The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_003116	Neisseria meningitidis Z2491, complete genome	2184406	1106194	1159018	2184406	tRNA,transposase,integrase	Acinetobacter_phage(25.0%)	56	1131217:1131232	1161497:1161512
WP_002217375.1|1106194_1106524_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_033912957.1|1106546_1106972_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002217373.1|1107198_1108140_-	YafY family transcriptional regulator	NA	NA	NA	NA	NA
WP_002244538.1|1108277_1108547_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014574071.1|1108550_1108748_+	hypothetical protein	NA	A0A192Y6A8	Salmonella_phage	66.1	1.2e-16
WP_002244540.1|1108762_1108933_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002244995.1|1108964_1111811_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	56.4	0.0e+00
WP_002226415.1|1111965_1112763_+	phosphatidylserine decarboxylase	NA	NA	NA	NA	NA
WP_002246893.1|1114190_1116467_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_002246904.1|1116891_1117482_+	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	66.3	8.5e-74
WP_002217365.1|1117546_1118605_+	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	45.7	4.3e-76
WP_002240483.1|1119414_1120416_+	replication initiation factor domain-containing protein	NA	S0F3I3	Stenotrophomonas_phage	31.8	6.8e-23
WP_002233765.1|1120460_1120751_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002215770.1|1120755_1120953_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002221100.1|1120960_1121245_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002215768.1|1121251_1121530_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002221098.1|1121657_1121975_+	DUF1132 family protein	NA	NA	NA	NA	NA
WP_002221097.1|1121916_1122357_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010980879.1|1122954_1123428_+	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_002246823.1|1123635_1125021_-	Re/Si-specific NAD(P)(+) transhydrogenase subunit beta	NA	NA	NA	NA	NA
WP_002246818.1|1125086_1125470_-	MAPEG family protein	NA	NA	NA	NA	NA
WP_002246831.1|1125473_1127015_-	Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha	NA	NA	NA	NA	NA
WP_002246839.1|1127304_1128138_+	phosphoserine phosphatase SerB	NA	NA	NA	NA	NA
WP_002246828.1|1129590_1131183_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	47.4	5.1e-65
1131217:1131232	attL	TTTCAGACGGCATTTT	NA	NA	NA	NA
WP_002251857.1|1131795_1132752_+|transposase	IS110 family transposase	transposase	Q75QL1	Wolbachia_phage	35.1	3.9e-28
WP_002221084.1|1132907_1133342_+	gp16 family protein	NA	L7P7R1	Pseudomonas_phage	40.8	6.8e-20
WP_002231473.1|1133322_1133751_+	hypothetical protein	NA	A0A0M3LRS6	Mannheimia_phage	40.4	2.1e-21
WP_002236920.1|1134058_1134604_+	N-acetylmuramoyl-L-alanine amidase	NA	U5PZX6	Acinetobacter_phage	49.2	1.5e-37
WP_002219372.1|1134600_1134807_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002215782.1|1134809_1134974_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002215783.1|1134976_1135213_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002246334.1|1135184_1135604_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002251753.1|1135500_1135806_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002215844.1|1135850_1136021_-	YegP family protein	NA	NA	NA	NA	NA
WP_002215845.1|1136033_1136252_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002222592.1|1136248_1136587_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002222591.1|1136598_1136865_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002234862.1|1136861_1137059_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002213715.1|1137061_1137568_+	DUF1804 family protein	NA	I6PBD1	Pseudomonas_phage	51.2	2.4e-40
WP_010981174.1|1137891_1138899_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_002236925.1|1139031_1140810_-	YadA-like family protein	NA	NA	NA	NA	NA
WP_002217326.1|1142679_1142850_-	rubredoxin	NA	NA	NA	NA	NA
WP_002217325.1|1143307_1144399_-	acyl-CoA/acyl-ACP dehydrogenase	NA	NA	NA	NA	NA
WP_002236926.1|1144533_1145082_-	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_002213703.1|1145236_1145608_-	DUF2628 domain-containing protein	NA	NA	NA	NA	NA
WP_002246920.1|1145902_1147594_-	D-lactate dehydrogenase	NA	NA	NA	NA	NA
WP_002246921.1|1148118_1151952_+	FAD/FMN-binding oxidoreductase	NA	NA	NA	NA	NA
WP_002246154.1|1152028_1153030_+|tRNA	tRNA-dihydrouridine synthase	tRNA	NA	NA	NA	NA
WP_002213698.1|1153079_1153262_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153314002.1|1154395_1154731_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157794828.1|1154872_1155702_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_162009328.1|1156512_1157364_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_002239049.1|1157628_1157832_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002213693.1|1157843_1158125_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002234830.1|1158162_1158366_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019273911.1|1158445_1159018_-|integrase	site-specific integrase	integrase	B7SYF8	Stenotrophomonas_phage	36.2	1.1e-09
1161497:1161512	attR	AAAATGCCGTCTGAAA	NA	NA	NA	NA
>prophage 2
NC_003116	Neisseria meningitidis Z2491, complete genome	2184406	1179978	1236260	2184406	head,plate,terminase,transposase,tail	Mannheimia_phage(26.47%)	65	NA	NA
WP_002249498.1|1179978_1180986_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_002235737.1|1181710_1182961_-	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	53.0	4.3e-99
WP_002222535.1|1183441_1185217_-	gamma-glutamyltransferase	NA	Q5GF27	Diachasmimorpha_longicaudata_entomopoxvirus	28.7	6.6e-05
WP_002213659.1|1185988_1186207_+	YdcH family protein	NA	NA	NA	NA	NA
WP_002213657.1|1186365_1187340_-	class 1 fructose-bisphosphatase	NA	A0A1V0SEY8	Hokovirus	30.3	9.5e-30
WP_002227199.1|1187585_1188431_-	23S rRNA (adenine(2030)-N(6))-methyltransferase RlmJ	NA	NA	NA	NA	NA
WP_002240500.1|1188518_1189121_-	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
WP_002213654.1|1189176_1189533_+	dihydroneopterin aldolase	NA	NA	NA	NA	NA
WP_002229426.1|1189566_1190103_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_002240501.1|1190758_1191118_-	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	45.5	9.6e-12
WP_002235741.1|1191146_1191827_-	energy-coupling factor ABC transporter permease	NA	NA	NA	NA	NA
WP_002246169.1|1191991_1195036_+	DNA translocase FtsK	NA	G1FGP1	Mycobacterium_phage	48.7	1.6e-83
WP_002246170.1|1195260_1196523_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	62.9	4.7e-138
WP_002219332.1|1196535_1197645_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	58.7	1.7e-112
WP_002246171.1|1197890_1199684_+	2-isopropylmalate synthase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	26.9	1.2e-09
WP_002222528.1|1199883_1200546_+	YecA family protein	NA	G9E3U3	Emiliania_huxleyi_virus	40.3	7.2e-05
WP_002219328.1|1200628_1201480_-	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_002219327.1|1201550_1202681_-	carboxypeptidase family protein	NA	NA	NA	NA	NA
WP_002221039.1|1202850_1203747_+	acetylglutamate kinase	NA	NA	NA	NA	NA
WP_002223806.1|1205183_1205852_-	HAD family hydrolase	NA	NA	NA	NA	NA
WP_002213636.1|1205848_1206517_-	DnaA regulatory inactivator Hda	NA	NA	NA	NA	NA
WP_162009329.1|1206621_1207200_-	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	28.8	4.6e-08
WP_072104465.1|1207421_1207634_-	helix-turn-helix transcriptional regulator	NA	X4YTE2	Pseudomonas_phage	42.0	6.7e-05
WP_002246172.1|1207796_1208678_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_002232388.1|1208725_1208977_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_002246173.1|1208978_1210952_+|transposase	Mu transposase C-terminal domain-containing protein	transposase	A0A0M3LPN5	Mannheimia_phage	41.9	3.2e-117
WP_002246174.1|1211166_1212081_+	AAA family ATPase	NA	A0A2D1GNS0	Pseudomonas_phage	41.8	1.0e-57
WP_002246175.1|1212170_1212437_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002246176.1|1212545_1212701_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002246178.1|1212899_1213067_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002213625.1|1213176_1213695_+	host-nuclease inhibitor Gam family protein	NA	F6MIJ0	Haemophilus_phage	48.8	4.1e-32
WP_002213624.1|1213854_1214070_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002213623.1|1214073_1214682_-	antA/AntB antirepressor family protein	NA	A0A0P0ZAZ7	Stx2-converting_phage	49.2	4.9e-24
WP_002213622.1|1214813_1215014_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002213621.1|1215214_1215400_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002213620.1|1215672_1215840_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002213617.1|1216362_1216554_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002213616.1|1216550_1216967_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002221084.1|1217141_1217576_+	gp16 family protein	NA	L7P7R1	Pseudomonas_phage	40.8	6.8e-20
WP_002231473.1|1217556_1217985_+	hypothetical protein	NA	A0A0M3LRS6	Mannheimia_phage	40.4	2.1e-21
WP_002236920.1|1218292_1218838_+	N-acetylmuramoyl-L-alanine amidase	NA	U5PZX6	Acinetobacter_phage	49.2	1.5e-37
WP_002219372.1|1218834_1219041_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002215782.1|1219043_1219208_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002215783.1|1219210_1219447_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002215784.1|1219418_1219838_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002246181.1|1219734_1220052_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002213614.1|1220388_1220655_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002213613.1|1220651_1220849_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002213612.1|1220850_1221357_+	DUF1804 family protein	NA	I6PBD1	Pseudomonas_phage	51.5	5.3e-40
WP_002246933.1|1221377_1223000_+|terminase	phage terminase large subunit	terminase	B7SDN0	Haemophilus_phage	69.3	2.1e-223
WP_002232418.1|1222999_1224568_+	DUF935 domain-containing protein	NA	A0A0M3LRU4	Mannheimia_phage	61.4	8.0e-188
WP_002246937.1|1224554_1225850_+|head	phage head morphogenesis protein	head	B7SDN5	Haemophilus_phage	49.5	9.8e-115
WP_002213608.1|1225959_1226376_+	phage virion morphogenesis protein	NA	B7SDN8	Haemophilus_phage	48.2	2.4e-30
WP_002233863.1|1227768_1228239_+	hypothetical protein	NA	A0A0M3LQ21	Mannheimia_phage	43.2	1.9e-20
WP_002246939.1|1228228_1229374_+	hypothetical protein	NA	F6MIL3	Haemophilus_phage	57.6	3.0e-115
WP_002217230.1|1229370_1230039_+|plate	phage baseplate assembly protein V	plate	A0A0M3LPA3	Mannheimia_phage	52.1	1.8e-59
WP_002217228.1|1230138_1230486_+	phage GP46 family protein	NA	A0A0M3LQK5	Mannheimia_phage	61.2	9.5e-33
WP_002246931.1|1230499_1231555_+|plate	baseplate J/gp47 family protein	plate	A0A0M3LQN4	Mannheimia_phage	56.4	5.0e-101
WP_002234869.1|1231551_1232112_+	YmfQ family protein	NA	A0A0M3LQE1	Mannheimia_phage	39.2	3.1e-25
WP_002246932.1|1232122_1234096_+|tail	tail fiber protein	tail	Q94MY0	Haemophilus_virus	57.4	6.9e-136
WP_002213586.1|1234532_1234835_-	BrnA antitoxin family protein	NA	A0A2H4J5Y5	uncultured_Caudovirales_phage	38.8	1.1e-05
WP_002217222.1|1234806_1235094_-	BrnT family toxin	NA	NA	NA	NA	NA
WP_002223791.1|1235173_1235779_+	hypothetical protein	NA	D0UIH2	Aggregatibacter_phage	41.8	9.2e-15
WP_002221017.1|1235757_1236054_+	hypothetical protein	NA	A0A0M3LNN9	Mannheimia_phage	61.4	1.8e-24
WP_002222487.1|1236050_1236260_+	hypothetical protein	NA	A0A0R6PHB4	Moraxella_phage	48.2	3.1e-07
>prophage 3
NC_003116	Neisseria meningitidis Z2491, complete genome	2184406	1391604	1400781	2184406		Burkholderia_phage(28.57%)	9	NA	NA
WP_002232563.1|1391604_1392447_+	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	42.0	1.6e-46
WP_002237048.1|1392461_1392902_+	DUF4149 domain-containing protein	NA	NA	NA	NA	NA
WP_002219188.1|1392949_1394236_+	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	62.1	7.4e-147
WP_002213385.1|1394249_1394528_+	cell division protein FtsB	NA	NA	NA	NA	NA
WP_002217077.1|1394568_1394859_-	2Fe-2S ferredoxin-like protein	NA	G9IAA2	Pseudomonas_phage	54.5	7.5e-15
WP_002237049.1|1395056_1396190_-	ribonucleotide-diphosphate reductase subunit beta	NA	W6AT53	Erwinia_phage	74.8	1.8e-165
WP_002246001.1|1396250_1397438_-	type II restriction endonuclease	NA	E5E3X4	Burkholderia_phage	38.9	6.6e-33
WP_002222381.1|1397430_1398444_-	DNA (cytosine-5-)-methyltransferase	NA	E5E3X6	Burkholderia_phage	52.8	8.0e-88
WP_002237050.1|1398501_1400781_-	ribonucleoside-diphosphate reductase subunit alpha	NA	I3UMG3	Colwellia_phage	67.8	9.2e-310
>prophage 4
NC_003116	Neisseria meningitidis Z2491, complete genome	2184406	1722396	1807515	2184406	tRNA,head,plate,capsid,terminase,integrase,transposase,protease,tail	Haemophilus_phage(20.0%)	100	1752468:1752517	1812510:1812559
WP_002218983.1|1722396_1723449_-|protease	protease SohB	protease	NA	NA	NA	NA
WP_002218982.1|1724295_1724859_-	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_002212800.1|1725669_1726005_-	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_002212798.1|1726133_1727039_+	efflux transporter MtrCDE transcriptional activator MtrA	NA	NA	NA	NA	NA
WP_002235070.1|1727100_1727589_-	lipoprotein	NA	NA	NA	NA	NA
WP_002229732.1|1727735_1728638_+	DMT family transporter	NA	NA	NA	NA	NA
WP_002229733.1|1728678_1729809_-	polyamine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002246319.1|1730013_1732638_+|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	37.0	2.1e-79
WP_002212793.1|1732699_1733431_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002231890.1|1734139_1736551_+	class I SAM-dependent DNA methyltransferase	NA	Q6NE04	Leptospira_phage	41.8	1.4e-162
WP_002223582.1|1737619_1738834_+	replication initiation factor domain-containing protein	NA	B1NI77	Stenotrophomonas_phage	33.8	3.6e-26
WP_002218477.1|1738845_1739157_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002218476.1|1739160_1739361_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002223585.1|1739598_1739829_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002223586.1|1739856_1740159_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042507217.1|1740505_1742110_+	T cell/B cell stimulating protein TspB	NA	NA	NA	NA	NA
WP_002216892.1|1742412_1742697_+	DUF2523 domain-containing protein	NA	NA	NA	NA	NA
WP_002212523.1|1742697_1743885_+	DUF2075 domain-containing protein	NA	A0A077JGB2	Xanthomonas_phage	26.6	2.7e-18
WP_002212521.1|1744099_1745056_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_002229738.1|1745394_1746078_-	2,3-diphosphoglycerate-dependent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_033909512.1|1746373_1748677_+	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	37.4	7.6e-86
WP_002235078.1|1748696_1750214_+	two-component sensor histidine kinase	NA	NA	NA	NA	NA
WP_002212784.1|1750265_1750733_+	response regulator	NA	NA	NA	NA	NA
WP_002246323.1|1750836_1751589_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
1752468:1752517	attL	AGTACGGCAAGGCGAGGCAACGCCGTACTGGTTTTTGTTAATCCACTATA	NA	NA	NA	NA
WP_002212781.1|1752622_1752829_-	DUF2788 domain-containing protein	NA	NA	NA	NA	NA
WP_002235079.1|1752923_1754093_-	O-succinylhomoserine sulfhydrylase	NA	A0A2K9L4S9	Tupanvirus	23.6	3.3e-05
WP_002234139.1|1754390_1755152_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002234140.1|1755251_1755503_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002229746.1|1755554_1756361_+	basic amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002253488.1|1756667_1758191_+	fumarate hydratase	NA	NA	NA	NA	NA
WP_002212772.1|1758288_1759701_+	Trk system potassium transporter TrkA	NA	NA	NA	NA	NA
WP_002246245.1|1760004_1760970_+|transposase	IS30-like element IS1655 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.5	1.0e-36
WP_009348827.1|1762225_1762423_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002235080.1|1762483_1763290_+	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_033909369.1|1763339_1764209_-	SAM-dependent methyltransferase TehB	NA	NA	NA	NA	NA
WP_002212768.1|1764322_1764760_+	ribonuclease HI	NA	J9Q745	Salmonella_phage	55.0	1.0e-39
WP_002212765.1|1766061_1766466_+	HIT domain-containing protein	NA	NA	NA	NA	NA
WP_002247021.1|1766505_1767690_+	LD-carboxypeptidase	NA	NA	NA	NA	NA
WP_002218952.1|1767752_1768286_-	glutathione peroxidase	NA	NA	NA	NA	NA
WP_002212760.1|1768545_1769385_-	DNA adenine methylase	NA	A0A0R6PH56	Moraxella_phage	50.0	6.2e-78
WP_002212759.1|1769732_1770221_-	hypothetical protein	NA	A0A0R6PGL8	Moraxella_phage	47.7	6.7e-24
WP_002212758.1|1770221_1770845_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002247024.1|1770841_1773124_-|tail	tail fiber domain-containing protein	tail	U5PSK6	Bacillus_phage	35.3	9.4e-20
WP_002212756.1|1773126_1773693_-	YmfQ family protein	NA	A0A0M3LQE1	Mannheimia_phage	36.3	8.0e-21
WP_002212755.1|1773689_1774265_-|plate	baseplate J/gp47 family protein	plate	F6MIL6	Haemophilus_phage	42.0	3.4e-35
WP_002212754.1|1774267_1774753_-|plate	baseplate J/gp47 family protein	plate	F6MIL6	Haemophilus_phage	41.4	6.8e-21
WP_002212752.1|1774749_1775103_-	phage GP46 family protein	NA	A0A2H4JDR8	uncultured_Caudovirales_phage	53.0	3.7e-24
WP_002237234.1|1775163_1775793_-|plate	phage baseplate assembly protein V	plate	A0A0M3LPA3	Mannheimia_phage	47.2	2.3e-32
WP_002237235.1|1775793_1776933_-	hypothetical protein	NA	A0A2H4J9E6	uncultured_Caudovirales_phage	44.0	1.6e-81
WP_002237236.1|1776916_1778284_-	DNA circularization protein	NA	F6MIL2	Haemophilus_phage	28.9	6.2e-43
WP_002212743.1|1780329_1780578_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002212742.1|1780535_1780925_-	hypothetical protein	NA	NA	NA	NA	NA
WP_125939526.1|1781053_1781233_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002237241.1|1781414_1781879_-	ImmA/IrrE family metallo-endopeptidase	NA	L7THB5	Pseudomonas_virus	39.1	2.0e-22
WP_002212738.1|1781865_1782252_-	helix-turn-helix transcriptional regulator	NA	L7TKV7	Pseudomonas_virus	54.3	2.8e-25
WP_002212737.1|1782427_1782802_-	hypothetical protein	NA	F6MIK8	Haemophilus_phage	45.2	1.9e-23
WP_002212736.1|1782815_1784243_-|tail	tail sheath protein	tail	B7SDP8	Haemophilus_phage	42.0	3.1e-85
WP_002212735.1|1784242_1784431_-	DUF2635 domain-containing protein	NA	NA	NA	NA	NA
WP_002212734.1|1784427_1785096_-	DUF1834 family protein	NA	NA	NA	NA	NA
WP_002212733.1|1785079_1785505_-	DUF1320 family protein	NA	A0A0C4UR02	Shigella_phage	41.7	2.9e-15
WP_002212732.1|1785501_1785975_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002212731.1|1786012_1786915_-|head	Mu-like prophage major head subunit gpT family protein	head	A0SMP3	Pseudomonas_virus	64.8	5.0e-110
WP_010981241.1|1786936_1788001_-	transcriptional regulator	NA	A0A0M5N0Q6	Ralstonia_phage	34.3	8.0e-30
WP_002212728.1|1788209_1788707_-	phage virion morphogenesis protein	NA	A0A0M3LSP9	Mannheimia_phage	37.3	2.4e-13
WP_002237243.1|1788810_1790157_-|capsid	minor capsid protein	capsid	B7SDN5	Haemophilus_phage	31.6	1.7e-40
WP_002212726.1|1790149_1791709_-	DUF935 domain-containing protein	NA	A0A0M3LRU4	Mannheimia_phage	47.8	3.1e-131
WP_002237245.1|1791787_1793407_-|terminase	phage terminase large subunit	terminase	B7SDN0	Haemophilus_phage	70.5	1.7e-220
WP_002212724.1|1793418_1793613_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002237246.1|1793609_1794116_-	DUF1804 family protein	NA	A0A0A1IX73	Pseudomonas_phage	56.2	7.1e-45
WP_002212722.1|1794118_1794334_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002212721.1|1794333_1794615_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002237247.1|1794611_1794953_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002215845.1|1794949_1795168_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002215844.1|1795180_1795351_+	YegP family protein	NA	NA	NA	NA	NA
WP_002247134.1|1795395_1795701_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002215784.1|1795597_1796017_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002215783.1|1795988_1796225_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002215782.1|1796227_1796392_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002219372.1|1796394_1796601_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002250303.1|1796597_1797143_-	N-acetylmuramoyl-L-alanine amidase	NA	U5PZX6	Acinetobacter_phage	50.3	4.8e-39
WP_173024110.1|1797274_1797916_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002237250.1|1797963_1798410_-	membrane protein	NA	A0A2D1GNW5	Pseudomonas_phage	29.2	7.2e-09
WP_002212717.1|1798406_1798841_-	DUF1018 domain-containing protein	NA	L7P7R1	Pseudomonas_phage	43.3	5.2e-20
WP_157851217.1|1798916_1799225_-	HU family DNA-binding protein	NA	A3E2K9	Sodalis_phage	51.7	2.9e-17
WP_002212715.1|1799240_1799441_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002212714.1|1799441_1800092_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002212713.1|1800097_1800709_-	DUF3164 family protein	NA	A0A0M3LQ92	Mannheimia_phage	54.4	6.3e-56
WP_010981244.1|1800701_1800896_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002212711.1|1800867_1801323_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010981245.1|1801306_1801684_-	hypothetical protein	NA	A0A2H4JFV8	uncultured_Caudovirales_phage	41.9	6.7e-16
WP_002237252.1|1801802_1802117_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010981246.1|1802113_1802329_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002212708.1|1802309_1802474_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002212707.1|1802489_1802642_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002212706.1|1802644_1802944_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002212705.1|1802933_1803176_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002212704.1|1803251_1804166_-	AAA family ATPase	NA	A0A2D1GNS0	Pseudomonas_phage	44.5	2.0e-53
WP_002237254.1|1804207_1806253_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	F6MII5	Haemophilus_phage	40.0	6.5e-113
WP_002212702.1|1806330_1806594_-	transcriptional regulator	NA	A0A2P9JZG5	Alteromonadaceae_phage	58.4	4.2e-17
WP_002212701.1|1806810_1807515_+	helix-turn-helix transcriptional regulator	NA	A0A0A1IWY4	Pseudomonas_phage	33.2	6.9e-22
1812510:1812559	attR	TATAGTGGATTAACAAAAACCAGTACGGCGTTGCCTCGCCTTGCCGTACT	NA	NA	NA	NA
