The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_000915	Helicobacter pylori 26695, complete sequence	1667867	1018459	1070383	1667867	transposase,tRNA,integrase	Helicobacter_phage(50.0%)	43	1028966:1028985	1080307:1080326
WP_001150920.1|1018459_1019371_-|tRNA	glycine--tRNA ligase subunit alpha	tRNA	NA	NA	NA	NA
WP_000401714.1|1019384_1020323_-	NAD(P)H-dependent glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_029671444.1|1020454_1020667_-	acyl carrier protein	NA	E3SSM9	Prochlorococcus_phage	55.2	7.9e-06
WP_001862974.1|1020908_1022252_-	dynamin-like GTPase family protein	NA	NA	NA	NA	NA
WP_000244300.1|1024577_1026224_-	GTPase	NA	NA	NA	NA	NA
WP_000271456.1|1026447_1026735_-	endoribonuclease VapD	NA	NA	NA	NA	NA
WP_015056073.1|1027101_1030161_-	CusA/CzcA family heavy metal efflux RND transporter	NA	S5VTK5	Leptospira_phage	25.7	2.8e-83
1028966:1028985	attL	ATGAGCATGCCTATAGCGAT	NA	NA	NA	NA
WP_000816822.1|1030160_1031240_-	sodium:proton antiporter	NA	NA	NA	NA	NA
WP_001212364.1|1031236_1032538_-	TolC family protein	NA	NA	NA	NA	NA
WP_000555186.1|1032527_1034633_-|tRNA	glycine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_000682021.1|1034744_1035806_+	hypothetical protein	NA	A0A2D1GN01	Pseudoalteromonas_phage	30.1	2.0e-09
WP_000057737.1|1035818_1037294_+	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_001165207.1|1037308_1037590_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC	tRNA	NA	NA	NA	NA
WP_001010809.1|1037709_1039020_-	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	NA	NA	NA	NA
WP_000574070.1|1039148_1040612_+	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_161595581.1|1040612_1042106_+	cell division protein FtsA	NA	NA	NA	NA	NA
WP_000233600.1|1042236_1043394_+	cell division protein FtsZ	NA	NA	NA	NA	NA
WP_001863015.1|1044551_1044854_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049794234.1|1044864_1045137_+	exonuclease VII large subunit	NA	NA	NA	NA	NA
WP_001101624.1|1045595_1046204_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001169565.1|1046204_1046495_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000343415.1|1047053_1047878_+	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_000517562.1|1048164_1048380_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000923190.1|1048530_1048674_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010875575.1|1048713_1049427_-	DUF1887 family protein	NA	NA	NA	NA	NA
WP_164930552.1|1049509_1049722_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000886948.1|1050811_1051045_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162481329.1|1051051_1051498_-|transposase	IS200/IS605 family transposase	transposase	A0A1S5RG71	Helicobacter_phage	97.9	1.2e-75
WP_000930564.1|1051549_1052833_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A1S5REX3	Helicobacter_phage	85.2	1.2e-200
WP_080012132.1|1052881_1053595_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010875576.1|1053599_1054229_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000006537.1|1054814_1055066_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000009111.1|1055037_1055841_+	nucleotidyl transferase AbiEii/AbiGii toxin family protein	NA	NA	NA	NA	NA
WP_001120382.1|1056157_1057225_-|integrase	tyrosine-type recombinase/integrase	integrase	S5W9T9	Leptospira_phage	26.7	1.7e-08
WP_000905829.1|1058372_1060199_-	relaxase/mobilization nuclease domain-containing protein	NA	NA	NA	NA	NA
WP_000930565.1|1060323_1061607_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A1S5REX3	Helicobacter_phage	85.0	2.6e-200
WP_162481329.1|1061658_1062105_+|transposase	IS200/IS605 family transposase	transposase	A0A1S5RG71	Helicobacter_phage	97.9	1.2e-75
WP_000587397.1|1062686_1063343_+	ParA family protein	NA	A2I303	Vibrio_virus	23.4	7.1e-05
WP_000394638.1|1063427_1063712_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000665511.1|1063755_1064940_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000065304.1|1067155_1067470_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025444691.1|1068020_1068545_-	type IV secretory system conjugative DNA transfer family protein	NA	NA	NA	NA	NA
WP_001862466.1|1069966_1070383_+|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	96.4	4.6e-74
1080307:1080326	attR	ATCGCTATAGGCATGCTCAT	NA	NA	NA	NA
