The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_008380	Rhizobium leguminosarum bv. viciae 3841, complete genome	5057142	1693674	1702942	5057142		Escherichia_phage(25.0%)	9	NA	NA
WP_011651299.1|1693674_1694973_+	serine hydroxymethyltransferase	NA	A0A219Y950	Aeromonas_phage	51.3	2.2e-98
WP_003547190.1|1694982_1695459_+	transcriptional repressor NrdR	NA	NA	NA	NA	NA
WP_011651300.1|1695462_1696809_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	40.5	8.8e-34
WP_026158618.1|1696808_1697420_+	riboflavin synthase	NA	A0A2I2L4R9	Orpheovirus	35.4	2.6e-17
WP_028741432.1|1697541_1698411_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	K7QKA7	Escherichia_phage	59.2	1.2e-95
WP_011651303.1|1698421_1699309_-	dTDP-4-dehydrorhamnose reductase	NA	A0A1D7XFA3	Escherichia_phage	38.8	2.7e-31
WP_011651304.1|1699312_1700368_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	52.2	6.3e-96
WP_011651305.1|1700374_1700953_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A218MN57	uncultured_virus	44.9	5.5e-33
WP_011651306.1|1700977_1702942_-	hypothetical protein	NA	F2Y0P4	Organic_Lake_phycodnavirus	37.7	2.3e-06
>prophage 2
NC_008380	Rhizobium leguminosarum bv. viciae 3841, complete genome	5057142	1766445	1777277	5057142	protease	Bacillus_phage(16.67%)	7	NA	NA
WP_011651360.1|1766445_1767861_-	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	33.5	7.6e-12
WP_003547334.1|1768135_1768765_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	59.2	9.4e-63
WP_003547337.1|1769068_1770346_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	58.6	7.9e-133
WP_003547341.1|1770749_1773167_+	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	49.4	2.5e-204
WP_011651361.1|1773373_1773649_+	HU family DNA-binding protein	NA	A0A172Q061	Acinetobacter_phage	33.3	7.1e-07
WP_086935544.1|1774083_1774983_+	DMT family transporter	NA	NA	NA	NA	NA
WP_173364434.1|1775066_1777277_+	esterase-like activity of phytase family protein	NA	M4SLV1	Cyanophage	43.4	2.4e-81
>prophage 3
NC_008380	Rhizobium leguminosarum bv. viciae 3841, complete genome	5057142	2157012	2170512	5057142	tRNA	uncultured_Mediterranean_phage(90.91%)	13	NA	NA
WP_011651653.1|2157012_2158026_+	beta-N-acetylhexosaminidase	NA	A0A1B1IVS3	uncultured_Mediterranean_phage	42.6	5.6e-25
WP_028742082.1|2158044_2158902_+	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	38.5	5.6e-34
WP_011651655.1|2158898_2159615_+	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	47.8	1.7e-39
WP_003538990.1|2159798_2159990_+	twin-arginine translocase TatA/TatE family subunit	NA	A0A1B1IVR9	uncultured_Mediterranean_phage	72.1	8.9e-09
WP_011651656.1|2160040_2160652_+	twin-arginine translocase subunit TatB	NA	NA	NA	NA	NA
WP_011651657.1|2160648_2161476_+	twin-arginine translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	46.5	2.8e-54
WP_011651658.1|2161676_2162960_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	45.3	4.1e-97
WP_011651659.1|2162964_2163738_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	30.2	2.4e-23
WP_011651660.1|2163734_2164388_+	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	33.5	7.6e-15
WP_028742081.1|2164629_2166231_+	peptidoglycan DD-metalloendopeptidase family protein	NA	I3PV24	Clostridium_phage	29.2	8.6e-12
WP_011651662.1|2166395_2167268_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_003539006.1|2167578_2167926_+	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	39.1	1.4e-12
WP_011651663.1|2167971_2170512_+	protein translocase subunit SecDF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	48.6	1.1e-56
>prophage 4
NC_008380	Rhizobium leguminosarum bv. viciae 3841, complete genome	5057142	2524790	2535308	5057142		uncultured_Mediterranean_phage(83.33%)	10	NA	NA
WP_011651966.1|2524790_2527712_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	62.1	0.0e+00
WP_011651967.1|2527974_2528484_+	single-stranded DNA-binding protein	NA	R9TP78	Rhizobium_phage	73.7	1.2e-44
WP_011651968.1|2528608_2529256_-	MarC family protein	NA	NA	NA	NA	NA
WP_129557794.1|2529317_2529500_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011651969.1|2529492_2532330_+	DNA gyrase subunit A	NA	A0A1B1IVS2	uncultured_Mediterranean_phage	42.2	3.0e-76
WP_003539654.1|2532684_2532840_-	hypothetical protein	NA	NA	NA	NA	NA
WP_028744078.1|2532974_2533253_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011651971.1|2533659_2534154_+	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	37.2	6.1e-25
WP_011651972.1|2534196_2534769_+	peptidylprolyl isomerase	NA	A0A1B1IVS0	uncultured_Mediterranean_phage	53.2	5.7e-43
WP_003539661.1|2534798_2535308_+	peptidylprolyl isomerase	NA	A0A1B1IVS0	uncultured_Mediterranean_phage	59.4	2.5e-45
>prophage 5
NC_008380	Rhizobium leguminosarum bv. viciae 3841, complete genome	5057142	3568479	3582013	5057142		Vibrio_phage(25.0%)	10	NA	NA
WP_011652885.1|3568479_3570537_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.6	1.7e-36
WP_011652886.1|3571005_3571353_-	GFA family protein	NA	NA	NA	NA	NA
WP_011652887.1|3571362_3572400_-	L-threonine 3-dehydrogenase	NA	R9TPW0	Vibrio_phage	68.6	7.1e-15
WP_011652888.1|3572589_3573777_-	glycine C-acetyltransferase	NA	D2TEZ5	Emiliania_huxleyi_virus	27.5	3.2e-35
WP_011652889.1|3573842_3574571_-	class I SAM-dependent methyltransferase	NA	A0A1X9I6N4	Streptococcus_phage	43.2	5.2e-49
WP_011652890.1|3574640_3576509_-	DNA helicase RecQ	NA	L7RCS0	Acanthamoeba_polyphaga_moumouvirus	35.1	9.3e-74
WP_011652891.1|3576508_3578518_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	41.5	2.7e-87
WP_011652892.1|3579188_3580079_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011652893.1|3580082_3580538_-	GatB/YqeY domain-containing protein	NA	A0A292GL36	Xanthomonas_phage	38.7	5.3e-15
WP_011652894.1|3580807_3582013_+	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	32.6	1.6e-39
>prophage 6
NC_008380	Rhizobium leguminosarum bv. viciae 3841, complete genome	5057142	4167928	4180509	5057142		Sinorhizobium_phage(25.0%)	21	NA	NA
WP_011653372.1|4167928_4168402_-	hypothetical protein	NA	F8TUR4	EBPR_podovirus	56.3	2.9e-32
WP_086935562.1|4168337_4168517_-	hypothetical protein	NA	NA	NA	NA	NA
WP_018449515.1|4168517_4168754_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041936451.1|4168875_4169127_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086935563.1|4169290_4169479_+	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
WP_041936452.1|4169491_4169719_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129557802.1|4169868_4170558_-	hypothetical protein	NA	A0A076G6H3	Sinorhizobium_phage	41.6	6.5e-17
WP_129557803.1|4170650_4171307_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162039369.1|4171327_4172932_-	AAA family ATPase	NA	A0A1X9SGS1	Bradyrhizobium_phage	38.5	2.3e-89
WP_011653379.1|4173124_4173898_-	DUF1376 domain-containing protein	NA	A9YWY6	Burkholderia_phage	33.3	1.3e-05
WP_011653380.1|4173887_4174130_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011653381.1|4174126_4174396_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011653382.1|4174488_4175268_+	helix-turn-helix transcriptional regulator	NA	A0A291AUR9	Sinorhizobium_phage	24.8	2.2e-08
WP_011653383.1|4175345_4176083_+	Rha family transcriptional regulator	NA	A0A1W6JTB2	Pseudomonas_phage	39.8	1.8e-36
WP_086935586.1|4176303_4176768_-	Arc family DNA-binding protein	NA	H6WRU6	Salmonella_phage	68.1	8.3e-08
WP_086935565.1|4176914_4177064_+	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_011653385.1|4177083_4177494_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011653386.1|4177549_4177858_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011653387.1|4177854_4178124_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011653388.1|4178116_4178779_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011653389.1|4178907_4180509_+	recombinase family protein	NA	R9TP69	Rhizobium_phage	38.5	4.2e-99
>prophage 7
NC_008380	Rhizobium leguminosarum bv. viciae 3841, complete genome	5057142	4511298	4521429	5057142		Mycobacterium_phage(25.0%)	9	NA	NA
WP_011653649.1|4511298_4512009_+	7-cyano-7-deazaguanine synthase QueC	NA	A0A2P1JXV3	Rhodococcus_phage	49.6	2.1e-50
WP_026238688.1|4512008_4512365_+	6-carboxytetrahydropterin synthase QueD	NA	NA	NA	NA	NA
WP_011653651.1|4512361_4513105_+	7-carboxy-7-deazaguanine synthase QueE	NA	A0A1U9WRB6	Streptococcus_virus	37.2	5.0e-39
WP_028744157.1|4513123_4514347_-	adenylate/guanylate cyclase domain-containing protein	NA	M1HLN3	Pelagibacter_phage	28.8	1.2e-13
WP_011653653.1|4514451_4515426_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	R4TBI6	Mycobacterium_phage	74.1	1.6e-138
WP_028744155.1|4515661_4517866_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	V9VI16	Lactococcus_phage	52.1	3.9e-212
WP_011653655.1|4517844_4518252_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A142F1R4	Bacillus_phage	42.7	3.3e-16
WP_011653656.1|4518266_4518488_-	glutaredoxin-like protein NrdH	NA	V5UN81	Mycobacterium_phage	50.7	8.7e-16
WP_011653657.1|4519158_4521429_-	cadmium-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	40.8	4.5e-123
>prophage 1
NC_008381	Rhizobium leguminosarum bv. viciae 3841 plasmid pRL10, complete sequence	488135	5130	56093	488135	integrase,transposase	Acidianus_tailed_spindle_virus(25.0%)	37	NA	NA
WP_011654075.1|5130_6273_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_011654076.1|6269_6599_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011654077.1|6610_6988_-	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_011654078.1|6984_7275_-	type II toxin-antitoxin system prevent-host-death family antitoxin	NA	NA	NA	NA	NA
WP_011654080.1|7982_8258_+	type II toxin-antitoxin system ParD family antitoxin	NA	NA	NA	NA	NA
WP_173364459.1|8238_8589_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_011654082.1|8594_9749_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_041936846.1|9873_10824_+	DUF1403 family protein	NA	NA	NA	NA	NA
WP_041936814.1|10826_11516_+	SMC-Scp complex subunit ScpB	NA	NA	NA	NA	NA
WP_011654085.1|11535_12582_-	TniQ family protein	NA	NA	NA	NA	NA
WP_041936815.1|12578_13460_-	TniB family NTP-binding protein	NA	NA	NA	NA	NA
WP_011654087.1|13462_15115_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_049778462.1|15302_15665_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011654089.1|16774_17290_+	DUF1269 domain-containing protein	NA	NA	NA	NA	NA
WP_011654090.1|17422_18271_+	bile acid:sodium symporter	NA	NA	NA	NA	NA
WP_011654091.1|18603_19677_+	DUF1612 and helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_028743875.1|19709_20651_+	DUF4238 domain-containing protein	NA	NA	NA	NA	NA
WP_011654093.1|20764_21328_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011654094.1|21372_22086_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157865245.1|22099_23455_-	N-6 DNA methylase	NA	NA	NA	NA	NA
WP_122330917.1|23796_24411_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011654097.1|24626_26879_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011654098.1|26882_31109_-	helicase	NA	NA	NA	NA	NA
WP_122330910.1|31111_33127_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032993442.1|34042_35032_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011654101.1|36332_38795_-	S8 family peptidase	NA	NA	NA	NA	NA
WP_011654102.1|38810_39794_-	ATP-binding protein	NA	A0A125SJ49	Acidianus_tailed_spindle_virus	30.5	1.1e-14
WP_028743871.1|40001_40259_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011654104.1|40676_42401_+	hypothetical protein	NA	NA	NA	NA	NA
WP_028743870.1|42467_43550_-	DNA polymerase IV	NA	NA	NA	NA	NA
WP_011654106.1|43627_44305_-	SOS response-associated peptidase	NA	A0A291AUP1	Sinorhizobium_phage	44.5	1.3e-49
WP_011654107.1|44382_44643_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011654108.1|44847_45603_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011652217.1|50622_51819_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_011652218.1|51825_52704_-|integrase	tyrosine-type recombinase/integrase	integrase	S5W9T9	Leptospira_phage	31.7	3.5e-31
WP_028743868.1|54180_55101_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_011654112.1|55097_56093_+|integrase	site-specific integrase	integrase	A0A1B1IQT7	uncultured_Mediterranean_phage	27.0	2.7e-11
>prophage 2
NC_008381	Rhizobium leguminosarum bv. viciae 3841 plasmid pRL10, complete sequence	488135	90822	168191	488135	integrase,transposase	Staphylococcus_phage(21.43%)	55	150634:150693	168486:170028
WP_028744323.1|90822_91113_+|transposase	IS6 family transposase	transposase	NA	NA	NA	NA
WP_011654150.1|92765_94715_-	RiPP maturation radical SAM protein 1	NA	NA	NA	NA	NA
WP_011654151.1|94711_96202_-	radical SAM family RiPP maturation amino acid epimerase	NA	NA	NA	NA	NA
WP_011654152.1|96239_96650_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155251706.1|96777_96927_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155251706.1|98350_98500_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077979378.1|99269_100493_+	hypothetical protein	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	24.2	1.0e-12
WP_011654153.1|100550_101723_+	iron-containing alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_011654154.1|101719_102418_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011654155.1|102421_103528_+	class III poly(R)-hydroxyalkanoic acid synthase subunit PhaC	NA	NA	NA	NA	NA
WP_032993738.1|104047_104851_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011654158.1|104931_105141_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011654159.1|105520_106768_+	plasmid partitioning protein RepA	NA	A0A240F4U1	Ochrobactrum_phage	39.4	2.2e-63
WP_028744274.1|107668_108514_-	hypothetical protein	NA	A0A291LAE0	Escherichia_phage	42.6	1.7e-54
WP_011654162.1|108500_109142_-	HAD family hydrolase	NA	K4JW67	Caulobacter_phage	30.0	3.3e-15
WP_011654164.1|110362_110620_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011654165.1|113852_115526_+	acyl CoA:acetate/3-ketoacid CoA transferase	NA	NA	NA	NA	NA
WP_011654167.1|116097_118062_+	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	36.7	3.7e-81
WP_011654168.1|118168_118783_+	adenylate kinase	NA	NA	NA	NA	NA
WP_011654169.1|119498_119996_+	hypothetical protein	NA	R9U4A9	Rhizobium_phage	49.6	8.9e-24
WP_011654171.1|121680_122034_-	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	45.2	3.6e-19
WP_162039391.1|122014_122461_-|transposase	transposase	transposase	A0A0P0ZBP6	Stx2-converting_phage	46.8	5.7e-06
WP_028744160.1|122495_122705_+	hypothetical protein	NA	A0A0F6WBX9	Sinorhizobium_phage	54.3	7.8e-06
WP_028744161.1|123217_123862_-	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.1	3.2e-10
WP_011654175.1|123854_124631_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	25.6	5.5e-12
WP_032993640.1|124627_125584_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_028744162.1|125583_126480_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_011654178.1|126619_127894_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_122330914.1|128476_129307_-	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011654181.1|129384_130836_+	NAD-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_028744164.1|130861_132022_+	iron-containing alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_011654183.1|132070_132862_+	N-acyl homoserine lactonase family protein	NA	NA	NA	NA	NA
WP_011654184.1|133029_134205_+	homoserine O-acetyltransferase	NA	NA	NA	NA	NA
WP_122330919.1|134672_135209_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011654186.1|135432_137496_-	recombinase family protein	NA	A0A1B2LRQ3	Wolbachia_phage	23.4	2.2e-07
WP_028744172.1|141052_141415_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011654188.1|141785_142037_+	acyl carrier protein	NA	NA	NA	NA	NA
WP_011654189.1|142036_143218_+	acyl-CoA/acyl-ACP dehydrogenase	NA	NA	NA	NA	NA
WP_011654190.1|144144_144819_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_011654191.1|144948_145503_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026264770.1|147198_147909_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011654195.1|149868_150102_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
150634:150693	attL	GGGAATCTGGAGGGTTCTGTGAGGTCCGTTCGCTATGCGTGCGGCATTCACTGATCGGAC	NA	NA	NA	NA
WP_011654196.1|150987_152163_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_011654197.1|152176_153037_-|integrase	tyrosine-type recombinase/integrase	integrase	S5W9T9	Leptospira_phage	34.1	1.4e-32
WP_011654198.1|153183_153549_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011654200.1|154962_155286_-	ferredoxin III, nif-specific	NA	NA	NA	NA	NA
WP_011654201.1|155640_156978_-	nitrogenase iron-molybdenum cofactor biosynthesis protein NifN	NA	NA	NA	NA	NA
WP_011654202.1|157032_158454_-	nitrogenase iron-molybdenum cofactor biosynthesis protein NifE	NA	NA	NA	NA	NA
WP_011654203.1|158507_160049_-	nitrogenase molybdenum-iron protein subunit beta	NA	NA	NA	NA	NA
WP_011654204.1|160139_161645_-	nitrogenase molybdenum-iron protein alpha chain	NA	NA	NA	NA	NA
WP_011654205.1|161747_162641_-	nitrogenase iron protein	NA	NA	NA	NA	NA
WP_020048084.1|164895_165054_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011654208.1|165376_165928_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_011654197.1|166141_167002_+|integrase	tyrosine-type recombinase/integrase	integrase	S5W9T9	Leptospira_phage	34.1	1.4e-32
WP_011654196.1|167015_168191_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
168486:170028	attR	GTCCGATCAGTGAATGCCGCACGCATAGCGAACGGACCTCACAGAACCCTCCAGATTCCCAAGGGCAAGCAAATCAGATTCAACGCTGACTTTTGGAGGTCAGTGATGGATTGCGATGCCCTTCGGGATGATCAATGGGAACGGATCAGAGGTTTTGTGCCGGGACGGACCAAGGGCAAACGCGGTCCGCGCACGAACAATCGATTGTTTCTGGACGCGCTTTTGTGGATGGCCCGTTCCGGCAGCCGCTGGCGCGACCTGCCCGAGCGACTGGGCGACTACCGCTCGGTGAAACGGCGTTACTACCGCTGGATCGAAATGGGTGTGCTCGATGAGATGCTGGCGATGCTTGCCCGAGAAGCAGACCTGGAATGGCTGATGATCGACAGCACCATCGTGCGGGCACACCAGCATGCGGCAGGGGCGCGTAAGGTCAAAGGGGGGCGGATGCCCAGGGCCTGGGCCGGTCTCGGGGCGGATTAAGCACCAAAATCCATGCCGCGACGGAGGCGCTCGGGCTTCCGGTTCGTCTGATCGCATCTCCCGGACAGCGTAACGACATCGCCTTTGCTCACGATCTCGTCGATGGCATCCAGGCTGCCGCTACGATTGCCGACAAGGGCTATGATGCCGATCATTTGTGCGACAAGATCACTGAAACCGGTGCTGACGTCGTCATCCCGCCGAAACGCAACCGCAAGCTCCAGCGCCCCTATGACGCCGATCTCTACAAGGAGCGAAACCGTATCGAACGCTTCTTCAACAAGCTCAAACAGTTCAGACGCGTCGCAACCCGATATGACAAGCTGCTCGCAAACTTCATGGGCTTCGTTAAACTCGCCGCTATCGCTATTTGGCTCAAATAGTTAAATCGTCACTACGGCCTAGGTCGCGGATGATTAACGTCGTTCGTCGCGCTACCATGGTTTGAAATCAAACAATCCCCCGCGGCATGGGAAATGGCGGTAACGGAAAGATCGCCAAAACGGGCTTAAGAATGCCATCATCTCGTACCGCTAGAGTAAATTTGCAGAGCATACGGTGTGCGTCAAAGACGCCAGGGGCTCGATCAAGCCGCCTCTCAGGCCGCTTTTCGTTGATGGGATCACGTTAGAAAGCCATCTCGGCCGGTGCTTATCTGCTACCGACCAAATAGACTTCGGCCGCTCTTACCGTCCCGGGTTTCGGGGGCATGCCTATGGGTTAATCGTGGTCTGTCAGGGAGTAAATCTACTCATTTACGTCACCCGGAAATGATTATAGCTGAATTGGTGTCTCCAATAACACTCGCCTCAGTTGGAGCTGGGCCAAGAAGCGGTCCAAGCGATTGGATCAGTCCTGGCGTGAAGACACAAAATCAATGGAAAAGGGAGAGTTAAATGTCCTTGCATGTCAGCTACGTAGACAAGGAAATGACGGATCATGCCCGTGCATCACAGCCGGGAAGCGCAGCGCTTGCCCAAGGAACGCAATATTCGTTATTGCTGAAGAATCAATCGGCGCAACCTTGGACCTTCTATGTCTATCAAAAGATGCCTCAACC	NA	NA	NA	NA
>prophage 1
NC_008384	Rhizobium leguminosarum bv. viciae 3841 plasmid pRL11, complete sequence	684202	372504	384122	684202	transposase,integrase	Leptospira_phage(33.33%)	13	367326:367340	382618:382632
367326:367340	attL	TCGCCTTCTCCCGAT	NA	NA	NA	NA
WP_011652218.1|372504_373383_+|integrase	tyrosine-type recombinase/integrase	integrase	S5W9T9	Leptospira_phage	31.7	3.5e-31
WP_011652217.1|373389_374586_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_011655083.1|375385_376033_+	VOC family protein	NA	NA	NA	NA	NA
WP_011655084.1|376295_377291_-|integrase	site-specific integrase	integrase	A0A1B1IQT7	uncultured_Mediterranean_phage	26.8	4.1e-12
WP_122330930.1|377287_378205_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_011655086.1|378204_379437_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1L4BKH1	Thermus_phage	30.4	2.8e-10
WP_011655087.1|379665_379953_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041936910.1|379970_380228_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011655089.1|381181_381535_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011655090.1|381691_381958_-	DUF982 domain-containing protein	NA	NA	NA	NA	NA
WP_129557821.1|382226_382454_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041936912.1|382537_382783_-	BON domain-containing protein	NA	NA	NA	NA	NA
382618:382632	attR	TCGCCTTCTCCCGAT	NA	NA	NA	NA
WP_011649142.1|383054_384122_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
>prophage 1
NC_008382	Rhizobium leguminosarum bv. viciae 3841 plasmid pRL7, complete sequence	151564	23646	68739	151564	transposase,integrase	Escherichia_phage(27.27%)	33	12825:12842	68329:68346
12825:12842	attL	CCGAAGCGCATCGTCACC	NA	NA	NA	NA
WP_041936623.1|23646_24399_-|transposase	IS6-like element ISRle6 family transposase	transposase	A0A077SL39	Escherichia_phage	46.2	1.3e-42
WP_162039381.1|24349_24502_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011654519.1|24966_26607_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011654520.1|26705_28331_+	effector protein	NA	NA	NA	NA	NA
WP_041936626.1|28920_29100_-	hypothetical protein	NA	NA	NA	NA	NA
WP_122330883.1|29120_30310_-|transposase	IS3-like element ISRle4 family transposase	transposase	S5WIU1	Leptospira_phage	44.0	3.7e-52
WP_011654523.1|30802_31381_+	winged helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_011654524.1|32855_33614_+	ATP-binding protein	NA	A0A059NT77	Lactococcus_phage	39.7	2.7e-40
WP_011654526.1|34406_35597_+	plasmid partitioning protein RepA	NA	A0A240F4U1	Ochrobactrum_phage	47.1	1.7e-76
WP_011654527.1|35586_36801_+	replication initiation protein RepC	NA	L7TKN6	Rhizobium_phage	26.5	8.3e-15
WP_011654529.1|37061_37442_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_011654530.1|37564_37996_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_041936627.1|38943_39858_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_122330884.1|39851_40652_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0K2CP59	Brevibacillus_phage	23.4	3.4e-09
WP_086935589.1|40923_41478_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_157865229.1|41405_41834_-	winged helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_011654535.1|41906_42293_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_011654536.1|42289_42634_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_011654537.1|42708_44301_+|transposase	IS66-like element ISRle3 family transposase	transposase	A0A218MNE7	uncultured_virus	33.1	1.2e-53
WP_041936629.1|44288_44492_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086935590.1|45432_46221_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157865232.1|46572_46824_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011654541.1|46774_47527_+|transposase	IS6-like element ISRle7 family transposase	transposase	A0A077SL39	Escherichia_phage	43.3	1.3e-39
WP_011654541.1|50613_51366_-|transposase	IS6-like element ISRle7 family transposase	transposase	A0A077SL39	Escherichia_phage	43.3	1.3e-39
WP_049778425.1|54983_55649_+|transposase	IS6 family transposase	transposase	NA	NA	NA	NA
WP_011654551.1|56322_56460_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011654552.1|56588_58643_+	type IV secretion system ATPase VirD4	NA	NA	NA	NA	NA
WP_122330894.1|60319_61156_+	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	26.2	6.5e-11
WP_011654554.1|61349_62072_+	response regulator	NA	NA	NA	NA	NA
WP_011653555.1|63335_64670_+|transposase	ISNCY-like element ISRle10 family transposase	transposase	NA	NA	NA	NA
WP_011654558.1|66006_67203_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1P8DJ76	Virus_Rctr85	44.3	3.4e-05
WP_049778427.1|67673_68003_+	response regulator	NA	NA	NA	NA	NA
WP_011654560.1|68034_68739_-|transposase	IS6 family transposase	transposase	NA	NA	NA	NA
68329:68346	attR	GGTGACGATGCGCTTCGG	NA	NA	NA	NA
