The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_006833	Wolbachia endosymbiont strain TRS of Brugia malayi, complete sequence	1080084	287110	299892	1080084	tRNA	Cyanophage(25.0%)	11	NA	NA
WP_041571405.1|287110_288853_-	type I secretion system permease/ATPase	NA	W8CYL7	Bacillus_phage	22.4	2.2e-24
WP_011256418.1|289040_290048_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	40.5	1.2e-62
WP_011256420.1|291216_291579_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011256421.1|291755_292364_+	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	38.7	1.2e-33
WP_041571407.1|292365_293637_+	insulinase family protein	NA	A0A2K9L1M6	Tupanvirus	26.7	4.1e-41
WP_011256423.1|294344_294779_+	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	48.2	1.9e-14
WP_011256424.1|294803_296624_+	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	A7J689	Paramecium_bursaria_Chlorella_virus	37.6	2.3e-93
WP_158676336.1|297348_297711_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011256426.1|297707_298001_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041571547.1|298134_299169_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A1D7SE90	Cyanophage	41.2	5.1e-58
WP_011256428.1|299169_299892_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A1D7SPE1	Cyanophage	40.3	1.9e-38
>prophage 2
NC_006833	Wolbachia endosymbiont strain TRS of Brugia malayi, complete sequence	1080084	943957	1011533	1080084	protease,integrase,tRNA	Erwinia_phage(10.0%)	48	950753:950773	1013102:1013122
WP_041571505.1|943957_944512_+|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_011256920.1|944513_946004_+|protease	ATP-dependent protease ATPase subunit HslU	protease	A0A2H5BJT2	Erwinia_phage	30.8	4.2e-37
WP_011256922.1|948159_950709_+	DNA polymerase I	NA	A0A142F1Q9	Bacillus_phage	37.4	1.4e-56
950753:950773	attL	AAATGCAAAAATTACTTGACA	NA	NA	NA	NA
WP_160119453.1|951325_952390_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011256924.1|952384_953812_-|protease	metalloprotease TldD	protease	NA	NA	NA	NA
WP_050707679.1|955268_955484_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050707680.1|955495_955753_-	cation:dicarboxylase symporter family transporter	NA	NA	NA	NA	NA
WP_011256925.1|956641_957349_+	uroporphyrinogen-III synthase	NA	NA	NA	NA	NA
WP_011256926.1|957348_958131_+	exodeoxyribonuclease III	NA	M1PSC0	Streptococcus_phage	23.5	6.3e-08
WP_041571506.1|958743_959817_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_011256928.1|959939_960575_+	chromosomal DNA replication initiator DnaA	NA	NA	NA	NA	NA
WP_011256929.1|960946_961933_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0K2CP59	Brevibacillus_phage	28.3	6.2e-29
WP_041571507.1|961997_962711_+	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_011256931.1|962774_963044_+	30S ribosomal protein S20	NA	NA	NA	NA	NA
WP_011256932.1|963109_964360_+	citrate synthase	NA	NA	NA	NA	NA
WP_011256933.1|965179_966118_-	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_011256934.1|966110_967028_-	polyprenyl synthetase family protein	NA	NA	NA	NA	NA
WP_011256935.1|967178_967445_+	acyl carrier protein	NA	NA	NA	NA	NA
WP_011256936.1|967451_968720_+	beta-ketoacyl-ACP synthase II	NA	NA	NA	NA	NA
WP_011256937.1|968817_970095_+	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_011256938.1|970104_970974_+	FAD-dependent thymidylate synthase	NA	M4QT16	Loktanella_phage	50.3	3.9e-75
WP_011256939.1|971040_973131_-	collagenase	NA	NA	NA	NA	NA
WP_011256941.1|974464_974749_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158676309.1|975642_975807_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041571508.1|975991_978370_+	primosomal protein N'	NA	NA	NA	NA	NA
WP_179943615.1|978933_979533_+	recombination protein RecR	NA	NA	NA	NA	NA
WP_158676310.1|980831_980996_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011256944.1|981612_982884_-	pyruvate dehydrogenase complex dihydrolipoamide acetyltransferase	NA	NA	NA	NA	NA
WP_011256946.1|983876_986672_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011256947.1|986652_989007_-	type VI secretion protein	NA	NA	NA	NA	NA
WP_011256948.1|989037_989415_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011256949.1|989525_990761_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011256950.1|990872_991913_-	nitronate monooxygenase	NA	NA	NA	NA	NA
WP_041571509.1|991918_992440_-	cytochrome b	NA	NA	NA	NA	NA
WP_041571510.1|994434_995346_-	signal recognition particle-docking protein FtsY	NA	D6PHS7	uncultured_phage	36.4	1.1e-14
WP_011256953.1|995524_995917_+	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	79.0	7.2e-53
WP_011256954.1|995923_996328_+	iron-sulfur cluster assembly accessory protein	NA	A0A0P0CQC4	Ostreococcus_lucimarinus_virus	33.9	4.0e-14
WP_011256955.1|996320_996776_+	molecular chaperone Hsc20	NA	NA	NA	NA	NA
WP_011256956.1|996753_998511_+	Fe-S protein assembly chaperone HscA	NA	F2Y2E1	Organic_Lake_phycodnavirus	36.2	4.3e-89
WP_050707681.1|998513_999260_-	signal peptidase I	NA	NA	NA	NA	NA
WP_011256959.1|999706_1000636_+	AEC family transporter	NA	NA	NA	NA	NA
WP_041571512.1|1000700_1002170_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA	tRNA	NA	NA	NA	NA
WP_011256961.1|1002820_1005199_-	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	34.5	7.8e-110
WP_041571513.1|1006317_1006914_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011256963.1|1006998_1007334_-	divalent-cation tolerance protein CutA	NA	NA	NA	NA	NA
WP_011256964.1|1007540_1009166_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011256965.1|1009620_1010658_+|protease	FtsH protease activity modulator HflK	protease	NA	NA	NA	NA
WP_011256966.1|1010660_1011533_+|protease	protease modulator HflC	protease	NA	NA	NA	NA
1013102:1013122	attR	AAATGCAAAAATTACTTGACA	NA	NA	NA	NA
