.1|2038585_2039335_-	molecular chaperone	NA	NA	NA	NA	NA
WP_005170228.1|2039381_2039939_-|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
WP_005170225.1|2039949_2040507_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_042661406.1|2040512_2041049_-|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
WP_011816201.1|2041376_2042801_-	MFS transporter	NA	NA	NA	NA	NA
WP_011816202.1|2042929_2043850_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011816203.1|2043862_2046493_-	PqiB family protein	NA	NA	NA	NA	NA
WP_005170219.1|2046461_2047709_-	membrane integrity lipid transport subunit YebS	NA	NA	NA	NA	NA
WP_011816204.1|2047949_2048447_+	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_005170218.1|2048542_2049271_+	RNA chaperone ProQ	NA	NA	NA	NA	NA
WP_005170217.1|2049290_2051366_+	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	35.4	3.3e-88
WP_005170215.1|2051660_2052542_+|protease	protease HtpX	protease	NA	NA	NA	NA
WP_011816205.1|2052948_2053968_-|transposase	IS110-like element ISYen1 family transposase	transposase	NA	NA	NA	NA
>prophage 6
NC_008800	Yersinia enterocolitica subsp. enterocolitica 8081, complete genome	4615899	2092184	2103647	4615899	tRNA,transposase	Tupanvirus(22.22%)	12	NA	NA
WP_011816225.1|2092184_2094113_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.1	7.4e-127
WP_011816226.1|2094116_2094668_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	33.7	3.4e-16
WP_004713020.1|2094764_2094962_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_004393357.1|2094999_2095356_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_152414234.1|2095424_2095472_+	pheST operon leader peptide PheM	NA	NA	NA	NA	NA
WP_005161570.1|2095820_2096804_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.5	5.8e-35
WP_011816227.1|2096818_2099206_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	A0A1L3IZU3	BeAn_58058_virus	27.8	1.1e-07
WP_002211830.1|2099210_2099507_+	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	4.2e-13
WP_011816229.1|2100788_2101721_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	54.3	4.6e-74
WP_011816230.1|2101982_2102270_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2L1IV28	Escherichia_phage	58.9	2.7e-25
WP_011816231.1|2102269_2102584_+	HigA family addiction module antidote protein	NA	A0A2L1IV52	Escherichia_phage	47.6	1.0e-17
WP_011816232.1|2102750_2103647_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	50.3	4.4e-74
>prophage 7
NC_008800	Yersinia enterocolitica subsp. enterocolitica 8081, complete genome	4615899	2477459	2554665	4615899	terminase,transposase,tail,holin	Salmonella_phage(16.67%)	96	NA	NA
WP_011816433.1|2477459_2478653_+|transposase	IS4 family transposase	transposase	S5FM71	Shigella_phage	61.7	3.1e-139
WP_005169267.1|2478724_2479495_-	MipA/OmpV family protein	NA	NA	NA	NA	NA
WP_005162916.1|2480040_2481975_+	protein kinase YeaG	NA	NA	NA	NA	NA
WP_005169266.1|2482086_2483364_+	YeaH/YhbH family protein	NA	A0A140HLI1	Bacillus_phage	37.1	2.0e-11
WP_005169265.1|2483466_2484516_+	DMT family transporter	NA	NA	NA	NA	NA
WP_011816434.1|2484710_2485157_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011816435.1|2485169_2486075_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011816436.1|2486243_2487116_+	pirin family protein	NA	NA	NA	NA	NA
WP_011816437.1|2487462_2490057_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_011816438.1|2490227_2491418_+	multidrug effflux MFS transporter	NA	S4TR35	Salmonella_phage	28.9	2.6e-29
WP_011816439.1|2491632_2492700_-	catabolic alanine racemase DadX	NA	NA	NA	NA	NA
WP_011816440.1|2492899_2494204_-	D-amino acid dehydrogenase	NA	NA	NA	NA	NA
WP_011816441.1|2494714_2496250_+	SpoVR family protein	NA	NA	NA	NA	NA
WP_005162963.1|2496335_2497055_-	fatty acid metabolism transcriptional regulator FadR	NA	NA	NA	NA	NA
WP_011816442.1|2497365_2498940_+	sodium/proton antiporter NhaB	NA	NA	NA	NA	NA
WP_011816443.1|2499169_2499700_+	disulfide bond formation protein DsbB	NA	NA	NA	NA	NA
WP_005169235.1|2499836_2500625_-	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
WP_005169233.1|2501178_2501535_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011816444.1|2502035_2502494_+	membrane protein	NA	A0A218M4J4	Erwinia_phage	36.2	1.8e-10
WP_011816445.1|2502487_2502814_+	DUF1493 family protein	NA	NA	NA	NA	NA
WP_011816446.1|2503098_2503740_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042661429.1|2503720_2503939_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011816447.1|2504020_2504479_-|tail	tail fiber assembly protein	tail	Q7Y3Y8	Yersinia_phage	56.0	4.5e-22
WP_193343194.1|2504487_2506047_-|tail	phage tail protein	tail	A0A1L7DQU7	Yersinia_phage	43.4	4.7e-39
WP_011816449.1|2506324_2507029_-	phage-like protein	NA	A0A2D2W721	Pectobacterium_phage	26.1	2.4e-06
WP_011816450.1|2507028_2507295_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011816451.1|2507297_2510480_-	host specificity protein J	NA	F1C571	Cronobacter_phage	58.0	0.0e+00
WP_011816452.1|2510654_2510954_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011816453.1|2510983_2511202_-	DUF1327 domain-containing protein	NA	NA	NA	NA	NA
WP_193343201.1|2511243_2511822_-|tail	tail assembly protein	tail	K7PH91	Enterobacterial_phage	62.3	1.8e-60
WP_011816455.1|2511907_2512330_-	hypothetical protein	NA	J9Q806	Salmonella_phage	46.7	2.1e-26
WP_042661431.1|2512326_2512707_-	DUF2545 family protein	NA	S4TR42	Salmonella_phage	41.9	5.4e-05
WP_011816457.1|2512817_2513546_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011816458.1|2513557_2513896_-	hypothetical protein	NA	J9Q6E9	Salmonella_phage	35.0	3.4e-11
WP_011816459.1|2514311_2514725_+	DUF2513 domain-containing protein	NA	NA	NA	NA	NA
WP_011816460.1|2514835_2515153_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011816461.1|2515364_2515712_-	TonB family protein	NA	NA	NA	NA	NA
WP_011816462.1|2515866_2516571_-	C40 family peptidase	NA	K7P6F5	Enterobacteria_phage	75.3	2.8e-108
WP_011816463.1|2516573_2517326_-|tail	phage minor tail protein L	tail	A0A1W6JNX9	Morganella_phage	67.7	4.2e-102
WP_011816464.1|2517342_2517684_-|tail	phage tail protein	tail	I6PBN7	Cronobacter_phage	53.9	4.3e-30
WP_042661432.1|2517686_2520734_-|tail	phage tail tape measure protein	tail	A0A161H7H8	Salmonella_phage	28.3	1.4e-71
WP_026018205.1|2520734_2520980_-	DUF1799 domain-containing protein	NA	A0A0S2SY90	Pseudomonas_phage	52.9	2.0e-13
WP_011816467.1|2521042_2521354_-	hypothetical protein	NA	I6PDG2	Cronobacter_phage	60.2	3.6e-31
WP_011816468.1|2521366_2522287_-	Ig-like domain-containing protein	NA	I6PBN6	Cronobacter_phage	46.8	5.4e-59
WP_011816469.1|2522353_2522761_-	DUF4128 domain-containing protein	NA	A0A1B0VMI0	Pseudomonas_phage	38.2	2.8e-15
WP_011816470.1|2522757_2523342_-	hypothetical protein	NA	G8C7Q1	Escherichia_phage	54.2	6.5e-50
WP_011816471.1|2523343_2523694_-	hypothetical protein	NA	I6PD77	Cronobacter_phage	53.4	2.6e-30
WP_042661433.1|2523693_2524176_-	hypothetical protein	NA	A0A2H5BHE7	Acinetobacter_phage	35.7	4.3e-15
WP_011816473.1|2524223_2525429_-	Ig-like domain-containing protein	NA	A0A1B0VMF8	Pseudomonas_phage	79.5	1.0e-142
WP_011816474.1|2525442_2526216_-	hypothetical protein	NA	A0A1B0VMG1	Pseudomonas_phage	62.3	7.5e-70
WP_011816475.1|2526337_2527450_-	hypothetical protein	NA	I6PD76	Cronobacter_phage	59.6	1.4e-122
WP_011816476.1|2527450_2528839_-	DUF4055 domain-containing protein	NA	A0A1B0VMH0	Pseudomonas_phage	52.6	6.5e-133
WP_011816477.1|2528838_2530401_-|terminase	phage terminase large subunit	terminase	G8C7P3	Escherichia_phage	83.3	5.2e-272
WP_011816478.1|2530397_2530970_-|terminase	terminase small subunit	terminase	I6PDJ6	Cronobacter_phage	73.8	9.4e-62
WP_011816479.1|2530998_2531142_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011816480.1|2531347_2531527_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011816481.1|2531678_2532017_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011816482.1|2532180_2532870_-	Rha family transcriptional regulator	NA	Q5G8R0	Enterobacteria_phage	87.8	3.5e-111
WP_011816483.1|2533505_2533898_-	exotoxin	NA	U5P0U9	Shigella_phage	33.3	3.4e-10
WP_011816484.1|2533882_2534365_-	lysozyme	NA	A0A2H4JCH1	uncultured_Caudovirales_phage	64.2	8.5e-56
WP_042661434.1|2534342_2534543_-|holin	phage holin family protein	holin	A0A1V0E5H9	Salmonella_phage	60.3	7.9e-16
WP_011816485.1|2534687_2535218_-	HNH endonuclease	NA	K7PL52	Enterobacteria_phage	52.7	5.5e-48
WP_011816486.1|2535453_2535942_-	DUF1133 family protein	NA	G8C7N2	Escherichia_phage	72.8	2.3e-64
WP_011816487.1|2535938_2536547_-	recombination protein NinG	NA	H6WRY9	Salmonella_phage	50.7	1.5e-44
WP_158505898.1|2536521_2536668_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144405167.1|2536660_2536831_-	NinE family protein	NA	NA	NA	NA	NA
WP_011816488.1|2536904_2537351_-	recombination protein NinB	NA	A0A2H4J8D9	uncultured_Caudovirales_phage	59.7	7.4e-46
WP_011816489.1|2537343_2537745_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011816490.1|2537741_2538044_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042661435.1|2538040_2538256_-	hypothetical protein	NA	A0A088CC19	Shigella_phage	48.1	1.4e-05
WP_042661436.1|2538254_2538902_+	DUF4145 domain-containing protein	NA	V5URE2	Shigella_phage	47.2	1.3e-51
WP_011816493.1|2539003_2539240_-	hypothetical protein	NA	A0A2P1CKR1	Pantoea_phage	44.6	2.7e-07
WP_011816494.1|2539236_2539932_-	DNA replication protein	NA	A0A2H4J1B6	uncultured_Caudovirales_phage	56.1	5.3e-67
WP_162484212.1|2539928_2540771_-	replication protein	NA	G9L680	Escherichia_phage	58.7	1.0e-48
WP_011816496.1|2540824_2541490_-	phage-like protein	NA	M1F3E2	Salmonella_phage	40.8	2.2e-33
WP_011816498.1|2541845_2542118_-	hypothetical protein	NA	Q76H54	Enterobacteria_phage	61.0	2.7e-19
WP_011816499.1|2542233_2542458_-	helix-turn-helix domain-containing protein	NA	Q76H55	Enterobacteria_phage	79.1	1.4e-24
WP_162484194.1|2542498_2543167_+	helix-turn-helix domain-containing protein	NA	A0A1R3Y604	Salmonella_virus	57.8	6.1e-20
WP_042661437.1|2543812_2544055_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019079601.1|2544068_2544377_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011816502.1|2544662_2545238_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011816503.1|2545365_2545776_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144405168.1|2545843_2546098_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011816504.1|2546078_2546744_+	exodeoxyribonuclease X	NA	A0A1W5PTR6	Pseudoalteromonas_phage	33.5	6.1e-20
WP_011816505.1|2546743_2547409_+	ATP-binding protein	NA	A0A2D1GLT5	Escherichia_phage	63.1	7.6e-71
WP_011816506.1|2547408_2548086_+	hypothetical protein	NA	A0A088C400	Shewanella_sp._phage	39.7	2.2e-25
WP_042661439.1|2548129_2548321_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011816507.1|2548481_2548850_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011816508.1|2548999_2549503_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042661440.1|2549730_2549946_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042661441.1|2549945_2550164_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011816509.1|2550160_2551021_+	adenine methyltransferase	NA	I6PDF5	Cronobacter_phage	73.4	3.7e-86
WP_011816510.1|2551017_2552763_+	DNA cytosine methyltransferase	NA	H9C171	Pectobacterium_phage	61.6	1.0e-236
WP_042661442.1|2552861_2553107_+	hypothetical protein	NA	A0A2H4J398	uncultured_Caudovirales_phage	64.5	3.8e-20
WP_011816511.1|2553099_2553348_+	excisionase family protein	NA	S4TND0	Salmonella_phage	54.2	4.7e-18
WP_042661443.1|2553381_2554665_+	DUF3596 domain-containing protein	NA	A0A0P0ZGT7	Escherichia_phage	57.1	2.5e-139
>prophage 8
NC_008800	Yersinia enterocolitica subsp. enterocolitica 8081, complete genome	4615899	2779705	2791835	4615899		Paramecium_bursaria_Chlorella_virus(16.67%)	8	NA	NA
WP_005168752.1|2779705_2782408_-	magnesium-translocating P-type ATPase	NA	M1HM40	Paramecium_bursaria_Chlorella_virus	25.7	2.5e-43
WP_005168749.1|2782624_2783323_-	MgtC family protein	NA	G3MA03	Bacillus_virus	40.3	1.8e-14
WP_042661459.1|2783886_2784135_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011816624.1|2784460_2786200_+	Tar ligand binding domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	30.8	3.9e-10
WP_004701013.1|2786332_2786524_-	protein DsrB	NA	NA	NA	NA	NA
WP_002210893.1|2786777_2786990_-	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	80.0	2.0e-25
WP_011816625.1|2787471_2788506_+	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	50.0	7.1e-84
WP_011816626.1|2788682_2791835_+	beta-galactosidase	NA	B9U1H7	Vaccinia_virus	62.9	0.0e+00
