The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 2
NC_003295	Ralstonia solanacearum GMI1000, complete genome	3716413	841310	899438	3716413	portal,head,tRNA,transposase,terminase,capsid	Acidithiobacillus_phage(33.33%)	59	NA	NA
WP_011000751.1|841310_843965_+|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	37.7	1.0e-78
WP_043876555.1|844254_845361_+	purine nucleoside permease	NA	NA	NA	NA	NA
WP_011000753.1|845357_846398_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021155847.1|846635_848744_+	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_043876556.1|848770_849481_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011000756.1|849490_850240_-	slipin family protein	NA	J3IZE5	Acanthamoeba_polyphaga_lentillevirus	31.6	3.9e-23
WP_011000757.1|850251_851664_-	nodulation protein NfeD	NA	NA	NA	NA	NA
WP_011000758.1|851738_852647_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_020831465.1|852755_853976_+	MFS transporter	NA	NA	NA	NA	NA
WP_011000760.1|854058_854844_+	class II aldolase/adducin family protein	NA	NA	NA	NA	NA
WP_011000761.1|854856_855045_+	4-oxalocrotonate tautomerase	NA	NA	NA	NA	NA
WP_011000762.1|855097_856135_+	low specificity L-threonine aldolase	NA	NA	NA	NA	NA
WP_011000763.1|856153_856735_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_003263554.1|856774_857002_+	sulfurtransferase TusA family protein	NA	NA	NA	NA	NA
WP_011000764.1|857015_857387_-	cytochrome c	NA	NA	NA	NA	NA
WP_011000767.1|858718_859351_-	LysE family translocator	NA	NA	NA	NA	NA
WP_011000768.1|859739_860138_+	RcnB family protein	NA	NA	NA	NA	NA
WP_011000770.1|860630_861251_+	glutathione transferase GstA	NA	NA	NA	NA	NA
WP_028860305.1|861646_862453_+	endoglucanase	NA	NA	NA	NA	NA
WP_071654075.1|862467_862683_-	ester cyclase	NA	NA	NA	NA	NA
WP_016727157.1|862902_863502_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011000774.1|863635_864364_+	nitroreductase family protein	NA	NA	NA	NA	NA
WP_011000775.1|864384_864690_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011000779.1|867209_868316_+	type III secretion system YopJ family effector PopP1	NA	NA	NA	NA	NA
WP_011000780.1|868652_869465_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_162014406.1|869566_869923_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086004961.1|869968_871086_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	40.0	2.0e-47
WP_011000783.1|871127_872081_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011000784.1|872260_874870_+	preprotein translocase subunit SecA	NA	NA	NA	NA	NA
WP_043876558.1|875333_876083_+	phospholipase D family protein	NA	NA	NA	NA	NA
WP_011000786.1|876463_876754_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_011000787.1|876750_877248_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011000788.1|877244_878117_+	ATP-binding protein	NA	K4HZX9	Acidithiobacillus_phage	66.4	4.4e-103
WP_011000789.1|878134_878767_+	hypothetical protein	NA	K4ICM8	Acidithiobacillus_phage	67.5	4.7e-62
WP_043876559.1|878776_879244_+	hypothetical protein	NA	K4I3X7	Acidithiobacillus_phage	54.2	3.5e-38
WP_043876560.1|879249_879648_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011000792.1|879631_881929_+	hypothetical protein	NA	K4HZY1	Acidithiobacillus_phage	65.3	5.0e-295
WP_011000793.1|882160_882373_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011000794.1|882362_882770_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011000796.1|883333_884656_+|transposase	IS5-like element ISRso9 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	48.6	1.2e-54
WP_011000798.1|886056_887292_+	site-specific DNA-methyltransferase	NA	A0A2H4JGF1	uncultured_Caudovirales_phage	81.5	2.0e-194
WP_043876561.1|887251_887497_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043876562.1|887599_887965_-	hypothetical protein	NA	A0A2H4JI44	uncultured_Caudovirales_phage	56.3	1.4e-29
WP_011000801.1|888189_888378_-	hypothetical protein	NA	K4HZY7	Acidithiobacillus_phage	67.9	1.8e-14
WP_043876718.1|888476_888827_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011000803.1|888954_889449_-	DUF3489 domain-containing protein	NA	A0A2H4JE21	uncultured_Caudovirales_phage	57.3	6.3e-22
WP_011000804.1|889538_889811_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011000805.1|889904_890441_+	hypothetical protein	NA	A0A2H4JCL4	uncultured_Caudovirales_phage	81.5	6.5e-73
WP_011000806.1|890440_892423_+|terminase	phage terminase large subunit family protein	terminase	A0A2H4JIC6	uncultured_Caudovirales_phage	86.2	0.0e+00
WP_011000807.1|892466_892976_+|portal	phage portal protein	portal	A0A0F6WCR7	Sinorhizobium_phage	45.0	1.3e-25
WP_011000808.1|892986_893379_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011000809.1|893379_893601_+	hypothetical protein	NA	A0A2H4JCJ9	uncultured_Caudovirales_phage	58.9	5.9e-12
WP_011000810.1|893600_895127_+|portal	phage portal protein	portal	A0A1B2LRR5	Wolbachia_phage	57.9	7.6e-151
WP_011000811.1|895136_896387_+	S49 family peptidase	NA	K4HZZ6	Acidithiobacillus_phage	41.2	2.3e-60
WP_011000812.1|896396_896774_+|head	head decoration protein	head	A0A1B2LRT0	Wolbachia_phage	49.6	1.0e-24
WP_011000813.1|896780_897785_+|capsid	major capsid protein	capsid	A0A1B2LRS0	Wolbachia_phage	66.3	8.1e-109
WP_011000814.1|897787_898090_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011000815.1|898095_898542_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011000816.1|898664_899438_+	hypothetical protein	NA	A0A2D2W2E0	Stenotrophomonas_phage	44.4	4.7e-48
>prophage 3
NC_003295	Ralstonia solanacearum GMI1000, complete genome	3716413	909710	918732	3716413		Ralstonia_phage(57.14%)	9	NA	NA
WP_011000828.1|909710_913301_+	hypothetical protein	NA	A0A0M4U447	Ralstonia_phage	53.5	0.0e+00
WP_043876720.1|913312_914479_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011000830.1|914482_914965_+	hypothetical protein	NA	A0A0M4TU90	Ralstonia_phage	44.0	2.0e-12
WP_011000831.1|914961_915360_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011000832.1|915364_917209_+	hypothetical protein	NA	A0A0M4UKC5	Ralstonia_phage	46.7	8.2e-107
WP_011000833.1|917218_917443_+	hypothetical protein	NA	A0A0M5MVN2	Ralstonia_phage	58.1	4.7e-17
WP_003270772.1|917510_917801_+	membrane protein	NA	K4I011	Acidithiobacillus_phage	47.6	3.1e-13
WP_011000834.1|917797_918274_+	hypothetical protein	NA	K4ICR8	Acidithiobacillus_phage	82.9	7.1e-71
WP_011000835.1|918270_918732_+	lysozyme	NA	K4I410	Acidithiobacillus_phage	83.0	4.6e-67
>prophage 4
NC_003295	Ralstonia solanacearum GMI1000, complete genome	3716413	964600	972836	3716413		Bacillus_phage(16.67%)	8	NA	NA
WP_011000865.1|964600_965974_+	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	38.9	2.5e-76
WP_049842162.1|966000_966948_+	D-glycero-beta-D-manno-heptose-7-phosphate kinase	NA	A0A2H4N7X4	Lake_Baikal_phage	27.6	9.0e-17
WP_011000867.1|966944_967940_+	ADP-glyceromanno-heptose 6-epimerase	NA	R9S880	Prochlorococcus_phage	32.3	4.1e-28
WP_011000868.1|968069_968387_+	ComEA family DNA-binding protein	NA	NA	NA	NA	NA
WP_011000869.1|968490_969393_+	cysteine synthase CysM	NA	A0A1X9I5K7	Streptococcus_phage	40.8	8.2e-52
WP_028852812.1|969473_970586_-	lytic murein transglycosylase B	NA	NA	NA	NA	NA
WP_011000871.1|970703_971627_+	histone deacetylase family protein	NA	A0A2K9KZC4	Tupanvirus	35.9	9.3e-43
WP_011000872.1|971783_972836_+	methionine ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	33.5	4.0e-26
>prophage 5
NC_003295	Ralstonia solanacearum GMI1000, complete genome	3716413	1004869	1013032	3716413		Ralstonia_phage(50.0%)	8	NA	NA
WP_043876725.1|1004869_1007527_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	85.3	0.0e+00
WP_011000911.1|1007529_1008369_+	hypothetical protein	NA	A0A077KEQ4	Ralstonia_phage	74.6	1.2e-108
WP_011000912.1|1008365_1010606_+	alpha/beta hydrolase	NA	A0A077K801	Ralstonia_phage	83.1	0.0e+00
WP_011000913.1|1010614_1010881_+	PAAR domain-containing protein	NA	R9U4D0	Rhizobium_phage	52.2	4.9e-05
WP_011000914.1|1011504_1011771_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	50.6	2.4e-12
WP_011000915.1|1011788_1012517_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080511051.1|1012538_1012757_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080511052.1|1012804_1013032_+	ogr/Delta-like zinc finger family protein	NA	E5E3P1	Burkholderia_phage	51.7	3.0e-11
>prophage 6
NC_003295	Ralstonia solanacearum GMI1000, complete genome	3716413	1756421	1830338	3716413	portal,protease,lysis,head,tRNA,transposase,integrase,terminase,tail,capsid	Burkholderia_virus(20.83%)	85	1778559:1778579	1825682:1825702
WP_011001577.1|1756421_1757402_+|tRNA	tRNA-dihydrouridine synthase	tRNA	NA	NA	NA	NA
WP_011001578.1|1757468_1758830_+	30S ribosomal protein S12 methylthiotransferase RimO	NA	NA	NA	NA	NA
WP_011001579.1|1758925_1760110_+	acetyl-CoA C-acyltransferase family protein	NA	NA	NA	NA	NA
WP_080511060.1|1760114_1760822_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011001581.1|1760864_1762079_+	cystathionine beta-lyase	NA	NA	NA	NA	NA
WP_011001582.1|1762106_1762964_-	phosphoserine phosphatase SerB	NA	NA	NA	NA	NA
WP_011001583.1|1763075_1764269_-	acetylornithine deacetylase	NA	NA	NA	NA	NA
WP_043876597.1|1764303_1767735_-	transcription-repair coupling factor	NA	NA	NA	NA	NA
WP_011001585.1|1767906_1768668_+	2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_011001586.1|1768664_1769171_+	2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase	NA	NA	NA	NA	NA
WP_011001587.1|1769250_1769778_-	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_016721800.1|1769836_1770385_-	peroxiredoxin	NA	NA	NA	NA	NA
WP_011001589.1|1770550_1771912_-	HAMP domain-containing protein	NA	NA	NA	NA	NA
WP_003267785.1|1771949_1772672_-	two-component system response regulator OmpR	NA	W8CYM9	Bacillus_phage	35.8	1.4e-33
WP_020425251.1|1772951_1773302_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011001591.1|1773373_1774990_+	DUF1800 family protein	NA	NA	NA	NA	NA
WP_011001592.1|1775017_1776202_+	DUF1501 domain-containing protein	NA	NA	NA	NA	NA
WP_011001593.1|1776202_1777075_-	presqualene diphosphate synthase HpnD	NA	NA	NA	NA	NA
WP_011001594.1|1777211_1778420_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_011001595.1|1778486_1781606_+	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
1778559:1778579	attL	GCGCTGCTGCTCGGCGGCATC	NA	NA	NA	NA
WP_011001596.1|1781994_1782999_+|integrase	site-specific integrase	integrase	A0A0A0YR56	Pseudomonas_phage	49.8	2.9e-66
WP_080511061.1|1782999_1783308_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011001597.1|1783361_1784927_-	hypothetical protein	NA	Q8W6Q9	Burkholderia_virus	54.1	3.1e-30
WP_011001598.1|1784928_1785729_-	PRTRC system ThiF family protein	NA	NA	NA	NA	NA
WP_011001599.1|1785725_1786511_-	PRTRC system protein A	NA	NA	NA	NA	NA
WP_011001600.1|1786512_1787235_-	PRTRC system protein B	NA	NA	NA	NA	NA
WP_011001601.1|1787242_1788292_-	PRTRC system protein F	NA	NA	NA	NA	NA
WP_011001602.1|1788288_1788678_-	PRTRC system protein C	NA	NA	NA	NA	NA
WP_011001603.1|1788690_1789284_-	PRTRC system protein E	NA	NA	NA	NA	NA
WP_011001604.1|1789309_1789546_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011001605.1|1789542_1789974_-	hypothetical protein	NA	A0A291LIA5	Streptomyces_phage	36.8	9.4e-06
WP_011001606.1|1789983_1790199_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011001607.1|1790204_1790357_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011001608.1|1790353_1790791_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011001609.1|1790787_1791162_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157048845.1|1791170_1791308_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011001611.1|1791855_1792161_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086004752.1|1792211_1793014_-|transposase	IS5-like element IS1421 family transposase	transposase	NA	NA	NA	NA
WP_011001614.1|1793028_1793487_-	hypothetical protein	NA	NA	NA	NA	NA
WP_078222094.1|1793625_1794150_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_011001616.1|1794706_1795210_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011001617.1|1795206_1795617_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011001618.1|1795625_1795823_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043876600.1|1795819_1796854_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011001619.1|1796850_1797147_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011001620.1|1797170_1797773_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011001621.1|1797956_1798331_+	HNH endonuclease	NA	A0A1B0RXJ3	Streptococcus_phage	43.1	2.8e-22
WP_049832880.1|1798754_1799096_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043876602.1|1799140_1800811_+|terminase	terminase large subunit	terminase	C7BGG7	Burkholderia_phage	62.4	4.8e-207
WP_011001622.1|1800813_1800972_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011001623.1|1800968_1802192_+|portal	phage portal protein	portal	A0A1J0GUY8	Halomonas_phage	69.6	7.7e-162
WP_011001624.1|1802199_1802811_+|head,protease	HK97 family phage prohead protease	head,protease	A0A1J0GUZ0	Halomonas_phage	63.1	9.4e-60
WP_011001625.1|1802821_1804060_+|capsid	phage major capsid protein	capsid	Q8SBH8	Shigella_phage	56.8	2.5e-128
WP_011001626.1|1804093_1804417_+|head,tail	phage gp6-like head-tail connector protein	head,tail	NA	NA	NA	NA
WP_011001627.1|1804424_1804751_+|head	phage head closure protein	head	NA	NA	NA	NA
WP_011001628.1|1804753_1805257_+	hypothetical protein	NA	I7GSL4	Xanthomonas_virus	33.3	6.2e-09
WP_011001629.1|1805246_1805600_+	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_011001630.1|1805663_1806317_+|tail	phage tail protein	tail	A0A0H5BBY3	Pseudomonas_phage	51.6	2.2e-54
WP_043876603.1|1806322_1806643_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080511062.1|1806690_1806951_+	DUF1799 domain-containing protein	NA	A0A2R3UAE2	Siphoviridae_environmental_samples	45.5	5.5e-09
WP_011001631.1|1806952_1809826_+|tail	phage tail tape measure protein	tail	A0A1V0E821	Vibrio_phage	33.8	1.7e-90
WP_011001632.1|1809828_1810167_+|tail	phage tail protein	tail	Q8W6T5	Burkholderia_virus	47.7	3.6e-21
WP_011001633.1|1810163_1810841_+|tail	phage tail protein	tail	A0A1W6JT73	Escherichia_phage	46.7	7.8e-31
WP_011001634.1|1810846_1811443_+|tail	tail fiber assembly protein	tail	NA	NA	NA	NA
WP_011001635.1|1811439_1812141_+|tail	phage minor tail protein L	tail	Q6JIL5	Burkholderia_virus	62.4	2.6e-77
WP_011001636.1|1812142_1812853_+	C40 family peptidase	NA	D6PG99	uncultured_phage	54.5	2.6e-69
WP_011001637.1|1812856_1813459_+|tail	tail assembly protein	tail	Q8W6T1	Burkholderia_virus	55.5	1.8e-50
WP_011001638.1|1813528_1813867_-	type II toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_043876605.1|1813863_1814118_-	type II toxin-antitoxin system HicA family toxin	NA	NA	NA	NA	NA
WP_011001639.1|1814169_1817325_+	host specificity protein J	NA	A4JX16	Burkholderia_virus	56.7	0.0e+00
WP_043876606.1|1817324_1817636_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011001640.1|1817661_1818318_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011001641.1|1818386_1818878_+	glycoside hydrolase family protein	NA	D5LH07	Escherichia_phage	67.7	8.7e-56
WP_011001642.1|1818877_1819186_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011001643.1|1819188_1819464_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011001644.1|1819463_1820009_+|lysis	lysis protein	lysis	A0A0H5AUG6	Pseudomonas_phage	43.6	2.6e-08
WP_011001645.1|1820272_1821238_-|transposase	IS5-like element ISRso18 family transposase	transposase	A0A077K814	Ralstonia_phage	93.1	7.9e-170
WP_071623775.1|1821304_1822375_-	hypothetical protein	NA	NA	NA	NA	NA
WP_119918759.1|1822503_1822773_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043876739.1|1822837_1823875_-	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_011001649.1|1824371_1824566_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011001650.1|1824637_1826611_+|tRNA	bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	tRNA	NA	NA	NA	NA
1825682:1825702	attR	GATGCCGCCGAGCAGCAGCGC	NA	NA	NA	NA
WP_011001651.1|1826865_1828215_+	trigger factor	NA	NA	NA	NA	NA
WP_003267806.1|1828244_1828898_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	54.9	1.8e-53
WP_011001652.1|1829063_1830338_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	58.9	4.9e-135
>prophage 7
NC_003295	Ralstonia solanacearum GMI1000, complete genome	3716413	1987270	2056036	3716413	integrase,tRNA,transposase	Pseudomonas_phage(50.0%)	53	2031675:2031692	2061804:2061821
WP_011001756.1|1987270_1988761_+|tRNA	methionine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_011001757.1|1988757_1989102_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_011001758.1|1989575_1990199_+	flavin reductase family protein	NA	NA	NA	NA	NA
WP_011001759.1|1990209_1990653_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_043876743.1|1990745_1991447_-	Asp/Glu racemase	NA	NA	NA	NA	NA
WP_011001761.1|1991500_1992532_-	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
WP_011001762.1|1992676_1993636_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_011001763.1|1993687_1994827_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_011001764.1|1994865_1997184_-	bifunctional salicylyl-CoA 5-hydroxylase/oxidoreductase	NA	NA	NA	NA	NA
WP_011001765.1|1997180_1997627_-	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_011001766.1|1997631_1999143_-	indolepyruvate oxidoreductase subunit beta family protein	NA	NA	NA	NA	NA
WP_086004966.1|2001544_2002755_-|transposase	IS3-like element ISRso10 family transposase	transposase	A0A1B0Z042	Pseudomonas_phage	65.5	8.9e-102
WP_011001770.1|2003333_2004362_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_011001771.1|2004549_2005443_-	transporter	NA	NA	NA	NA	NA
WP_011001772.1|2005546_2007154_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_011001773.1|2007157_2007949_-	cyclase family protein	NA	NA	NA	NA	NA
WP_011001774.1|2007985_2008537_-	flavin reductase family protein	NA	NA	NA	NA	NA
WP_011001775.1|2008547_2009798_-	alanine-phosphoribitol ligase	NA	NA	NA	NA	NA
WP_011001776.1|2009845_2010634_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_162939063.1|2011211_2019116_-	Type III effector protein (Skwp 4)	NA	NA	NA	NA	NA
WP_011001778.1|2019455_2020334_+	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_011001779.1|2020539_2021427_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_080511063.1|2021715_2022018_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043876613.1|2022268_2022985_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011001781.1|2023800_2025276_-|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_011001782.1|2025557_2026061_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011001783.1|2026053_2028357_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011001784.1|2028353_2029922_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_011001785.1|2029857_2031096_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_011001786.1|2031487_2031943_-	hypothetical protein	NA	NA	NA	NA	NA
2031675:2031692	attL	GCGCCATTGGCGCCAATC	NA	NA	NA	NA
WP_011001787.1|2032081_2032555_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_043876614.1|2032885_2033362_-	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_011001789.1|2033471_2033939_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_011001790.1|2034094_2035633_-	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_011001791.1|2035645_2036803_-	HlyD family secretion protein	NA	NA	NA	NA	NA
WP_011001792.1|2036827_2038255_-	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_155738957.1|2039096_2039258_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011001794.1|2039256_2039874_+	FABP family protein	NA	NA	NA	NA	NA
WP_011001795.1|2040078_2041470_-	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_011001796.1|2041646_2042639_+	ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_011001797.1|2042642_2044619_+	cytochrome o ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_011001798.1|2044621_2045248_+	cytochrome o ubiquinol oxidase subunit III	NA	NA	NA	NA	NA
WP_011001799.1|2045244_2045622_+	cytochrome o ubiquinol oxidase subunit IV	NA	NA	NA	NA	NA
WP_011001800.1|2045648_2047382_+	nitrite/sulfite reductase	NA	NA	NA	NA	NA
WP_011001801.1|2047368_2047878_+	DUF934 domain-containing protein	NA	NA	NA	NA	NA
WP_011001433.1|2047947_2049282_+|transposase	IS4-like element ISRso13 family transposase	transposase	NA	NA	NA	NA
WP_043876615.1|2051440_2051731_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011001803.1|2051854_2052211_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011001804.1|2052493_2052661_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011001805.1|2052657_2052951_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_011001806.1|2052954_2053215_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_011001807.1|2053400_2054642_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011001808.1|2054818_2056036_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	56.1	1.1e-123
2061804:2061821	attR	GATTGGCGCCAATGGCGC	NA	NA	NA	NA
>prophage 8
NC_003295	Ralstonia solanacearum GMI1000, complete genome	3716413	2084601	2115573	3716413	plate,portal,head,holin,integrase,tail,capsid,terminase	Ralstonia_phage(66.67%)	40	2084443:2084460	2125140:2125157
2084443:2084460	attL	CCCCTCTCTCCGCCAGGA	NA	NA	NA	NA
WP_011001833.1|2084601_2085837_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	A0A077KET4	Ralstonia_phage	98.8	3.4e-234
WP_011001834.1|2085811_2086027_-	AlpA family transcriptional regulator	NA	A0A077K9Z8	Ralstonia_phage	97.2	4.5e-33
WP_011001835.1|2086023_2088732_-	toprim domain-containing protein	NA	A0A077K8T2	Ralstonia_phage	99.6	0.0e+00
WP_011001836.1|2088786_2088993_-	hypothetical protein	NA	A0A077K9T6	Ralstonia_phage	100.0	6.9e-31
WP_011001837.1|2088985_2089228_-	hypothetical protein	NA	A0A077K830	Ralstonia_phage	97.5	1.6e-39
WP_011001838.1|2089227_2089440_-	hypothetical protein	NA	A0A077KET1	Ralstonia_phage	94.4	2.2e-24
WP_011001839.1|2089436_2089604_-	hypothetical protein	NA	A4PE63	Ralstonia_virus	79.2	3.6e-14
WP_011001840.1|2089600_2089834_-	hypothetical protein	NA	A4PE62	Ralstonia_virus	55.4	1.2e-12
WP_011001841.1|2089948_2090197_-	ogr/Delta-like zinc finger family protein	NA	A0A077K829	Ralstonia_phage	82.9	4.7e-34
WP_080511084.1|2090193_2090478_-	DNA-binding protein	NA	A0A1S5NNI6	Burkholderia_phage	71.7	5.0e-32
WP_043876747.1|2090764_2091268_+	helix-turn-helix transcriptional regulator	NA	A0A077K9Z1	Ralstonia_phage	64.7	1.9e-45
WP_011001847.1|2091937_2092489_-	hypothetical protein	NA	A0A077K9T2	Ralstonia_phage	96.6	6.2e-95
WP_011001849.1|2092848_2093973_-	phage late control D family protein	NA	A4PE54	Ralstonia_virus	96.5	3.7e-203
WP_011001850.1|2093969_2094392_-|tail	phage tail protein	tail	A4PE53	Ralstonia_virus	99.3	1.4e-73
WP_011001851.1|2094394_2097058_-	hypothetical protein	NA	A4PE52	Ralstonia_virus	93.6	0.0e+00
WP_011001852.1|2097054_2097156_-|tail	GpE family phage tail protein	tail	A0A077K821	Ralstonia_phage	97.0	2.1e-09
WP_011001853.1|2097152_2097509_-|tail	phage tail assembly protein	tail	A4PE51	Ralstonia_virus	98.3	1.2e-54
WP_011001854.1|2097554_2098064_-|tail	phage major tail tube protein	tail	A0A077KER7	Ralstonia_phage	100.0	8.3e-94
WP_011001855.1|2098095_2099271_-|tail	phage tail sheath protein	tail	A0A077K9Y4	Ralstonia_phage	96.2	3.9e-219
WP_011001856.1|2099364_2099829_-	hypothetical protein	NA	A0A077K8R9	Ralstonia_phage	92.2	6.2e-80
WP_011001857.1|2099825_2100578_-	hypothetical protein	NA	A4PE47	Ralstonia_virus	90.4	1.6e-117
WP_011001858.1|2100590_2102255_-|tail	phage tail protein	tail	A0A077K818	Ralstonia_phage	98.7	0.0e+00
WP_011001859.1|2102261_2102879_-|tail	phage tail protein I	tail	A0A077KER5	Ralstonia_phage	96.2	6.5e-101
WP_011001860.1|2102871_2103780_-|plate	baseplate assembly protein	plate	A0A077K9X9	Ralstonia_phage	96.0	8.8e-155
WP_011001861.1|2103782_2104130_-	GPW/gp25 family protein	NA	A4PE42	Ralstonia_virus	93.9	1.4e-55
WP_011001862.1|2104126_2104744_-|plate	phage baseplate assembly protein V	plate	A4PE41	Ralstonia_virus	94.6	1.3e-109
WP_011001863.1|2105006_2105702_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011001864.1|2105779_2106232_+	hypothetical protein	NA	A0A077KER3	Ralstonia_phage	72.7	1.4e-55
WP_011001865.1|2106253_2106700_-	phage virion morphogenesis protein	NA	A0A077K9X5	Ralstonia_phage	92.5	1.3e-69
WP_011001866.1|2106696_2107131_-|tail	phage tail protein	tail	A0A077K8R3	Ralstonia_phage	96.5	3.0e-76
WP_011001867.1|2107127_2107628_-	hypothetical protein	NA	A0A077K9R7	Ralstonia_phage	92.8	1.1e-77
WP_011001868.1|2107624_2108431_-	DUF3380 domain-containing protein	NA	A4PE36	Ralstonia_virus	98.9	1.0e-146
WP_011001869.1|2108427_2108742_-|holin	phage holin family protein	holin	A4PE35	Ralstonia_virus	98.1	1.7e-49
WP_011001870.1|2108738_2109143_-|holin	phage holin family protein	holin	A0A077K9X1	Ralstonia_phage	97.8	8.2e-28
WP_011001871.1|2109158_2109365_-|tail	tail protein X	tail	A0A077K8R0	Ralstonia_phage	100.0	1.8e-31
WP_011001872.1|2109364_2109844_-|head	head completion/stabilization protein	head	A4PE32	Ralstonia_virus	100.0	2.3e-85
WP_011001873.1|2109940_2110663_-|terminase	terminase endonuclease subunit	terminase	A0A077K804	Ralstonia_phage	98.3	2.6e-125
WP_011001874.1|2110659_2111676_-|capsid	phage major capsid protein, P2 family	capsid	A0A077KEQ8	Ralstonia_phage	100.0	4.7e-189
WP_011001875.1|2111729_2112569_-|capsid	GPO family capsid scaffolding protein	capsid	A0A077K9W8	Ralstonia_phage	95.3	1.8e-146
WP_011001878.1|2114487_2115573_+|portal	phage portal protein	portal	A0A077K9Q8	Ralstonia_phage	97.0	2.7e-206
2125140:2125157	attR	CCCCTCTCTCCGCCAGGA	NA	NA	NA	NA
>prophage 9
NC_003295	Ralstonia solanacearum GMI1000, complete genome	3716413	2829831	2839964	3716413		unidentified_phage(14.29%)	9	NA	NA
WP_011002537.1|2829831_2831376_+	polynucleotide adenylyltransferase PcnB	NA	H7BUW3	unidentified_phage	33.6	3.6e-23
WP_011002538.1|2831375_2831885_+	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_011002539.1|2831918_2832563_+	deoxynucleoside kinase	NA	M1IA15	Paramecium_bursaria_Chlorella_virus	27.8	1.7e-06
WP_011002540.1|2832619_2833444_+	3-methyl-2-oxobutanoate hydroxymethyltransferase	NA	A0A0N7HVJ8	Ostreococcus_lucimarinus_virus	31.3	1.9e-34
WP_011002541.1|2833455_2834163_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_011002542.1|2834170_2834857_+	energy-coupling factor ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	27.2	1.5e-13
WP_011002543.1|2834812_2836693_-	bifunctional anthranilate synthase component I family protein/class IV aminotransferase	NA	A0A0B5J984	Pandoravirus	37.4	4.6e-57
WP_011002544.1|2836728_2837871_-	molecular chaperone DnaJ	NA	A0A0P0YMJ9	Yellowstone_lake_phycodnavirus	32.7	2.9e-22
WP_028853574.1|2838005_2839964_-	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	49.3	1.7e-147
>prophage 10
NC_003295	Ralstonia solanacearum GMI1000, complete genome	3716413	2855123	2903206	3716413	protease,coat	Bacillus_phage(16.67%)	44	NA	NA
WP_011002563.1|2855123_2856755_+|protease	MprA protease, GlyGly-CTERM protein-sorting domain-containing form	protease	NA	NA	NA	NA
WP_011002564.1|2856973_2859013_+|protease	MprA protease, GlyGly-CTERM protein-sorting domain-containing form	protease	A0A1B0T6A2	Bacillus_phage	34.7	3.5e-10
WP_011002565.1|2859068_2859689_-	rhombosortase	NA	NA	NA	NA	NA
WP_011002566.1|2859685_2862553_-	bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase	NA	NA	NA	NA	NA
WP_011002567.1|2862731_2867012_+	TIGR02099 family protein	NA	NA	NA	NA	NA
WP_011002568.1|2867017_2867887_+	carbon-nitrogen hydrolase family protein	NA	M1H5W0	Paramecium_bursaria_Chlorella_virus	25.3	8.3e-09
WP_011002569.1|2867914_2869375_+|protease	metalloprotease TldD	protease	NA	NA	NA	NA
WP_011002570.1|2869767_2870847_+	3-deoxy-7-phosphoheptulonate synthase AroG	NA	A0A2I6UFP9	Klebsiella_phage	45.0	1.1e-76
WP_011002571.1|2870970_2871306_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_011002572.1|2871590_2872487_+	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_011002573.1|2872560_2873118_-	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_011002574.1|2873240_2874659_+	FAD-binding protein	NA	NA	NA	NA	NA
WP_011002575.1|2874669_2875560_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011002576.1|2875730_2877224_+	FAD-binding protein	NA	NA	NA	NA	NA
WP_011002577.1|2877234_2878353_+	glycolate oxidase subunit GlcE	NA	NA	NA	NA	NA
WP_011002578.1|2878362_2879610_+	glycolate oxidase subunit GlcF	NA	NA	NA	NA	NA
WP_011002579.1|2879661_2880039_+	CidA/LrgA family protein	NA	NA	NA	NA	NA
WP_011002580.1|2880035_2880758_+	LrgB family protein	NA	NA	NA	NA	NA
WP_011002581.1|2880916_2881312_+	VOC family protein	NA	NA	NA	NA	NA
WP_011002582.1|2881362_2881842_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_011002583.1|2881884_2882583_+	YafY family transcriptional regulator	NA	NA	NA	NA	NA
WP_011002584.1|2882599_2883097_-	glutathione peroxidase	NA	Q6VZR0	Canarypox_virus	40.2	5.5e-26
WP_011002585.1|2883192_2886405_-	pilus assembly protein	NA	NA	NA	NA	NA
WP_011002586.1|2886436_2886973_-	pilus assembly PilX N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_016723683.1|2886976_2888005_-	PilW family protein	NA	NA	NA	NA	NA
WP_011002588.1|2888001_2888592_-	type IV pilus modification protein PilV	NA	NA	NA	NA	NA
WP_016723684.1|2888588_2889077_-	GspH/FimT family pseudopilin	NA	NA	NA	NA	NA
WP_011002590.1|2889080_2889521_-	type IV pilin protein	NA	NA	NA	NA	NA
WP_011002591.1|2889715_2890855_-	PilT/PilU family type 4a pilus ATPase	NA	NA	NA	NA	NA
WP_011002592.1|2890907_2891951_-	type IV pilus twitching motility protein PilT	NA	NA	NA	NA	NA
WP_011002593.1|2892075_2892798_+	YggS family pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_011002594.1|2892832_2893657_+	pyrroline-5-carboxylate reductase	NA	NA	NA	NA	NA
WP_011002595.1|2893678_2893957_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011002596.1|2893953_2894829_-	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
WP_003271865.1|2894902_2895403_-	DNA starvation/stationary phase protection protein	NA	A0A2H4N7L5	Lake_Baikal_phage	36.2	2.1e-20
WP_011002597.1|2895561_2895804_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011002598.1|2895862_2896111_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016723690.1|2896329_2897274_-	hydrogen peroxide-inducible genes activator	NA	A0A2P0ZL89	Lactobacillus_phage	23.9	4.0e-09
WP_011002600.1|2897879_2898422_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172833515.1|2898491_2898980_-|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
WP_011002602.1|2898997_2901262_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_043876652.1|2901311_2902031_-	molecular chaperone	NA	NA	NA	NA	NA
WP_011002604.1|2902149_2902653_-|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
WP_011002605.1|2902702_2903206_-|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
>prophage 11
NC_003295	Ralstonia solanacearum GMI1000, complete genome	3716413	3487428	3498183	3716413		Acidithiobacillus_phage(84.62%)	13	NA	NA
WP_011003116.1|3487428_3487893_-	hypothetical protein	NA	K4ICN3	Acidithiobacillus_phage	67.6	1.7e-53
WP_011003117.1|3488035_3490315_-	hypothetical protein	NA	K4HZY1	Acidithiobacillus_phage	74.5	0.0e+00
WP_011003118.1|3490311_3490572_-	DNA-binding protein	NA	K4I1D6	Acidithiobacillus_phage	62.0	5.5e-17
WP_011003119.1|3490568_3491327_-	hypothetical protein	NA	K4HZA0	Acidithiobacillus_phage	62.1	1.3e-82
WP_011003120.1|3491313_3491862_-	HNH endonuclease	NA	A0A1B0TRC1	Escherichia_phage	39.3	4.1e-22
WP_011003121.1|3491861_3492374_-	hypothetical protein	NA	K4I3X7	Acidithiobacillus_phage	67.5	7.2e-53
WP_011003122.1|3492381_3493029_-	hypothetical protein	NA	K4ICM8	Acidithiobacillus_phage	73.3	1.2e-81
WP_011003123.1|3493025_3493931_-	ATP-binding protein	NA	K4HZX9	Acidithiobacillus_phage	68.2	2.4e-104
WP_043876681.1|3493902_3494436_-	HNH endonuclease	NA	A0A172JFU7	Citrobacter_phage	39.2	2.1e-23
WP_011003125.1|3494450_3494933_-	hypothetical protein	NA	K4HZ96	Acidithiobacillus_phage	57.5	3.4e-44
WP_011003126.1|3494943_3495207_-	hypothetical protein	NA	K4I3X3	Acidithiobacillus_phage	75.4	3.5e-19
WP_011003127.1|3495434_3495896_+	helix-turn-helix domain-containing protein	NA	K4ICM4	Acidithiobacillus_phage	64.1	1.2e-46
WP_011003128.1|3495945_3498183_+	hypothetical protein	NA	K4I1D0	Acidithiobacillus_phage	66.1	4.0e-289
>prophage 1
NC_003296	Ralstonia solanacearum GMI1000, complete genome	2094509	562933	626294	2094509	transposase	Escherichia_phage(25.0%)	46	NA	NA
WP_011000214.1|562933_563977_+|transposase	IS21-like element ISRso6 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	45.1	2.9e-77
WP_011000215.1|563973_564819_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	57.5	3.1e-77
WP_011003764.1|565488_566895_-	RHS repeat protein	NA	NA	NA	NA	NA
WP_011003765.1|566936_569582_-	RHS repeat protein	NA	NA	NA	NA	NA
WP_119918820.1|569807_571811_-	RHS repeat protein	NA	NA	NA	NA	NA
WP_011003768.1|572492_574256_-	RHS repeat protein	NA	NA	NA	NA	NA
WP_080511098.1|574685_576515_-	RHS repeat protein	NA	NA	NA	NA	NA
WP_086004966.1|577527_578738_-|transposase	IS3-like element ISRso10 family transposase	transposase	A0A1B0Z042	Pseudomonas_phage	65.5	8.9e-102
WP_011003770.1|579338_579833_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011003771.1|579822_580539_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011001433.1|581897_583232_+|transposase	IS4-like element ISRso13 family transposase	transposase	NA	NA	NA	NA
WP_011003773.1|583153_583669_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011003774.1|583670_584864_-	type II secretion system F family protein	NA	NA	NA	NA	NA
WP_119918784.1|584867_585275_-	type II secretion system major pseudopilin GspG	NA	NA	NA	NA	NA
WP_011003776.1|585305_585770_-	type II secretion system protein	NA	NA	NA	NA	NA
WP_011003777.1|585756_586143_-	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	NA	NA	NA	NA
WP_011003778.1|586136_586613_-	type II secretion system protein	NA	NA	NA	NA	NA
WP_011003779.1|586609_587098_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043876929.1|587099_587675_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011003443.1|589926_591258_-|transposase	IS701-like element ISRso17 family transposase	transposase	NA	NA	NA	NA
WP_011003782.1|591919_596026_+	discoidin domain-containing protein	NA	NA	NA	NA	NA
WP_155740427.1|598433_598724_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011000219.1|598844_600095_+|transposase	IS256-like element ISRso7 family transposase	transposase	A0A218MNI5	uncultured_virus	42.8	4.8e-42
WP_011003784.1|600676_601426_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.9	1.2e-27
WP_011003785.1|601422_602211_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_011003786.1|602235_603003_-	amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_011003787.1|603265_603703_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_011003788.1|603841_604891_+	ornithine cyclodeaminase	NA	A0A1V0SL93	Klosneuvirus	52.1	1.8e-98
WP_011003789.1|604887_605847_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011003790.1|605891_606509_-	HAD hydrolase-like protein	NA	NA	NA	NA	NA
WP_011003791.1|606881_607328_-	DUF3005 domain-containing protein	NA	NA	NA	NA	NA
WP_011003792.1|608099_609632_+	M20 family peptidase	NA	NA	NA	NA	NA
WP_011003793.1|609750_611148_-	heavy metal sensor histidine kinase	NA	NA	NA	NA	NA
WP_011003794.1|611144_611819_-	heavy metal response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.5	8.0e-36
WP_011003795.1|612088_612394_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011003796.1|612399_613725_+	TolC family protein	NA	NA	NA	NA	NA
WP_011003797.1|613751_614966_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_011003798.1|614976_618171_+	CusA/CzcA family heavy metal efflux RND transporter	NA	NA	NA	NA	NA
WP_011003799.1|618177_618612_-	HIT family protein	NA	NA	NA	NA	NA
WP_011003801.1|619076_620300_-	DUF2087 domain-containing protein	NA	NA	NA	NA	NA
WP_019719262.1|620307_620736_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011003803.1|621009_621891_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_011003804.1|621890_623090_-	MFS transporter	NA	NA	NA	NA	NA
WP_011003805.1|623089_624280_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011003806.1|624380_624614_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086004967.1|625174_626294_+|transposase	IS3-like element ISRso12 family transposase	transposase	S5WIU1	Leptospira_phage	41.4	1.9e-50
>prophage 2
NC_003296	Ralstonia solanacearum GMI1000, complete genome	2094509	687803	723390	2094509	transposase	uncultured_Caudovirales_phage(50.0%)	34	NA	NA
WP_086004959.1|687803_688983_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	42.9	1.1e-61
WP_119918788.1|689356_689629_+	DUF2384 domain-containing protein	NA	NA	NA	NA	NA
WP_011003850.1|689890_690751_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011003851.1|690841_692614_+	ShlB/FhaC/HecB family hemolysin secretion/activation protein	NA	NA	NA	NA	NA
WP_052286333.1|693285_694653_+	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_011003853.1|694945_696079_-	nickel/cobalt efflux transporter RcnA	NA	NA	NA	NA	NA
WP_011003854.1|696180_696453_+	metal/formaldehyde-sensitive transcriptional repressor	NA	NA	NA	NA	NA
WP_011003855.1|696585_697557_+	chromate resistance protein	NA	NA	NA	NA	NA
WP_011003856.1|697575_698781_+	chromate transporter	NA	NA	NA	NA	NA
WP_043876826.1|698834_699341_+	chromate resistance protein	NA	NA	NA	NA	NA
WP_086004986.1|699423_700564_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.4	2.6e-50
WP_080511102.1|700724_701105_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155740431.1|701322_703251_+	hypothetical protein	NA	NA	NA	NA	NA
WP_119918822.1|705196_705637_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_011003864.1|705517_706075_-	redoxin domain-containing protein	NA	NA	NA	NA	NA
WP_011003865.1|706064_707108_-	transporter	NA	NA	NA	NA	NA
WP_071015387.1|707198_707576_-	DUF2946 domain-containing protein	NA	NA	NA	NA	NA
WP_086004987.1|707964_709174_+|transposase	IS3 family transposase	transposase	A0A1B0Z042	Pseudomonas_phage	62.2	4.3e-96
WP_119918790.1|709240_709612_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011003870.1|709960_710533_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011003871.1|710924_711593_+	site-specific DNA-methyltransferase	NA	A0A2H4JGF1	uncultured_Caudovirales_phage	59.5	6.9e-64
WP_011003872.1|711725_711974_+	site-specific DNA-methyltransferase	NA	A0A2H4JGF1	uncultured_Caudovirales_phage	84.8	8.0e-34
WP_028861544.1|711970_712336_+	site-specific DNA-methyltransferase	NA	A0A2H4JGF1	uncultured_Caudovirales_phage	74.7	2.0e-28
WP_011003873.1|712251_712908_-	type III secretion system effector protein	NA	NA	NA	NA	NA
WP_011003875.1|713734_713923_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043876937.1|714020_714371_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011003879.1|715788_716010_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011003880.1|716107_716644_+	hypothetical protein	NA	A0A2H4JCL4	uncultured_Caudovirales_phage	82.6	9.1e-75
WP_086004752.1|717007_717809_+|transposase	IS5-like element IS1421 family transposase	transposase	NA	NA	NA	NA
WP_080511103.1|718314_719949_+	glycoside hydrolase family 6 protein	NA	NA	NA	NA	NA
WP_011000796.1|720129_721452_-|transposase	IS5-like element ISRso9 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	48.6	1.2e-54
WP_071615493.1|722200_722533_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011003885.1|722583_723054_-	DUF2147 domain-containing protein	NA	NA	NA	NA	NA
WP_011003886.1|723258_723390_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 3
NC_003296	Ralstonia solanacearum GMI1000, complete genome	2094509	1648985	1682957	2094509	transposase	Heterosigma_akashiwo_virus(100.0%)	30	NA	NA
WP_011001433.1|1648985_1650320_-|transposase	IS4-like element ISRso13 family transposase	transposase	NA	NA	NA	NA
WP_011003443.1|1650529_1651861_-|transposase	IS701-like element ISRso17 family transposase	transposase	NA	NA	NA	NA
WP_011004581.1|1651942_1652767_-|transposase	IS5-like element ISRso1 family transposase	transposase	NA	NA	NA	NA
WP_086004991.1|1656832_1657177_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_011004585.1|1657307_1658885_+	polyamine aminopropyltransferase	NA	A0A1C9C533	Heterosigma_akashiwo_virus	27.0	5.5e-11
WP_011004586.1|1658898_1660521_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_011004587.1|1660556_1661273_-	dienelactone hydrolase family protein	NA	NA	NA	NA	NA
WP_011004588.1|1661402_1661765_+	DUF1304 domain-containing protein	NA	NA	NA	NA	NA
WP_011004589.1|1661803_1662493_+	glutathione S-transferase	NA	NA	NA	NA	NA
WP_080511118.1|1662608_1662797_+	peptidoglycan-binding protein	NA	NA	NA	NA	NA
WP_011004590.1|1662926_1664303_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080511119.1|1665021_1665231_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011004591.1|1665568_1666735_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011004592.1|1666767_1667037_-	MoaD/ThiS family protein	NA	NA	NA	NA	NA
WP_043876877.1|1667271_1668231_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_011004594.1|1668275_1668713_-	RidA family protein	NA	NA	NA	NA	NA
WP_043876878.1|1668754_1669795_-	4-hydroxyphenylpyruvate dioxygenase	NA	NA	NA	NA	NA
WP_011004596.1|1669898_1670393_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_011004597.1|1670839_1671175_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_011004598.1|1671167_1671650_+	SRPBCC family protein	NA	NA	NA	NA	NA
WP_011004599.1|1671757_1672375_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_011004600.1|1672440_1673061_+	LysE family translocator	NA	NA	NA	NA	NA
WP_011004601.1|1673188_1673566_-	RidA family protein	NA	NA	NA	NA	NA
WP_011004603.1|1674089_1675055_+	lipoprotein transmembrane	NA	NA	NA	NA	NA
WP_011004604.1|1675125_1675479_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011004605.1|1675874_1676795_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011004606.1|1676986_1678051_+	branched-chain amino acid aminotransferase	NA	NA	NA	NA	NA
WP_043876977.1|1678158_1679487_+	MFS transporter	NA	NA	NA	NA	NA
WP_011003443.1|1680719_1682051_-|transposase	IS701-like element ISRso17 family transposase	transposase	NA	NA	NA	NA
WP_011004581.1|1682132_1682957_-|transposase	IS5-like element ISRso1 family transposase	transposase	NA	NA	NA	NA
