The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_002755	Mycobacterium tuberculosis CDC1551, complete sequence	4403837	2937332	2975604	4403837	terminase,tRNA,protease,capsid,head,integrase	Mycobacterium_phage(33.33%)	46	2966133:2966160	2975757:2975784
WP_003413486.1|2937332_2939411_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L6B6	Tupanvirus	34.9	2.5e-104
WP_003413487.1|2939519_2939747_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009938541.1|2939743_2941129_-	PE family protein	NA	NA	NA	NA	NA
WP_003917661.1|2941473_2941974_+	DUF1990 family protein	NA	NA	NA	NA	NA
WP_003413574.1|2941990_2942431_-	DoxX family membrane protein	NA	NA	NA	NA	NA
WP_003899397.1|2942526_2943255_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_003413583.1|2943239_2943593_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_003413586.1|2943605_2944031_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003413588.1|2944027_2944702_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_003413589.1|2944779_2945601_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_003413592.1|2945736_2946630_+	universal stress protein TB31.7	NA	NA	NA	NA	NA
WP_003413594.1|2946632_2947451_-	universal stress protein	NA	NA	NA	NA	NA
WP_003899401.1|2947465_2948647_-|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_003413598.1|2948705_2949137_-	hypoxic response protein Hrp1	NA	A0A2I6B2H4	Macacine_betaherpesvirus	100.0	1.9e-75
WP_003899402.1|2949650_2950892_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_085976157.1|2951306_2951564_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003413610.1|2951910_2953035_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003413614.1|2953036_2953576_+	archease	NA	NA	NA	NA	NA
WP_003413619.1|2955052_2955334_-	DUF1876 domain-containing protein	NA	NA	NA	NA	NA
WP_003413625.1|2955478_2955964_-	non-heme di-iron catalase	NA	NA	NA	NA	NA
WP_003908019.1|2955990_2956245_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042507591.1|2956248_2958585_-	PE family protein	NA	NA	NA	NA	NA
WP_003899405.1|2958613_2958856_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003899406.1|2958856_2959534_+	chloramphenicol phosphotransferase CPT family protein	NA	NA	NA	NA	NA
WP_003413654.1|2959729_2960386_+	DedA family protein	NA	NA	NA	NA	NA
WP_003413657.1|2960548_2960995_+	anti-sigma factor antagonist	NA	NA	NA	NA	NA
WP_003413663.1|2961169_2961502_-	YnfA family protein	NA	NA	NA	NA	NA
WP_003413665.1|2961621_2961981_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003413675.1|2962082_2962541_+	glyoxalase/bleomycin resistance/dioxygenase family protein	NA	NA	NA	NA	NA
WP_003899407.1|2962676_2963057_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003413686.1|2963053_2964550_+	ACR3 family arsenite efflux transporter	NA	A0A2H4PQT9	Staphylococcus_phage	39.7	5.1e-14
WP_003912823.1|2964784_2964976_+	antitoxin MazE family protein	NA	NA	NA	NA	NA
2966133:2966160	attL	ACTGGTTCAATCCCAGTATCGCGCACCA	NA	NA	NA	NA
WP_003899409.1|2966266_2966698_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003900538.1|2966694_2967693_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2D1G8E2	Mycobacterium_phage	47.8	7.4e-62
WP_003900539.1|2967706_2968171_+	ParB N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_003908028.1|2968158_2968410_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003899411.1|2968580_2970020_-|capsid	phage major capsid protein	capsid	A0A1B3AYS4	Gordonia_phage	40.6	1.4e-66
WP_003899412.1|2970027_2970561_-|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	32.9	3.1e-06
WP_003900541.1|2970713_2971205_-|terminase	phage terminase small subunit P27 family	terminase	V9H0V4	Actinophage	47.2	9.4e-18
WP_003899414.1|2971371_2971695_-	type II toxin-antitoxin system toxin	NA	NA	NA	NA	NA
WP_003899415.1|2971774_2972020_-	type II toxin-antitoxin system antitoxin	NA	NA	NA	NA	NA
WP_003899416.1|2972016_2973444_-	DUF3631 domain-containing protein	NA	NA	NA	NA	NA
WP_003899417.1|2973445_2973838_-	DUF2742 domain-containing protein	NA	NA	NA	NA	NA
WP_003899418.1|2973834_2974095_-	helix-turn-helix domain-containing protein	NA	A0A2P1CHK7	Mycobacterium_phage	64.6	3.0e-15
WP_003900543.1|2974111_2974474_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003899420.1|2974476_2975604_-|integrase	site-specific integrase	integrase	A0A1X9SFC1	Mycobacterium_phage	40.4	1.5e-66
2975757:2975784	attR	ACTGGTTCAATCCCAGTATCGCGCACCA	NA	NA	NA	NA
