The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_008313	Cupriavidus necator H16 chromosome 1, complete sequence	4052032	874757	883542	4052032		Bacillus_phage(16.67%)	8	NA	NA
WP_010812950.1|874757_876140_+	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	36.5	1.7e-69
WP_010812949.1|876220_877168_+	D-glycero-beta-D-manno-heptose-7-phosphate kinase	NA	A0A2H4N7X4	Lake_Baikal_phage	28.1	3.2e-14
WP_010812948.1|877196_878192_+	ADP-glyceromanno-heptose 6-epimerase	NA	R9S880	Prochlorococcus_phage	33.1	4.1e-28
WP_010812947.1|878347_878716_+	helix-hairpin-helix domain-containing protein	NA	NA	NA	NA	NA
WP_011614702.1|878953_880255_+	nitrate reductase	NA	Q9KX94	Enterobacteria_phage	64.8	1.0e-143
WP_010812945.1|880390_881293_+	cysteine synthase CysM	NA	C3U2M1	Lactococcus_phage	42.1	9.7e-53
WP_010812944.1|881362_882469_-	lytic murein transglycosylase B	NA	NA	NA	NA	NA
WP_010812943.1|882618_883542_+	histone deacetylase family protein	NA	A0A2K9L2T7	Tupanvirus	33.3	1.3e-41
>prophage 2
NC_008313	Cupriavidus necator H16 chromosome 1, complete sequence	4052032	3301721	3311033	4052032	protease	Methanothermobacter_phage(16.67%)	9	NA	NA
WP_011615966.1|3301721_3302972_+	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	30.6	4.6e-37
WP_011615967.1|3302994_3303495_+	dUTP diphosphatase	NA	A0A289ZTC1	Serratia_phage	54.2	1.8e-40
WP_011615968.1|3303549_3304398_-	VOC family protein	NA	NA	NA	NA	NA
WP_010814996.1|3304440_3305448_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_010814997.1|3305624_3307919_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	43.3	1.1e-172
WP_010814998.1|3307915_3308242_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	46.9	1.3e-12
WP_010814999.1|3308755_3308962_+	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	75.8	1.9e-20
WP_011615969.1|3309172_3309634_-	VOC family protein	NA	NA	NA	NA	NA
WP_010815001.1|3309782_3311033_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	64.8	8.8e-12
>prophage 3
NC_008313	Cupriavidus necator H16 chromosome 1, complete sequence	4052032	3847541	3853604	4052032		uncultured_Caudovirales_phage(33.33%)	9	NA	NA
WP_010812127.1|3847541_3848129_-	phosphoheptose isomerase	NA	A0A067XQR2	Caulobacter_phage	31.4	1.8e-15
WP_010812128.1|3848191_3848587_-	YraN family protein	NA	NA	NA	NA	NA
WP_010812129.1|3848605_3849514_+	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	40.4	7.0e-35
WP_011616201.1|3849601_3850372_-	septal ring lytic transglycosylase RlpA family protein	NA	H2BCY4	Synechococcus_phage	52.1	3.0e-18
WP_011616202.1|3850653_3851304_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_041687562.1|3851308_3851965_+	exonuclease	NA	A0A2L0UZL4	Agrobacterium_phage	40.4	5.1e-35
WP_010812133.1|3852172_3852400_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010812134.1|3852488_3852848_-	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	43.6	5.2e-18
WP_010812135.1|3853022_3853604_+	N-acetyltransferase	NA	A0A2H4J136	uncultured_Caudovirales_phage	41.7	3.1e-20
>prophage 1
NC_005241	Cupriavidus necator H16 megaplasmid pHG1, complete sequence	452156	33309	66718	452156	protease,integrase,transposase	Virus_Rctr85(25.0%)	27	46301:46319	56800:56818
WP_011153959.1|33309_34254_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_011153960.1|34250_35249_+|integrase	site-specific integrase	integrase	A0A1P8DJ76	Virus_Rctr85	32.1	2.0e-11
WP_082236114.1|35313_35568_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_011153961.1|35730_35931_-|integrase	integrase	integrase	NA	NA	NA	NA
WP_011153962.1|36085_37084_-|integrase	site-specific integrase	integrase	A0A1P8DJ76	Virus_Rctr85	30.8	2.0e-11
WP_011153963.1|37080_38025_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_011154055.1|38021_39260_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_011153965.1|39413_40640_+|transposase	ISL3-like element ISAe1 family transposase	transposase	NA	NA	NA	NA
WP_011153966.1|40645_41500_-|integrase	site-specific integrase	integrase	A0A2K9VH72	Gordonia_phage	28.8	4.0e-08
WP_011153967.1|41496_42429_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_011153968.1|42425_43658_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2D1G8E2	Mycobacterium_phage	29.0	1.1e-06
WP_136227927.1|43768_44275_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011153970.1|44268_45516_-|integrase	tyrosine-type recombinase/integrase	integrase	W8EHC2	Mycobacterium_phage	33.3	3.0e-12
46301:46319	attL	GGGCGTTGTTGCACAAATC	NA	NA	NA	NA
WP_011153974.1|47082_47445_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011153975.1|47441_49322_-|integrase	integrase	integrase	A0A2H4J185	uncultured_Caudovirales_phage	27.1	1.6e-33
WP_011153976.1|49318_51199_-	hypothetical protein	NA	A0A2H4J9J6	uncultured_Caudovirales_phage	27.3	2.2e-22
WP_011153978.1|51475_52738_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_011153979.1|52730_53714_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_011153980.1|53710_54721_+|integrase	tyrosine-type recombinase/integrase	integrase	S5MBZ0	Brevibacillus_phage	24.3	6.4e-05
WP_011153985.1|58600_59635_-	HoxN/HupN/NixA family nickel/cobalt transporter	NA	NA	NA	NA	NA
56800:56818	attR	GATTTGTGCAACAACGCCC	NA	NA	NA	NA
WP_011153986.1|59961_61017_+	hydrogenase expression protein HypE	NA	NA	NA	NA	NA
WP_011153987.1|61054_62866_+	nickel-dependent hydrogenase large subunit	NA	NA	NA	NA	NA
WP_011153988.1|62865_63444_+	NifU family protein	NA	NA	NA	NA	NA
WP_011153989.1|63440_64103_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011153990.1|64095_64743_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011153991.1|64739_66170_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011153992.1|66166_66718_+|protease	hydrogenase maturation protease	protease	NA	NA	NA	NA
>prophage 2
NC_005241	Cupriavidus necator H16 megaplasmid pHG1, complete sequence	452156	84314	142703	452156	protease,integrase,transposase	Thermus_phage(25.0%)	41	128214:128273	137748:137877
WP_011154014.1|84314_84812_+|protease	hydrogenase maturation protease	protease	NA	NA	NA	NA
WP_011154015.1|84834_85338_+	cyclic nucleotide-binding domain-containing protein	NA	NA	NA	NA	NA
WP_011154016.1|85448_85790_+	hydrogenase maturation nickel metallochaperone HypA	NA	NA	NA	NA	NA
WP_011154017.1|85835_86798_+	hydrogenase nickel incorporation protein HypB	NA	NA	NA	NA	NA
WP_011154018.1|86803_89227_+	carbamoyltransferase HypF	NA	NA	NA	NA	NA
WP_011154019.1|89390_90581_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011154020.1|90939_91158_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041688635.1|91517_92753_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_011153965.1|93047_94274_-|transposase	ISL3-like element ISAe1 family transposase	transposase	NA	NA	NA	NA
WP_051398622.1|94360_96364_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011154024.1|96367_97348_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_041688639.1|97349_98792_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011154026.1|99041_100253_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_011154027.1|100236_100506_+	H-NS histone family protein	NA	NA	NA	NA	NA
WP_011154028.1|101128_102226_+	protein kinase	NA	M1PWQ7	Moumouvirus	27.7	8.5e-11
WP_011154030.1|103074_104100_+	ATP-binding protein	NA	G8DDJ2	Micromonas_pusilla_virus	30.8	7.4e-17
WP_011154031.1|104077_106576_+	S8 family peptidase	NA	NA	NA	NA	NA
WP_011154032.1|106904_107963_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_011154034.1|110402_110738_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_011154035.1|110970_111615_+	DUF1326 domain-containing protein	NA	NA	NA	NA	NA
WP_011154036.1|111611_112400_+	DUF2182 domain-containing protein	NA	NA	NA	NA	NA
WP_011154037.1|113702_115601_+	potassium transporter Kup	NA	M1I6H8	Paramecium_bursaria_Chlorella_virus	31.3	8.0e-73
WP_011154038.1|115786_116041_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011154041.1|116160_116922_-	siderophore biosynthesis protein SbnG	NA	NA	NA	NA	NA
WP_041688643.1|116908_118153_-	type III PLP-dependent enzyme	NA	A0A060D2X4	Bovine_gammaherpesvirus	23.6	1.5e-08
WP_041688645.1|118149_119976_-	iron transporter	NA	NA	NA	NA	NA
WP_011154044.1|120022_121198_-	MFS transporter	NA	NA	NA	NA	NA
WP_011154045.1|121194_123012_-	siderophore biosynthesis protein	NA	NA	NA	NA	NA
WP_011154046.1|123008_124214_-	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_041688647.1|124401_126525_-	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_011154048.1|126955_127276_+	hypothetical protein	NA	NA	NA	NA	NA
128214:128273	attL	GTTATGCCGGCTCCCCGATTATGCCGCGTCGTGCACGCGCATGACGGTGGGTATGGCCTT	NA	NA	NA	NA
WP_011154050.1|128343_129576_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1L4BKH1	Thermus_phage	31.1	1.7e-07
WP_011154051.1|129572_130520_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_011154055.1|131432_132671_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_011153963.1|132667_133612_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_011153962.1|133608_134607_+|integrase	site-specific integrase	integrase	A0A1P8DJ76	Virus_Rctr85	30.8	2.0e-11
WP_011154051.1|135500_136448_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_011154050.1|136444_137677_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1L4BKH1	Thermus_phage	31.1	1.7e-07
WP_011154057.1|137741_139190_-|transposase	IS66 family transposase	transposase	S5VLC8	Leptospira_phage	33.1	4.0e-40
137748:137877	attR	AAGGCCATACCCACCGTCATGCGCGTGCACGACGCGGCATAATCGGGGAGCCGGCATAACGCGGTTCATGCCGCTAGCGGCATGAACCGCGTTGTTCGAGATCGGCCAGGTTCCGTTCTCGATGTAGCGC	NA	NA	NA	NA
WP_011154059.1|139221_139572_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_011154060.1|139763_142703_+|transposase	Tn3-like element IS882 family transposase	transposase	NA	NA	NA	NA
