The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_005810	Yersinia pestis biovar Microtus str. 91001, complete sequence	4595065	80242	131041	4595065	transposase,tRNA,protease	Bacillus_phage(30.0%)	44	NA	NA
WP_002208973.1|80242_80731_-|tRNA	tRNA (uridine(34)/cytosine(34)/5- carboxymethylaminomethyluridine(34)-2'-O)- methyltransferase TrmL	tRNA	NA	NA	NA	NA
WP_002208972.1|80919_81984_+	bifunctional DNA-binding transcriptional regulator/O6-methylguanine-DNA methyltransferase Ada	NA	NA	NA	NA	NA
WP_002208971.1|82032_83409_-	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	25.4	1.5e-17
WP_002208970.1|83405_84104_-	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	29.5	1.8e-06
WP_002208969.1|84277_84766_+	cell-envelope stress modulator CpxP	NA	NA	NA	NA	NA
WP_002353252.1|85482_86403_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	54.3	8.6e-73
WP_002208967.1|86964_87867_+	CDF family cation-efflux transporter FieF	NA	NA	NA	NA	NA
WP_002208966.1|88084_89068_+	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_002208965.1|89288_90278_+	sulfate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002218867.1|90527_91304_-	molybdate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002208963.1|91421_92849_-	anion permease	NA	NA	NA	NA	NA
WP_001297096.1|93208_93988_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_000255944.1|93987_95010_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_002208961.1|95583_96321_-	PIG-L family deacetylase	NA	NA	NA	NA	NA
WP_002208960.1|96457_97693_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002208959.1|97924_98692_-	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_002208958.1|98820_99435_-	DUF1454 family protein	NA	NA	NA	NA	NA
WP_002208957.1|99603_100038_+	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_011171744.1|100378_101125_-	ferredoxin--NADP(+) reductase	NA	NA	NA	NA	NA
WP_002223912.1|101279_102290_-	class II fructose-bisphosphatase	NA	NA	NA	NA	NA
WP_002218876.1|102526_104050_-	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_002208954.1|104226_105075_-	aquaporin family protein	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	27.5	3.2e-13
WP_002208953.1|105686_105926_+	septal ring assembly protein ZapB	NA	NA	NA	NA	NA
WP_002213759.1|106133_106592_-|transposase	IS200/IS605-like element IS1541A family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	8.5e-13
WP_002230357.1|106983_109098_-	peptidase domain-containing ABC transporter	NA	W8CYL7	Bacillus_phage	26.5	2.8e-34
WP_002208949.1|109090_110383_-	HlyD family secretion protein	NA	NA	NA	NA	NA
WP_002215873.1|110595_110835_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002228141.1|111464_112049_+	DUF4232 domain-containing protein	NA	NA	NA	NA	NA
WP_002208945.1|112165_112651_-	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_002208944.1|112792_113710_-	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_002208943.1|113945_115277_-	HslU--HslV peptidase ATPase subunit	NA	A0A191ZC11	Erwinia_phage	29.8	1.2e-43
WP_002208942.1|115347_115872_-|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_002208941.1|115971_116817_-	cell division protein FtsN	NA	NA	NA	NA	NA
WP_002216730.1|116882_117911_-	DNA-binding transcriptional regulator CytR	NA	NA	NA	NA	NA
WP_002208938.1|118263_120462_-	primosomal protein N'	NA	NA	NA	NA	NA
WP_002216737.1|120714_120930_+	50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_002208936.1|121472_121928_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002208935.1|122276_122594_-	met regulon transcriptional regulator MetJ	NA	NA	NA	NA	NA
WP_002221173.1|122971_124132_+	cystathionine gamma-synthase	NA	NA	NA	NA	NA
WP_002208934.1|124134_126570_+	bifunctional aspartate kinase/homoserine dehydrogenase II	NA	NA	NA	NA	NA
WP_002208933.1|126802_127687_+	methylenetetrahydrofolate reductase	NA	NA	NA	NA	NA
WP_100067904.1|127864_129219_-|transposase	IS3-like element IS1661 family transposase	transposase	A0A1B1P773	Bacillus_phage	44.7	1.1e-55
WP_002208930.1|129411_130170_-	DeoR/GlpR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002216348.1|130204_131041_-|protease	rhomboid family intramembrane serine protease GlpG	protease	NA	NA	NA	NA
>prophage 2
NC_005810	Yersinia pestis biovar Microtus str. 91001, complete sequence	4595065	570190	632856	4595065	transposase,protease,tRNA	Bacillus_phage(18.75%)	60	NA	NA
WP_002209154.1|570190_571450_+|protease	FtsH protease activity modulator HflK	protease	NA	NA	NA	NA
WP_002209155.1|571453_572458_+|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_002217227.1|572629_572830_+	DUF2065 domain-containing protein	NA	NA	NA	NA	NA
WP_002209157.1|572929_574228_+	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	35.4	1.3e-66
WP_002217229.1|574596_575022_+	nitric oxide-sensing transcriptional repressor NsrR	NA	NA	NA	NA	NA
WP_002209159.1|575262_577797_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	33.3	2.5e-66
WP_002209161.1|577915_578656_+	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_032484797.1|579075_580707_+	isovaleryl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_002215294.1|580778_581090_-	biofilm peroxide resistance protein BsmA	NA	NA	NA	NA	NA
WP_002230471.1|581280_582030_+	esterase	NA	NA	NA	NA	NA
WP_002210153.1|582396_582789_+	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_002210154.1|582794_583115_+	primosomal replication protein N	NA	NA	NA	NA	NA
WP_002210155.1|583119_583347_+	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_002210156.1|583386_583839_+	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_000255944.1|584142_585165_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_001297096.1|585164_585944_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_029562500.1|586044_586452_+|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	32.5	1.1e-08
WP_002210157.1|586573_587029_-	DUF3757 domain-containing protein	NA	NA	NA	NA	NA
WP_002210158.1|587168_587909_-	peptidoglycan-binding protein LysM	NA	NA	NA	NA	NA
WP_002228198.1|588251_588872_+	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_002210159.1|588969_589635_-	iron-sulfur cluster repair protein YtfE	NA	NA	NA	NA	NA
WP_002210160.1|589789_591760_-	bifunctional 2',3'-cyclic-nucleotide 2'-phosphodiesterase/3'-nucleotidase	NA	NA	NA	NA	NA
WP_002220539.1|592194_592935_+	3'(2'),5'-bisphosphate nucleotidase CysQ	NA	NA	NA	NA	NA
WP_002210162.1|592937_593501_-	YtfJ family protein	NA	NA	NA	NA	NA
WP_002210163.1|593835_594048_+	DUF1107 domain-containing protein	NA	NA	NA	NA	NA
WP_002210164.1|594155_595487_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_002210165.1|595764_596403_-	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_002210166.1|596677_598414_+	outer membrane protein assembly factor	NA	NA	NA	NA	NA
WP_002210167.1|598410_602328_+	translocation/assembly module TamB domain-containing protein	NA	NA	NA	NA	NA
WP_002210168.1|602330_602687_+	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
WP_002210169.1|602804_603332_-	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	62.7	9.3e-56
WP_002216946.1|603531_604545_-	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	45.8	3.0e-71
WP_002210171.1|604715_606098_+	UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl- meso-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_002210172.1|606393_606657_-	peroxide/acid stress response protein YhcN	NA	NA	NA	NA	NA
WP_002210173.1|607045_607516_-	transcriptional regulator ArgR	NA	NA	NA	NA	NA
WP_002210174.1|607979_608918_+	malate dehydrogenase	NA	NA	NA	NA	NA
WP_002210175.1|609351_609627_-	helix-turn-helix domain-containing protein	NA	A0A2I7S995	Vibrio_phage	64.2	1.1e-18
WP_002210176.1|609810_610158_+	putative DNA-binding transcriptional regulator	NA	A0A0M3LPN5	Mannheimia_phage	45.2	7.3e-09
WP_002210177.1|610254_611226_-	octaprenyl diphosphate synthase	NA	A0A1V0SE37	Indivirus	27.6	6.0e-08
WP_002210178.1|611485_611797_+	50S ribosomal protein L21	NA	NA	NA	NA	NA
WP_002210179.1|611816_612074_+	50S ribosomal protein L27	NA	NA	NA	NA	NA
WP_002210180.1|612161_613148_+	DMT family transporter	NA	NA	NA	NA	NA
WP_002210181.1|613148_614321_+	Obg family GTPase CgtA	NA	NA	NA	NA	NA
WP_002210182.1|614415_615483_-	two-component system sensor histidine kinase PmrB	NA	W8CYF6	Bacillus_phage	21.9	4.7e-06
WP_002210183.1|615479_616142_-	two-component system response regulator PmrA	NA	W8CYM9	Bacillus_phage	35.5	8.4e-30
WP_002217314.1|616147_617596_-	serine-type D-Ala-D-Ala carboxypeptidase	NA	NA	NA	NA	NA
WP_002210184.1|617853_618330_+	transcription elongation factor GreA	NA	NA	NA	NA	NA
WP_002210185.1|618457_618751_-	ribosome assembly RNA-binding protein YhbY	NA	NA	NA	NA	NA
WP_002228196.1|618897_619527_+	23S rRNA (uridine(2552)-2'-O)-methyltransferase RlmE	NA	NA	NA	NA	NA
WP_002228195.1|619583_621518_+|protease	ATP-dependent zinc metalloprotease FtsH	protease	G8DDJ2	Micromonas_pusilla_virus	44.5	4.4e-119
WP_002210188.1|621637_622471_+	dihydropteroate synthase	NA	A0A0B5J4J5	Pandoravirus	28.2	6.5e-19
WP_002210189.1|622480_623821_+	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_002210190.1|624043_624379_+	preprotein translocase subunit SecG	NA	NA	NA	NA	NA
WP_002222054.1|624910_625363_+	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_002209253.1|625384_626872_+	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_002223151.1|626896_629575_+	translation initiation factor IF-2	NA	A0A2H4UTS4	Bodo_saltans_virus	24.6	2.3e-25
WP_002209255.1|629640_630051_+	30S ribosome-binding factor RbfA	NA	NA	NA	NA	NA
WP_002209256.1|630050_631025_+|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	NA	NA	NA	NA
WP_002209257.1|631146_631416_+	30S ribosomal protein S15	NA	NA	NA	NA	NA
WP_100067904.1|631502_632856_+|transposase	IS3-like element IS1661 family transposase	transposase	A0A1B1P773	Bacillus_phage	44.7	1.1e-55
>prophage 3
NC_005810	Yersinia pestis biovar Microtus str. 91001, complete sequence	4595065	907149	943192	4595065	transposase,tRNA,integrase,protease	Saccharomonospora_phage(22.22%)	39	925429:925444	942414:942429
WP_002208581.1|907149_907629_-|tRNA	Cys-tRNA(Pro)/Cys-tRNA(Cys) deacylase YbaK	tRNA	NA	NA	NA	NA
WP_002208580.1|907892_908702_-	TraB/GumN family protein	NA	NA	NA	NA	NA
WP_002223301.1|909222_912108_-	copper-exporting P-type ATPase CopA	NA	A0A218MNH6	uncultured_virus	36.8	1.0e-111
WP_002208578.1|912314_912734_+	Cu(I)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_002208577.1|912842_913292_-	NfeD family protein	NA	NA	NA	NA	NA
WP_002208576.1|913294_914209_-	SPFH/Band 7/PHB domain protein	NA	NA	NA	NA	NA
WP_002208575.1|914403_915273_-	co-chaperone YbbN	NA	NA	NA	NA	NA
WP_002208574.1|915349_916126_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_002208573.1|916512_917148_-|protease	multifunctional acyl-CoA thioesterase I/protease I/lysophospholipase L1	protease	NA	NA	NA	NA
WP_002208572.1|917118_917805_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.2	1.6e-31
WP_002208571.1|917801_920231_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_002208570.1|920274_921339_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_002208569.1|921335_921860_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	NA	NA	NA	NA
WP_002208568.1|922155_922878_-	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_002208567.1|922888_923383_-	peptidylprolyl isomerase B	NA	NA	NA	NA	NA
WP_002222677.1|923592_924978_+|tRNA	cysteine--tRNA ligase	tRNA	A0A0G2Y344	Acanthamoeba_polyphaga_mimivirus	28.5	2.2e-40
WP_002213775.1|925324_925783_+|transposase	IS200/IS605-like element IS1541B family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	8.5e-13
925429:925444	attL	AGCGATTGGCAGTATT	NA	NA	NA	NA
WP_002209775.1|925929_926142_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_002209774.1|926156_927023_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	34.1	2.2e-30
WP_002215270.1|927377_927560_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_002215268.1|927818_928019_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002231096.1|928132_928780_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002215266.1|928764_929103_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079866998.1|929185_929464_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y6Q1	Salmonella_phage	73.5	4.2e-31
WP_002354559.1|929675_929882_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002209770.1|930281_930884_+	CDP-alcohol phosphatidyltransferase family protein	NA	NA	NA	NA	NA
WP_002209769.1|930876_931806_+	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_002209768.1|931815_932448_+	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_002209767.1|932444_934208_+	bifunctional alpha/beta hydrolase/class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_002209766.1|934200_935520_+	phosphatase PAP2/dual specificity phosphatase family protein	NA	NA	NA	NA	NA
WP_002209765.1|935501_935903_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002215253.1|935999_936305_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001297096.1|936671_937451_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_000255944.1|937450_938473_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_002211286.1|939106_939295_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002220006.1|939560_940079_-	bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase	NA	NA	NA	NA	NA
WP_002224683.1|940147_941899_-|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_002226586.1|942109_942565_+	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
942414:942429	attR	AGCGATTGGCAGTATT	NA	NA	NA	NA
WP_002213775.1|942733_943192_-|transposase	IS200/IS605-like element IS1541B family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	8.5e-13
>prophage 4
NC_005810	Yersinia pestis biovar Microtus str. 91001, complete sequence	4595065	953198	997815	4595065	tail,protease,coat,plate	Pseudomonas_phage(25.0%)	38	NA	NA
WP_002208845.1|953198_953978_-|tail	tail fiber protein	tail	Q9MCR6	Enterobacteria_phage	52.4	7.1e-52
WP_002208846.1|954074_954422_-	DUF2313 domain-containing protein	NA	A0A2P9JZK7	Alteromonadaceae_phage	41.3	6.4e-21
WP_002215458.1|954418_954679_-	DUF2313 domain-containing protein	NA	NA	NA	NA	NA
WP_002208847.1|954675_955812_-|plate	baseplate J/gp47 family protein	plate	B5TK75	Pseudomonas_phage	30.5	4.5e-31
WP_002208848.1|955815_956271_-	phage GP46 family protein	NA	A0A0C4UR04	Shigella_phage	43.8	4.3e-17
WP_002215460.1|956267_956864_-|plate	phage baseplate assembly protein	plate	NA	NA	NA	NA
WP_011171778.1|956879_957935_-|tail	tail protein	tail	M1PVV2	Vibrio_phage	27.6	1.8e-37
WP_002208852.1|957931_959338_-	DNA circularization protein	NA	Q8SBG8	Shigella_phage	33.7	2.1e-17
WP_002208853.1|959604_961098_-|coat	coat protein	coat	NA	NA	NA	NA
WP_002208854.1|961218_961518_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_002208855.1|961519_961888_-|tail	phage tail tube protein	tail	NA	NA	NA	NA
WP_002208856.1|961909_963418_-|tail	phage tail sheath subtilisin-like domain-containing protein	tail	B5TK67	Pseudomonas_phage	44.2	2.4e-104
WP_002208857.1|963414_963609_-	DUF2635 domain-containing protein	NA	B5TK66	Pseudomonas_phage	60.4	3.5e-08
WP_002208858.1|963613_964231_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_002208859.1|964276_964567_-	hypothetical protein	NA	H6WRZ3	Salmonella_phage	46.3	7.7e-12
WP_002208860.1|965180_965975_-	hydroxypyruvate isomerase family protein	NA	NA	NA	NA	NA
WP_002208861.1|965950_966763_-	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_002208862.1|967471_968776_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	46.0	1.7e-90
WP_002215470.1|968986_969466_-	antitermination protein Q	NA	S5M7R9	Escherichia_phage	61.0	2.3e-37
WP_002208864.1|969739_970462_+	LexA family transcriptional regulator	NA	F1C599	Cronobacter_phage	51.9	2.2e-63
WP_002208866.1|970667_970910_+	DinI family protein	NA	K7PKR6	Enterobacteria_phage	65.0	6.9e-22
WP_002208867.1|971081_972017_+	omptin family outer membrane beta-barrel protein YcoA	NA	NA	NA	NA	NA
WP_002208868.1|972423_974211_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	63.5	4.0e-10
WP_002230695.1|974284_975313_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_002208870.1|975689_977216_+	MFS transporter	NA	NA	NA	NA	NA
WP_002228026.1|977490_978657_+	D-alanyl-D-alanine- carboxypeptidase/endopeptidase AmpH	NA	NA	NA	NA	NA
WP_002210826.1|979396_980512_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	57.6	9.6e-111
WP_002210825.1|981614_982769_+	MFS transporter	NA	NA	NA	NA	NA
WP_002216093.1|982792_984745_+	phosphotransferase RcsD	NA	NA	NA	NA	NA
WP_002216094.1|984912_985485_+	Hpt domain-containing protein	NA	NA	NA	NA	NA
WP_002210824.1|985487_986141_+	transcriptional regulator RcsB	NA	NA	NA	NA	NA
WP_011171779.1|986208_989082_-	two-component system sensor histidine kinase RcsC	NA	A0A1V0SGX0	Hokovirus	28.3	3.8e-42
WP_002210821.1|989269_991945_-	DNA topoisomerase (ATP-hydrolyzing) subunit A	NA	G3M9Z5	Bacillus_virus	34.4	4.0e-102
WP_002210820.1|992206_992935_+	bifunctional 3-demethylubiquinone 3-O-methyltransferase/2-octaprenyl-6-hydroxy phenol methylase	NA	NA	NA	NA	NA
WP_002210818.1|993428_995717_+	ribonucleoside-diphosphate reductase subunit alpha	NA	I3UMG3	Colwellia_phage	64.9	1.1e-286
WP_002210817.1|995879_997010_+	ribonucleotide-diphosphate reductase subunit beta	NA	G9IAA3	Pseudomonas_phage	78.6	7.6e-172
WP_002210816.1|997013_997271_+	2Fe-2S ferredoxin-like protein	NA	G9IAA2	Pseudomonas_phage	54.9	4.0e-20
WP_002210815.1|997305_997815_+|protease	serine protease inhibitor ecotin	protease	NA	NA	NA	NA
>prophage 5
NC_005810	Yersinia pestis biovar Microtus str. 91001, complete sequence	4595065	1038349	1074565	4595065	holin,transposase,tRNA	Saccharomonospora_phage(27.27%)	30	NA	NA
WP_002228612.1|1038349_1039288_-|tRNA	tRNA dihydrouridine(16) synthase DusC	tRNA	NA	NA	NA	NA
WP_002210776.1|1039587_1040517_-	DUF4097 domain-containing protein	NA	NA	NA	NA	NA
WP_002213759.1|1040926_1041385_-|transposase	IS200/IS605-like element IS1541A family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	8.5e-13
WP_002209743.1|1043196_1044405_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	50.8	5.4e-51
WP_002223532.1|1044578_1044893_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002228617.1|1044976_1045213_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016256670.1|1045353_1045680_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158499539.1|1045726_1046041_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002220152.1|1047127_1048483_-	ATP-dependent RNA helicase RhlE	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	35.6	4.1e-55
WP_002220154.1|1048873_1049584_+	transcriptional regulator CecR	NA	NA	NA	NA	NA
WP_002220156.1|1049635_1050622_+	secretion protein HlyD	NA	NA	NA	NA	NA
WP_002220158.1|1050635_1052378_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	34.6	6.3e-24
WP_002230687.1|1052382_1053558_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_002220162.1|1053570_1054677_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_002220163.1|1054715_1055042_-	EthD family reductase	NA	NA	NA	NA	NA
WP_002220165.1|1055052_1055280_-	N5,N10-methylene tetrahydromethanopterin reductase	NA	NA	NA	NA	NA
WP_002220168.1|1055834_1056746_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002220169.1|1056746_1057856_-	alkene reductase	NA	NA	NA	NA	NA
WP_002220170.1|1058203_1059568_-	sigma 54-interacting transcriptional regulator	NA	Q6XM27	Feldmannia_irregularis_virus	29.1	1.3e-05
WP_002220171.1|1059554_1061369_-	PAS domain-containing sensor histidine kinase	NA	W8CYF6	Bacillus_phage	28.4	1.0e-16
WP_002220173.1|1061726_1062200_+	zinc resistance sensor/chaperone ZraP	NA	NA	NA	NA	NA
WP_002213759.1|1063005_1063464_-|transposase	IS200/IS605-like element IS1541A family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	8.5e-13
WP_002214195.1|1064392_1065256_-	xanthosine phosphorylase	NA	Q5YBA4	Grouper_iridovirus	40.7	2.3e-51
WP_002214197.1|1065601_1066450_+	DMT family transporter	NA	NA	NA	NA	NA
WP_002214199.1|1066487_1067381_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002228035.1|1067612_1069661_-|holin	choline transporter	holin	A0A2I7QNT1	Vibrio_phage	28.5	1.4e-19
WP_002218278.1|1070025_1070622_+	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_002218281.1|1070679_1072152_+	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_002220180.1|1072174_1073878_+|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.5	9.4e-57
WP_002213775.1|1074106_1074565_-|transposase	IS200/IS605-like element IS1541B family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	8.5e-13
>prophage 6
NC_005810	Yersinia pestis biovar Microtus str. 91001, complete sequence	4595065	1144409	1153551	4595065	transposase	Escherichia_phage(28.57%)	11	NA	NA
WP_002210709.1|1144409_1144610_+	AlpA family transcriptional regulator	NA	A0A1V0E8E5	Vibrio_phage	51.7	1.6e-08
WP_002215949.1|1144609_1145152_+	ash family protein	NA	NA	NA	NA	NA
WP_002215950.1|1145144_1146104_+	toprim domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	41.0	1.6e-50
WP_002210707.1|1146100_1147189_+	AAA family ATPase	NA	A0A2H4JFA4	uncultured_Caudovirales_phage	60.4	1.4e-114
WP_002210705.1|1147537_1147852_-	putative addiction module antidote protein	NA	NA	NA	NA	NA
WP_002215951.1|1147857_1148175_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A141GEX6	Brucella_phage	48.1	2.0e-13
WP_000255944.1|1148779_1149802_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_001297096.1|1149801_1150581_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_002215393.1|1151473_1151659_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002212204.1|1151821_1152073_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002215390.1|1152783_1153551_+	esterase	NA	G1DB77	Mycobacterium_phage	36.0	3.4e-06
>prophage 7
NC_005810	Yersinia pestis biovar Microtus str. 91001, complete sequence	4595065	1334232	1343854	4595065	transposase,tRNA,protease	Brazilian_cedratvirus(16.67%)	8	NA	NA
WP_002211344.1|1334232_1335957_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	31.8	3.3e-17
WP_002211346.1|1336175_1336886_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_002211347.1|1337051_1337270_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_002213759.1|1337641_1338100_-|transposase	IS200/IS605-like element IS1541A family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	8.5e-13
WP_002211348.1|1338377_1340654_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	41.7	7.4e-166
WP_002211349.1|1340679_1341000_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	42.7	8.2e-15
WP_002211350.1|1341360_1341624_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	59.7	3.6e-16
WP_011171806.1|1341904_1343854_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	37.7	8.8e-35
>prophage 8
NC_005810	Yersinia pestis biovar Microtus str. 91001, complete sequence	4595065	1453425	1517440	4595065	transposase,plate	Escherichia_phage(25.0%)	50	NA	NA
WP_002213775.1|1453425_1453884_-|transposase	IS200/IS605-like element IS1541B family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	8.5e-13
WP_002213066.1|1454073_1455135_-	porin OmpA	NA	NA	NA	NA	NA
WP_002213065.1|1455492_1455999_-	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_002213064.1|1456227_1456863_+	TfoX/Sxy family DNA transformation protein	NA	NA	NA	NA	NA
WP_002213063.1|1456964_1459103_-	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_002213062.1|1459132_1459579_-	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_002221095.1|1459772_1461827_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	25.8	1.5e-16
WP_002213060.1|1461887_1462352_-	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_002213058.1|1462530_1463211_-	DUF2057 family protein	NA	NA	NA	NA	NA
WP_002213056.1|1463526_1463943_+	CoA-binding protein	NA	NA	NA	NA	NA
WP_002213054.1|1464051_1464369_-	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_002213052.1|1464429_1465620_-	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	W6LLI2	Streptococcus_phage	28.1	2.1e-26
WP_002213049.1|1465713_1465992_+	acylphosphatase	NA	NA	NA	NA	NA
WP_002213046.1|1466043_1466373_-	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_000255944.1|1469226_1470249_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_001297096.1|1470248_1471028_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_002213039.1|1471978_1474396_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_002213038.1|1474549_1475296_-	SDR family oxidoreductase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	31.4	3.3e-14
WP_002213036.1|1476026_1476245_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002213034.1|1476508_1477033_+	beta-hydroxyacyl-ACP dehydratase	NA	NA	NA	NA	NA
WP_002213032.1|1477022_1478306_+	beta-ketoacyl-[acyl-carrier-protein] synthase family protein	NA	NA	NA	NA	NA
WP_002213030.1|1478307_1479045_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_002213028.1|1479060_1480299_+	hydroxymethylglutaryl-CoA synthase family protein	NA	NA	NA	NA	NA
WP_002213026.1|1480291_1481011_+	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_002213025.1|1481012_1481765_+	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_002213024.1|1481767_1482556_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_002228570.1|1482642_1483083_+	lipocalin-like domain-containing protein	NA	NA	NA	NA	NA
WP_002213017.1|1483120_1483369_+	acyl carrier protein	NA	NA	NA	NA	NA
WP_002213016.1|1483467_1484316_+	ACP S-malonyltransferase	NA	NA	NA	NA	NA
WP_002213014.1|1485304_1485805_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_002215896.1|1485847_1487392_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_002211664.1|1487403_1488756_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_002210015.1|1488752_1489439_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_002214568.1|1489438_1491175_+	OmpA family protein	NA	NA	NA	NA	NA
WP_002210014.1|1491178_1491670_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_002211927.1|1492057_1494700_+	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	31.6	1.6e-92
WP_002211928.1|1494702_1497051_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	32.1	4.5e-17
WP_002211929.1|1497066_1499367_+	M23 family metallopeptidase	NA	NA	NA	NA	NA
WP_002211930.1|1499363_1500137_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002211931.1|1500290_1500551_+	DUF2345 domain-containing protein	NA	NA	NA	NA	NA
WP_002211932.1|1500566_1502750_+	M23 family metallopeptidase	NA	NA	NA	NA	NA
WP_002214564.1|1502922_1503393_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002211935.1|1505557_1506790_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002211936.1|1506786_1510209_+	type VI secretion system membrane subunit	NA	NA	NA	NA	NA
WP_002211938.1|1511870_1512929_+	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_002211939.1|1512943_1513399_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002211940.1|1513619_1515383_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_002211941.1|1515346_1516432_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_002214552.1|1516406_1516988_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_002211943.1|1516987_1517440_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
>prophage 9
NC_005810	Yersinia pestis biovar Microtus str. 91001, complete sequence	4595065	1878213	1906906	4595065	transposase,coat	Escherichia_phage(33.33%)	25	NA	NA
WP_002209743.1|1878213_1879422_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	50.8	5.4e-51
WP_052638304.1|1879452_1879731_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002212037.1|1879790_1880579_+	phosphate starvation-inducible protein PhoH	NA	R4II13	Cronobacter_phage	73.8	2.5e-89
WP_002212036.1|1880681_1881782_-	sodium-potassium/proton antiporter ChaA	NA	NA	NA	NA	NA
WP_002212035.1|1882330_1884112_-	nitrate/nitrite two-component system sensor histidine kinase NarX	NA	NA	NA	NA	NA
WP_071588665.1|1884179_1884308_-	DUF2474 domain-containing protein	NA	NA	NA	NA	NA
WP_002212033.1|1884421_1885843_+	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_002216140.1|1886479_1887724_+	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	28.3	8.2e-26
WP_002212031.1|1887753_1888806_+	arginine N-succinyltransferase	NA	NA	NA	NA	NA
WP_002212030.1|1888802_1890320_+	succinylglutamate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_002212029.1|1890343_1891687_+	N-succinylarginine dihydrolase	NA	NA	NA	NA	NA
WP_002212028.1|1891747_1892740_+	succinylglutamate desuccinylase	NA	NA	NA	NA	NA
WP_002230843.1|1893467_1894550_+	porin	NA	Q1MVN1	Enterobacteria_phage	52.7	3.3e-100
WP_002211282.1|1894866_1895673_-	N-formylglutamate deformylase	NA	NA	NA	NA	NA
WP_002211281.1|1895669_1896890_-	imidazolonepropionase	NA	NA	NA	NA	NA
WP_001297096.1|1897504_1898284_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_000255944.1|1898283_1899306_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_002215943.1|1899712_1900102_+	ASCH domain-containing protein	NA	NA	NA	NA	NA
WP_002210859.1|1900211_1900451_-	YebV family protein	NA	NA	NA	NA	NA
WP_002230846.1|1900658_1901648_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_002210857.1|1901853_1904301_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_002210856.1|1904454_1905207_-	molecular chaperone	NA	NA	NA	NA	NA
WP_002216611.1|1905237_1905795_-|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
WP_002216613.1|1905815_1906346_-|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
WP_002210852.1|1906351_1906906_-|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
>prophage 10
NC_005810	Yersinia pestis biovar Microtus str. 91001, complete sequence	4595065	2144895	2156299	4595065	transposase,integrase	Escherichia_phage(20.0%)	13	2144840:2144870	2153810:2153840
2144840:2144870	attL	ATATTGAATAAGCCGAGTTGGGCTAAATAAC	NA	NA	NA	NA
WP_002211738.1|2144895_2146134_-|integrase	site-specific integrase	integrase	Q20GI2	Phage_258-320	53.3	2.3e-121
WP_000255944.1|2146203_2147226_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_001297096.1|2147225_2148005_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_002215632.1|2148172_2148433_-	excisionase family protein	NA	Q859D3	Escherichia_coli_phage	42.9	1.7e-10
WP_002211736.1|2149457_2149904_+	recombination protein NinB	NA	A0A2H4J8D9	uncultured_Caudovirales_phage	62.5	3.9e-47
WP_002211735.1|2149977_2150583_+	recombination protein NinG	NA	A0A1P8DTE0	Proteus_phage	56.9	2.8e-56
WP_002215636.1|2150583_2150973_+	antitermination protein	NA	A0A1W6JNX1	Morganella_phage	68.8	1.4e-45
WP_002215638.1|2150976_2151195_+	ash family protein	NA	NA	NA	NA	NA
WP_002211732.1|2151243_2151807_+	Bro-N domain-containing protein	NA	B6SD63	Bacteriophage	58.0	9.4e-30
WP_002393183.1|2151891_2152068_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002209743.1|2152410_2153619_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	50.8	5.4e-51
WP_002214492.1|2153923_2155096_-	MFS transporter	NA	NA	NA	NA	NA
2153810:2153840	attR	ATATTGAATAAGCCGAGTTGGGCTAAATAAC	NA	NA	NA	NA
WP_002211693.1|2155099_2156299_-	cysteine desulfurase	NA	A0A1X7QGF3	Faustovirus	29.6	2.4e-38
>prophage 11
NC_005810	Yersinia pestis biovar Microtus str. 91001, complete sequence	4595065	2797960	2854881	4595065	transposase,tRNA,plate	Saccharomonospora_phage(10.0%)	48	NA	NA
WP_002213775.1|2797960_2798419_+|transposase	IS200/IS605-like element IS1541B family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	8.5e-13
WP_002211567.1|2798574_2798835_-	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	53.5	9.3e-17
WP_000255944.1|2799520_2800543_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_001297096.1|2800542_2801322_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_002211565.1|2802002_2802890_+	N-acetylmuramic acid 6-phosphate etherase	NA	NA	NA	NA	NA
WP_002211564.1|2803116_2803812_+	phosphatidylglycerophosphatase C	NA	NA	NA	NA	NA
WP_002211563.1|2803882_2804485_+|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	S4VYT2	Pandoravirus	34.1	6.5e-05
WP_002211562.1|2804593_2806054_-	membrane-bound lytic murein transglycosylase MltF	NA	I1VXB7	Halocynthia_phage	41.4	7.1e-13
WP_002223376.1|2806369_2810260_+	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	59.5	8.8e-127
WP_032487261.1|2810256_2810364_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002211560.1|2810671_2811121_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002211559.1|2811572_2812133_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002216113.1|2813145_2813370_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002213759.1|2813359_2813818_+|transposase	IS200/IS605-like element IS1541A family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	8.5e-13
WP_002216114.1|2814038_2815475_+	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	23.8	3.1e-13
WP_072120864.1|2815523_2816546_+	two-component system QseEF-associated lipoprotein QseG	NA	NA	NA	NA	NA
WP_002211556.1|2816508_2817846_+	two-component system response regulator GlrR	NA	W8CYM9	Bacillus_phage	37.4	1.2e-11
WP_002211555.1|2818005_2819628_+	NAD+ synthase	NA	A0A2L0UZF5	Agrobacterium_phage	36.5	1.1e-94
WP_002231018.1|2819642_2819981_+	nitrogen regulatory protein P-II	NA	NA	NA	NA	NA
WP_002211553.1|2821513_2822704_-	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_002211552.1|2823244_2824498_+	serine hydroxymethyltransferase	NA	A0A219Y950	Aeromonas_phage	52.5	2.8e-98
WP_002223388.1|2824649_2824832_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011171891.1|2824941_2825490_+	attachment invasion locus protein Ail	NA	A0A1B0VBR9	Salmonella_phage	36.7	8.8e-25
WP_002213316.1|2825841_2826999_+	3-phenylpropionate MFS transporter	NA	NA	NA	NA	NA
WP_002213314.1|2826995_2828357_-	stationary phase inducible protein CsiE	NA	NA	NA	NA	NA
WP_002213310.1|2828498_2829173_+	DUF1007 family protein	NA	NA	NA	NA	NA
WP_011171892.1|2829163_2830186_+	nickel/cobalt transporter	NA	NA	NA	NA	NA
WP_002213305.1|2830284_2831088_-	inositol-1-monophosphatase	NA	NA	NA	NA	NA
WP_002217034.1|2831206_2831980_+|tRNA	tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ	tRNA	NA	NA	NA	NA
WP_002222202.1|2832135_2832630_+	Fe-S cluster assembly transcriptional regulator IscR	NA	NA	NA	NA	NA
WP_002209836.1|2832683_2833913_+	IscS subfamily cysteine desulfurase	NA	A0A0H3TPH2	Faustovirus	33.1	8.6e-36
WP_002209835.1|2833943_2834330_+	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	77.3	5.4e-53
WP_002209834.1|2834599_2834923_+	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	47.7	7.8e-21
WP_002209833.1|2835033_2835558_+	co-chaperone HscB	NA	NA	NA	NA	NA
WP_011171893.1|2835800_2837738_+	Fe-S protein assembly chaperone HscA	NA	F2Y2E1	Organic_Lake_phycodnavirus	38.0	5.2e-96
WP_002209831.1|2837740_2838076_+	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
WP_002209830.1|2838105_2838306_+	Fe-S cluster assembly protein IscX	NA	NA	NA	NA	NA
WP_002209829.1|2838445_2839744_+	aminopeptidase PepB	NA	Q6GYZ8	Mycoplasma_phage	39.0	9.7e-38
WP_002209828.1|2839822_2840776_+	enhanced serine sensitivity protein SseB	NA	NA	NA	NA	NA
WP_071525548.1|2840909_2841035_+	gluconate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_002215505.1|2841113_2841434_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_002209743.1|2843945_2845154_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	50.8	5.4e-51
WP_002231031.1|2845175_2846726_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_002211579.1|2846853_2847615_-	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_002211580.1|2847771_2848317_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_002215317.1|2848517_2851193_-	type VI secretion system ATPase TssH	NA	A0A223W0B1	Agrobacterium_phage	32.3	1.0e-81
WP_002211582.1|2851975_2853856_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_002211583.1|2853855_2854881_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
>prophage 12
NC_005810	Yersinia pestis biovar Microtus str. 91001, complete sequence	4595065	3929054	4005024	4595065	transposase,protease,tRNA,plate	Staphylococcus_phage(20.0%)	55	NA	NA
WP_002215902.1|3929054_3929705_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_002215900.1|3930155_3930551_+	lipoprotein	NA	NA	NA	NA	NA
WP_002230478.1|3932826_3933327_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_002214707.1|3933369_3934920_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_002213011.1|3934931_3936284_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_002210015.1|3936280_3936967_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_002228049.1|3936966_3938703_+	OmpA family protein	NA	NA	NA	NA	NA
WP_002210014.1|3938706_3939198_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_011171956.1|3939615_3942264_+	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	29.5	4.8e-92
WP_011171957.1|3942260_3944609_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	33.3	3.1e-18
WP_002210011.1|3944623_3946846_+	hydroxyethylthiazole kinase	NA	NA	NA	NA	NA
WP_002230652.1|3946846_3947347_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002216110.1|3947530_3947725_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002210010.1|3948949_3949585_+	DUF2345 domain-containing protein	NA	NA	NA	NA	NA
WP_002210009.1|3949600_3951898_+	M23 family metallopeptidase	NA	NA	NA	NA	NA
WP_002210008.1|3951884_3952652_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086016632.1|3952747_3953444_+|transposase	IS1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	48.5	1.3e-60
WP_002210002.1|3956009_3958172_+	ornithine decarboxylase SpeF	NA	NA	NA	NA	NA
WP_002210001.1|3958727_3959687_+	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_002210000.1|3959732_3961232_+	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	31.7	5.2e-19
WP_002209999.1|3961264_3962248_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_002209998.1|3962330_3964364_-	TonB-dependent siderophore receptor	NA	A0A0P0I887	Acinetobacter_phage	26.1	4.5e-05
WP_002209997.1|3964467_3965568_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002209995.1|3965867_3966944_-	membrane-bound lytic murein transglycosylase MltC	NA	NA	NA	NA	NA
WP_002230648.1|3967126_3967399_-	oxidative damage protection protein	NA	NA	NA	NA	NA
WP_002228057.1|3967576_3968692_-	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_002209991.1|3969029_3969749_+|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_002209990.1|3969748_3970075_+	YggL family protein	NA	NA	NA	NA	NA
WP_002209989.1|3970185_3971112_+	glutaminase B	NA	NA	NA	NA	NA
WP_002228656.1|3971223_3971754_+	DUF2884 family protein	NA	NA	NA	NA	NA
WP_011566213.1|3971711_3971957_+	DUF2884 family protein	NA	NA	NA	NA	NA
WP_011171959.1|3972452_3981785_+	virulence determinant	NA	NA	NA	NA	NA
WP_002209743.1|3981899_3983108_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	50.8	5.4e-51
WP_002209987.1|3983297_3984428_-	radical SAM family heme chaperone HemW	NA	NA	NA	NA	NA
WP_002215614.1|3984420_3985014_-	XTP/dITP diphosphatase	NA	NA	NA	NA	NA
WP_002215612.1|3985113_3985404_-	YggU family protein	NA	NA	NA	NA	NA
WP_002209984.1|3985400_3985955_-	YggT family protein	NA	NA	NA	NA	NA
WP_002209983.1|3986242_3987064_-	pyrroline-5-carboxylate reductase	NA	NA	NA	NA	NA
WP_002215609.1|3987196_3987895_-	YggS family pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_002209981.1|3987914_3989039_+	type IV pilus twitching motility protein PilT	NA	NA	NA	NA	NA
WP_002209980.1|3989147_3990263_-	agmatine deiminase	NA	M1I1E2	Acanthocystis_turfacea_Chlorella_virus	50.7	3.0e-96
WP_002209979.1|3990266_3991151_-	N-carbamoylputrescine amidase	NA	A7IVZ1	Paramecium_bursaria_Chlorella_virus	51.0	3.1e-80
WP_002209978.1|3991330_3991753_-	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_002209977.1|3991752_3992316_-	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_002209976.1|3992431_3993391_-	glutathione synthase	NA	NA	NA	NA	NA
WP_002209975.1|3993416_3994148_-	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_002209973.1|3994399_3995107_-	deoxyribonuclease I	NA	NA	NA	NA	NA
WP_002228653.1|3995204_3995717_-|protease	SprT family zinc-dependent metalloprotease	protease	NA	NA	NA	NA
WP_002209971.1|3995909_3997064_-	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	62.1	1.7e-126
WP_002209969.1|3998271_4000251_+	biosynthetic arginine decarboxylase	NA	NA	NA	NA	NA
WP_002209968.1|4000410_4000731_+	non-heme iron oxygenase ferredoxin subunit	NA	NA	NA	NA	NA
WP_071525520.1|4000764_4000875_-	gluconate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_002209967.1|4001020_4001773_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_002209965.1|4002263_4004258_+	transketolase	NA	NA	NA	NA	NA
WP_002213759.1|4004565_4005024_+|transposase	IS200/IS605-like element IS1541A family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	8.5e-13
>prophage 13
NC_005810	Yersinia pestis biovar Microtus str. 91001, complete sequence	4595065	4112798	4188723	4595065	transposase,plate	Escherichia_phage(16.67%)	55	NA	NA
WP_011171963.1|4112798_4113821_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.4	1.6e-200
WP_001297096.1|4113820_4114600_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_002210424.1|4114939_4115326_-	8-oxo-dGTP diphosphatase MutT	NA	A0A0B5CYJ3	Rhizoctonia_fumigata_mycovirus	30.4	8.4e-06
WP_002210426.1|4115620_4118335_-	preprotein translocase subunit SecA	NA	NA	NA	NA	NA
WP_002210427.1|4118412_4118946_-	secA regulator SecM	NA	NA	NA	NA	NA
WP_002210428.1|4118974_4119499_+	DUF721 domain-containing protein	NA	NA	NA	NA	NA
WP_002228285.1|4119665_4120586_-	UDP-3-O-acyl-N-acetylglucosamine deacetylase	NA	NA	NA	NA	NA
WP_002210431.1|4121908_4123165_-	cell division protein FtsA	NA	NA	NA	NA	NA
WP_011171965.1|4123191_4124019_-	cell division protein FtsQ	NA	NA	NA	NA	NA
WP_002210432.1|4124020_4124941_-	D-alanine--D-alanine ligase	NA	NA	NA	NA	NA
WP_002216457.1|4124933_4126409_-	UDP-N-acetylmuramate--L-alanine ligase	NA	NA	NA	NA	NA
WP_002210434.1|4126546_4127617_-	undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase	NA	NA	NA	NA	NA
WP_002210435.1|4127613_4128816_-	cell division protein FtsW	NA	NA	NA	NA	NA
WP_002210436.1|4128815_4130132_-	UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase	NA	NA	NA	NA	NA
WP_002210437.1|4130134_4131217_-	phospho-N-acetylmuramoyl-pentapeptide- transferase	NA	NA	NA	NA	NA
WP_002210438.1|4131210_4132587_-	UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D- alanine ligase	NA	NA	NA	NA	NA
WP_002210439.1|4132583_4134071_-	UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2, 6-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_002210440.1|4134057_4135821_-	peptidoglycan glycosyltransferase FtsI	NA	NA	NA	NA	NA
WP_002210441.1|4135886_4136204_-	cell division protein FtsL	NA	NA	NA	NA	NA
WP_002210442.1|4136200_4137163_-	16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH	NA	NA	NA	NA	NA
WP_002210443.1|4137165_4137624_-	division/cell wall cluster transcriptional repressor MraZ	NA	NA	NA	NA	NA
WP_087768171.1|4138178_4138268_-	gluconate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_002210446.1|4138725_4139166_+	L-alanine exporter AlaE	NA	NA	NA	NA	NA
WP_002210447.1|4139296_4140307_-	catabolite repressor/activator	NA	NA	NA	NA	NA
WP_002213775.1|4140811_4141270_-|transposase	IS200/IS605-like element IS1541B family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	8.5e-13
WP_002210452.1|4141698_4141914_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002216434.1|4142590_4143547_+	transcriptional regulator LeuO	NA	NA	NA	NA	NA
WP_002216437.1|4144095_4145901_+	long-chain fatty acid--CoA ligase	NA	A0A1V0SBX8	Catovirus	23.2	3.5e-38
WP_002228103.1|4146360_4148088_+	acetolactate synthase 3 large subunit	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	29.4	7.8e-59
WP_002210448.1|4148090_4148585_+	acetolactate synthase small subunit	NA	NA	NA	NA	NA
WP_002213775.1|4148783_4149242_+|transposase	IS200/IS605-like element IS1541B family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	8.5e-13
WP_002210453.1|4149388_4150951_+	2-isopropylmalate synthase	NA	NA	NA	NA	NA
WP_002210454.1|4150953_4152045_+	3-isopropylmalate dehydrogenase	NA	NA	NA	NA	NA
WP_002210455.1|4152046_4153477_+	3-isopropylmalate dehydratase large subunit	NA	NA	NA	NA	NA
WP_002210456.1|4153491_4154094_+	3-isopropylmalate dehydratase small subunit	NA	NA	NA	NA	NA
WP_002224086.1|4154334_4155516_-	MFS transporter	NA	NA	NA	NA	NA
WP_002210461.1|4156179_4157841_+	HTH-type transcriptional regulator SgrR	NA	NA	NA	NA	NA
WP_002214274.1|4158780_4159773_+	thiamine ABC transporter substrate binding subunit	NA	NA	NA	NA	NA
WP_002214276.1|4159748_4161356_+	thiamine/thiamine pyrophosphate ABC transporter permease ThiP	NA	NA	NA	NA	NA
WP_002210464.1|4161342_4162053_+	thiamine ABC transporter ATP-binding protein ThiQ	NA	G3M9Y6	Bacillus_virus	34.1	1.0e-20
WP_002210465.1|4162121_4162889_-	DedA family protein	NA	NA	NA	NA	NA
WP_002210466.1|4163084_4165454_+	DNA polymerase II	NA	A0A0P0YM26	Yellowstone_lake_phycodnavirus	25.5	1.5e-31
WP_002220588.1|4165914_4168821_+	RNA polymerase-associated protein RapA	NA	A0A1B1IUI1	uncultured_Mediterranean_phage	37.6	3.0e-23
WP_002210468.1|4169076_4169430_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002210469.1|4172954_4174565_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_002210470.1|4174561_4175917_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_002210471.1|4176018_4176510_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_002214737.1|4176502_4176868_-	DUF4150 domain-containing protein	NA	NA	NA	NA	NA
WP_002210473.1|4176873_4177491_-	DUF3540 domain-containing protein	NA	NA	NA	NA	NA
WP_002214739.1|4177483_4178587_-	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_002224087.1|4178612_4180832_-	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_002210474.1|4180844_4183193_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	32.9	2.1e-14
WP_002210475.1|4183296_4185885_-	type VI secretion system ATPase TssH	NA	A0A248SJW6	Salicola_phage	28.7	1.9e-77
WP_002210476.1|4185902_4186886_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_002210477.1|4186878_4188723_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
>prophage 14
NC_005810	Yersinia pestis biovar Microtus str. 91001, complete sequence	4595065	4313308	4379371	4595065	transposase,protease,plate	Escherichia_phage(11.76%)	60	NA	NA
WP_071525507.1|4313308_4313647_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_002209171.1|4313990_4315364_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002230553.1|4315335_4316058_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_002230554.1|4316107_4317439_-	site-specific DNA-methyltransferase	NA	NA	NA	NA	NA
WP_002209167.1|4318462_4319779_-	McrC family protein	NA	NA	NA	NA	NA
WP_002209166.1|4319775_4321839_-	McrB family protein	NA	K4I1H4	Acidithiobacillus_phage	33.2	5.3e-30
WP_000255944.1|4321972_4322995_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_001297096.1|4322994_4323774_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_002210151.1|4324855_4325749_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002210150.1|4326010_4326715_+	pirin family protein	NA	NA	NA	NA	NA
WP_002210149.1|4327651_4328551_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	44.4	1.0e-49
WP_002228200.1|4328613_4330587_+	penicillin-binding protein activator	NA	NA	NA	NA	NA
WP_002210147.1|4330670_4331024_+	YraN family protein	NA	NA	NA	NA	NA
WP_002210146.1|4331294_4331885_+	DnaA initiator-associating protein DiaA	NA	A0A067XQR2	Caulobacter_phage	32.0	3.2e-12
WP_002210145.1|4331895_4332471_+	divisome-associated lipoprotein YraP	NA	NA	NA	NA	NA
WP_002210144.1|4332677_4333403_-	monofunctional biosynthetic peptidoglycan transglycosylase	NA	NA	NA	NA	NA
WP_002210143.1|4333399_4334053_-	isoprenoid biosynthesis glyoxalase ElbB	NA	NA	NA	NA	NA
WP_002210142.1|4334294_4336631_-	aerobic respiration two-component sensor histidine kinase ArcB	NA	A0A1V0SGX0	Hokovirus	30.4	9.9e-41
WP_002210140.1|4336894_4337818_-	TIGR01212 family radical SAM protein	NA	NA	NA	NA	NA
WP_002228691.1|4338640_4343098_+	glutamate synthase large subunit	NA	NA	NA	NA	NA
WP_002210138.1|4343107_4344526_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_002224291.1|4344966_4345452_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002216203.1|4345604_4346120_-|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	55.6	3.6e-28
WP_002210135.1|4346125_4346767_-	stringent starvation protein A	NA	NA	NA	NA	NA
WP_002230558.1|4346946_4347144_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002210133.1|4347140_4347533_-	30S ribosomal protein S9	NA	NA	NA	NA	NA
WP_002210132.1|4347547_4347976_-	50S ribosomal protein L13	NA	NA	NA	NA	NA
WP_002210131.1|4348289_4349417_-	cell division protein ZapE	NA	NA	NA	NA	NA
WP_002210130.1|4349640_4350045_+	DUF1043 family protein	NA	NA	NA	NA	NA
WP_002218066.1|4350315_4351689_+|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	28.2	7.4e-20
WP_002213775.1|4351805_4352264_-|transposase	IS200/IS605-like element IS1541B family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	8.5e-13
WP_002210128.1|4352489_4353578_+	outer membrane-stress sensor serine endopeptidase DegS	NA	A0A1B1IRD3	uncultured_Mediterranean_phage	31.8	2.1e-09
WP_002210127.1|4353758_4355021_-	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_002210126.1|4355174_4355429_-	BolA family iron metabolism protein IbaG	NA	NA	NA	NA	NA
WP_002210125.1|4355575_4355878_-	lipid asymmetry maintenance protein MlaB	NA	NA	NA	NA	NA
WP_002210124.1|4355913_4356537_-	phospholipid-binding protein MlaC	NA	NA	NA	NA	NA
WP_016595794.1|4356549_4357107_-	outer membrane lipid asymmetry maintenance protein MlaD	NA	NA	NA	NA	NA
WP_002210122.1|4357111_4357894_-	lipid asymmetry maintenance ABC transporter permease subunit MlaE	NA	NA	NA	NA	NA
WP_002210121.1|4358111_4358930_-	phospholipid ABC transporter ATP-binding protein MlaF	NA	G3M9Y6	Bacillus_virus	31.7	2.2e-19
WP_002210120.1|4359194_4360169_+	calcium/sodium antiporter	NA	NA	NA	NA	NA
WP_002210119.1|4360279_4361266_+	arabinose-5-phosphate isomerase KdsD	NA	A0A2P0VNK5	Tetraselmis_virus	30.8	6.0e-40
WP_002228203.1|4361514_4362078_+	3-deoxy-manno-octulosonate-8-phosphatase KdsC	NA	A0A140XBD6	Dickeya_phage	83.0	9.6e-59
WP_002218352.1|4362074_4362638_+	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_002210117.1|4362621_4363167_+	lipopolysaccharide ABC transporter substrate-binding protein LptA	NA	NA	NA	NA	NA
WP_002210116.1|4363173_4363899_+	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	1.4e-22
WP_002210115.1|4363960_4365394_+	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_002213952.1|4365822_4366305_+	PTS IIA-like nitrogen regulatory protein PtsN	NA	NA	NA	NA	NA
WP_002210113.1|4366610_4367465_+	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	30.0	3.2e-05
WP_002210112.1|4367461_4367734_+	PTS phosphocarrier protein NPr	NA	NA	NA	NA	NA
WP_002210111.1|4368071_4369007_+	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	38.5	1.5e-48
WP_002210110.1|4369018_4369483_+	aspartate carbamoyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_002210109.1|4369620_4370007_+	2-iminobutanoate/2-iminopropanoate deaminase	NA	NA	NA	NA	NA
WP_002210107.1|4370305_4370782_+	PliI family lysozyme inhibitor of I-type lysozyme	NA	NA	NA	NA	NA
WP_002210106.1|4371015_4371969_+	HTH-type transcriptional regulator TreR	NA	NA	NA	NA	NA
WP_002215779.1|4372379_4373795_+	PTS trehalose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_002210104.1|4373889_4375557_+	alpha,alpha-phosphotrehalase	NA	NA	NA	NA	NA
WP_002210103.1|4375909_4376320_+	nucleoside diphosphate kinase regulator	NA	NA	NA	NA	NA
WP_002210102.1|4376543_4376930_-	cytochrome b562	NA	NA	NA	NA	NA
WP_011055205.1|4377137_4377782_-	hypothetical protein	NA	A0A1B0VBK8	Salmonella_phage	49.0	3.4e-52
WP_002210100.1|4378030_4379371_-|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
>prophage 1
NC_005813	Yersinia pestis biovar Microtus str. 91001 plasmid pCD1, complete sequence	70159	44638	69110	70159	protease,transposase	Enterobacteria_phage(50.0%)	22	NA	NA
WP_116442925.1|44638_44884_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_002222515.1|45632_46052_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002213004.1|46756_47155_-	type III secretion system chaperone SycT	NA	NA	NA	NA	NA
WP_002213006.1|47154_48123_-|protease	T3SS effector cysteine protease YopT	protease	NA	NA	NA	NA
WP_002213007.1|48622_49171_+	type III secretion system effector YopK	NA	NA	NA	NA	NA
WP_002229770.1|49768_50398_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002220902.1|52409_53576_+	plasmid-partitioning protein SopA	NA	Q7Y3Y6	Yersinia_phage	85.3	3.5e-196
WP_002213354.1|53572_54538_+	ParB/RepB/Spo0J family plasmid partition protein	NA	Q7Y3Y7	Yersinia_phage	56.6	3.1e-89
WP_154020274.1|54697_54934_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002213357.1|55082_55256_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002224342.1|55799_56042_+	type II toxin-antitoxin system ParD family antitoxin	NA	NA	NA	NA	NA
WP_002213360.1|56034_56334_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_002229754.1|56473_57133_-	type III secretion system effector GTPase activator YopE	NA	NA	NA	NA	NA
WP_002213403.1|57326_57719_+	type III secretion system chaperone SycE/YerA	NA	NA	NA	NA	NA
WP_002220893.1|58528_59701_+|transposase	IS21 family transposase	transposase	U5N3F9	Enterobacteria_phage	95.4	1.6e-220
WP_002213267.1|60475_60901_+	type III secretion system chaperone SycH	NA	NA	NA	NA	NA
WP_086016640.1|61048_62148_-|transposase	IS3-like element ISYpe1 family transposase	transposase	S5WIU1	Leptospira_phage	38.5	1.4e-45
WP_002229829.1|62247_62577_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002224338.1|62715_63180_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002213258.1|63198_63750_-	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	80.3	5.9e-77
WP_002213256.1|63913_66229_+|transposase	Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	51.6	1.0e-279
WP_042469136.1|68840_69110_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 1
NC_005815	Yersinia pestis biovar Microtus str. 91001 plasmid pMT1, complete sequence	106642	0	72579	106642	tail,integrase,transposase,terminase	Salmonella_phage(88.06%)	72	66364:66381	79423:79440
WP_000255944.1|86_1109_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_001297096.1|1108_1888_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_002211769.1|2017_2626_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	62.2	4.8e-64
WP_002211770.1|2927_5816_-|tail	phage tail protein	tail	J9Q6E3	Salmonella_phage	33.1	4.5e-11
WP_002211771.1|5896_6475_-	DUF4376 domain-containing protein	NA	Q9LA61	Enterobacterial_phage	38.8	3.4e-27
WP_002214118.1|6531_11163_-	DUF1983 domain-containing protein	NA	J9Q713	Salmonella_phage	88.6	0.0e+00
WP_002211773.1|11184_11772_-|tail	tail assembly protein	tail	J9Q7F8	Salmonella_phage	92.8	5.1e-103
WP_002211774.1|11759_12557_-	C40 family peptidase	NA	J9Q7R4	Salmonella_phage	96.2	1.4e-156
WP_011901831.1|12549_13248_-|tail	phage minor tail protein L	tail	J9Q7Y5	Salmonella_phage	99.6	6.4e-137
WP_000440566.1|13337_13673_-|tail	phage tail protein	tail	J9Q6E1	Salmonella_phage	97.3	5.7e-59
WP_011172025.1|13714_17956_-	tape measure protein	NA	J9Q712	Salmonella_phage	84.0	0.0e+00
WP_000952684.1|17963_18188_-	hypothetical protein	NA	J9Q7F7	Salmonella_phage	100.0	4.2e-34
WP_000163862.1|18313_18631_-	hypothetical protein	NA	J9Q7R3	Salmonella_phage	98.1	6.0e-50
WP_002211778.1|18690_19437_-	Ig domain-containing protein	NA	J9Q7Y4	Salmonella_phage	98.8	5.2e-129
WP_002211779.1|19511_19895_-	hypothetical protein	NA	J9Q6D8	Salmonella_phage	98.4	1.1e-66
WP_002211780.1|19896_20370_-	hypothetical protein	NA	J9Q711	Salmonella_phage	99.4	8.9e-82
WP_001027662.1|20360_20705_-	hypothetical protein	NA	J9Q7F6	Salmonella_phage	100.0	1.9e-57
WP_002211781.1|20802_21636_-	hypothetical protein	NA	J9Q7R2	Salmonella_phage	99.6	2.9e-152
WP_002211782.1|21635_22070_-	hypothetical protein	NA	J9Q7Y3	Salmonella_phage	99.3	3.1e-73
WP_002211783.1|22113_22776_-	Ig domain-containing protein	NA	J9Q6D6	Salmonella_phage	97.2	8.5e-107
WP_002211784.1|22850_23726_-	hypothetical protein	NA	J9Q710	Salmonella_phage	99.7	8.5e-163
WP_002231160.1|23752_24649_-	hypothetical protein	NA	J9Q7F4	Salmonella_phage	96.3	3.9e-147
WP_025476523.1|24671_26246_-	hypothetical protein	NA	J9Q7R1	Salmonella_phage	99.0	2.1e-300
WP_002211787.1|26279_27536_-|terminase	terminase	terminase	J9Q7Y2	Salmonella_phage	100.0	1.8e-251
WP_011172027.1|27538_28180_-	hypothetical protein	NA	J9Q6D4	Salmonella_phage	97.7	3.4e-108
WP_000176291.1|28375_28642_-	hypothetical protein	NA	J9Q757	Salmonella_phage	100.0	1.3e-42
WP_002211789.1|28651_29542_-	hypothetical protein	NA	J9Q7I6	Salmonella_phage	99.7	6.2e-169
WP_002211790.1|29547_29802_-	hypothetical protein	NA	J9Q7U0	Salmonella_phage	97.6	2.0e-40
WP_002211791.1|29794_30433_-	ATP-binding cassette domain-containing protein	NA	J9Q807	Salmonella_phage	98.1	4.7e-110
WP_002211792.1|30429_31098_-	ParB N-terminal domain-containing protein	NA	J9Q6L1	Salmonella_phage	98.2	9.5e-114
WP_002228791.1|31097_31796_-	ParB N-terminal domain-containing protein	NA	J9Q756	Salmonella_phage	98.7	9.6e-125
WP_002211794.1|31860_33420_+	DEAD/DEAH box helicase	NA	J9Q7I4	Salmonella_phage	99.0	1.1e-293
WP_002214131.1|33422_33701_+	hypothetical protein	NA	J9Q7T9	Salmonella_phage	97.8	4.4e-41
WP_002211796.1|33760_34183_+	hypothetical protein	NA	J9Q806	Salmonella_phage	85.0	4.1e-62
WP_002214134.1|34187_34715_+	transcriptional regulator	NA	J9Q6L0	Salmonella_phage	98.0	6.4e-81
WP_002211799.1|35038_35689_+	hypothetical protein	NA	J9Q754	Salmonella_phage	99.5	4.1e-114
WP_002214137.1|35773_36001_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002211801.1|36638_37121_-	hypothetical protein	NA	J9Q805	Salmonella_phage	94.4	5.1e-85
WP_002211802.1|37326_37608_-	hypothetical protein	NA	J9Q753	Salmonella_phage	93.5	6.1e-46
WP_002213775.1|37807_38266_-|transposase	IS200/IS605-like element IS1541B family transposase	transposase	D9CGB6	Hyperthermophilic_Archaeal_Virus_2	35.3	5.0e-13
WP_002231164.1|39457_40600_-	ribonucleotide-diphosphate reductase subunit beta	NA	J9Q7H3	Salmonella_phage	100.0	1.7e-219
WP_011172033.1|40707_43023_-	ribonucleoside-diphosphate reductase subunit alpha	NA	J9Q7T0	Salmonella_phage	98.2	0.0e+00
WP_002214145.1|43100_43670_-	hypothetical protein	NA	J9Q7Z7	Salmonella_phage	100.0	5.8e-104
WP_002213303.1|43682_44429_-	hypothetical protein	NA	J9Q6J5	Salmonella_phage	96.4	4.1e-134
WP_002214148.1|44418_46335_-	AAA family ATPase	NA	J9Q741	Salmonella_phage	98.6	0.0e+00
WP_002213300.1|46564_47650_-	metallophosphoesterase	NA	J9Q7S9	Salmonella_phage	98.6	7.7e-206
WP_002213298.1|48065_49088_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002389821.1|49447_49672_-	hypothetical protein	NA	J9Q739	Salmonella_phage	97.3	1.5e-34
WP_002214164.1|50856_51921_+	replication protein RepA	NA	J9Q7H0	Salmonella_phage	98.6	2.4e-188
WP_002222711.1|52489_52702_-	hypothetical protein	NA	J9Q7S8	Salmonella_phage	95.7	6.8e-34
WP_002227818.1|52701_53037_-	hypothetical protein	NA	J9Q7Z5	Salmonella_phage	91.0	5.2e-52
WP_002228796.1|53033_53213_-	hypothetical protein	NA	J9Q6J1	Salmonella_phage	86.4	5.8e-18
WP_002228797.1|53253_53529_-	hypothetical protein	NA	J9Q738	Salmonella_phage	95.6	1.7e-45
WP_002222869.1|53596_54007_-	hypothetical protein	NA	J9Q7G9	Salmonella_phage	97.8	4.1e-75
WP_002222868.1|53990_54362_-	DUF2591 domain-containing protein	NA	J9Q7S7	Salmonella_phage	87.8	4.0e-61
WP_002222866.1|54515_55346_-	hypothetical protein	NA	J9Q7Z4	Salmonella_phage	98.6	9.3e-127
WP_002213439.1|55349_55550_-	hypothetical protein	NA	J9Q6J0	Salmonella_phage	97.0	1.1e-25
WP_000920226.1|56719_56986_-	hypothetical protein	NA	J9Q7G8	Salmonella_phage	100.0	1.6e-40
WP_002225551.1|56985_57930_-	exonuclease	NA	J9Q7S6	Salmonella_phage	99.0	1.3e-180
WP_002213132.1|57990_59019_-	hypothetical protein	NA	J9Q7Z3	Salmonella_phage	98.5	1.3e-165
WP_002213135.1|59138_59570_-	hypothetical protein	NA	J9Q6I8	Salmonella_phage	98.6	2.6e-72
WP_002215095.1|59790_60042_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002213141.1|60114_60678_+	DNA-binding protein	NA	J9Q7G7	Salmonella_phage	64.6	2.2e-63
WP_002425587.1|60707_61133_-	hypothetical protein	NA	J9Q7S4	Salmonella_phage	100.0	7.5e-72
WP_000255944.1|62061_63084_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_001297096.1|63083_63863_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_002231173.1|63913_66631_-	DNA polymerase III subunit alpha	NA	J9Q7Z2	Salmonella_phage	99.4	0.0e+00
66364:66381	attL	CCAATGATTCCATACATC	NA	NA	NA	NA
WP_002211767.1|66811_68047_-	AAA family ATPase	NA	J9Q733	Salmonella_phage	99.3	3.0e-238
WP_002211766.1|68143_70510_-	porphyrin biosynthesis protein	NA	J9Q7G6	Salmonella_phage	94.4	0.0e+00
WP_002228800.1|70619_70832_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002228802.1|71094_71481_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002353208.1|71475_72579_-|integrase	site-specific integrase	integrase	A0A1P8DTG6	Proteus_phage	30.9	5.2e-24
79423:79440	attR	GATGTATGGAATCATTGG	NA	NA	NA	NA
>prophage 2
NC_005815	Yersinia pestis biovar Microtus str. 91001 plasmid pMT1, complete sequence	106642	78982	97568	106642	transposase	Salmonella_phage(40.0%)	23	NA	NA
WP_002224363.1|78982_79288_-	hypothetical protein	NA	J9Q7S1	Salmonella_phage	97.0	3.2e-48
WP_002225462.1|79284_79437_-	hypothetical protein	NA	J9Q7Z1	Salmonella_phage	96.0	2.0e-19
WP_002224361.1|79433_79649_-	hypothetical protein	NA	J9Q6I3	Salmonella_phage	98.6	7.7e-33
WP_002231172.1|79808_81131_-	DNA ligase	NA	J9Q7G5	Salmonella_phage	99.1	1.6e-258
WP_002231171.1|81165_81642_-	hypothetical protein	NA	J9Q7R9	Salmonella_phage	96.2	1.3e-77
WP_002231170.1|81723_81966_-	hypothetical protein	NA	J9Q7Z0	Salmonella_phage	98.4	2.0e-29
WP_001297096.1|81981_82761_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_000255944.1|82760_83783_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_002211744.1|83906_85916_-	ParB/RepB/Spo0J family partition protein	NA	G8DH78	Emiliania_huxleyi_virus	30.3	7.7e-26
WP_002211745.1|85988_86219_-	DUF905 domain-containing protein	NA	NA	NA	NA	NA
WP_002211746.1|87007_87514_-	antirestriction protein ArdA	NA	A0A1I9S7Y0	Rhodococcus_phage	29.5	1.1e-08
WP_002211747.1|87912_88692_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002215082.1|88745_89165_-	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
WP_002211748.1|89175_89397_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002211749.1|89396_90074_-	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.9	1.6e-28
WP_002211750.1|90574_90775_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002228775.1|90936_92334_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_002215070.1|92712_93684_-	ParB/RepB/Spo0J family partition protein	NA	Q1MVJ4	Enterobacteria_phage	67.3	1.5e-112
WP_002211752.1|93680_94886_-	AAA family ATPase	NA	Q1MVJ3	Enterobacteria_phage	90.5	1.7e-206
WP_002211753.1|95187_95415_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_002215068.1|95414_95741_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_002211754.1|95940_96561_+	recombinase family protein	NA	A0A1V0E035	Clostridioides_phage	31.1	6.5e-08
WP_002215065.1|96626_97568_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	54.8	1.0e-68
>prophage 3
NC_005815	Yersinia pestis biovar Microtus str. 91001 plasmid pMT1, complete sequence	106642	103817	105026	106642	transposase	uncultured_virus(100.0%)	1	NA	NA
WP_002209743.1|103817_105026_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	50.8	5.4e-51
