The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_006087	Leifsonia xyli subsp. xyli str. CTCB07, complete sequence	2584158	358428	400724	2584158	tail,transposase,portal,integrase	Microbacterium_phage(21.43%)	46	350399:350414	388624:388639
350399:350414	attL	CCGCCGCCGCATCCGG	NA	NA	NA	NA
WP_011185149.1|358428_359733_-|integrase	site-specific integrase	integrase	G8IR34	Mycobacterium_virus	38.2	3.0e-63
WP_011185375.1|361077_362058_-	metallophosphoesterase	NA	NA	NA	NA	NA
WP_011185376.1|362054_364613_-	transglycosylase domain-containing protein	NA	NA	NA	NA	NA
WP_011185377.1|364685_364853_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011185378.1|364852_365323_+	RidA family protein	NA	M1I5B0	Acanthocystis_turfacea_Chlorella_virus	36.5	1.0e-13
WP_141692896.1|366207_366693_-	hypothetical protein	NA	NA	NA	NA	NA
WP_141692897.1|369575_370532_+	Flp pilus assembly complex ATPase component TadA	NA	NA	NA	NA	NA
WP_155806755.1|370528_370669_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041767000.1|370833_371061_+	hypothetical protein	NA	NA	NA	NA	NA
WP_176714805.1|372663_373827_-	cutinase family protein	NA	NA	NA	NA	NA
WP_155806756.1|374464_374932_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081423054.1|375853_376087_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011185382.1|376711_377821_+|transposase	IS110-like element ISLxx2 family transposase	transposase	NA	NA	NA	NA
WP_011186130.1|377903_378140_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_083219768.1|378113_378356_-	HigA family addiction module antidote protein	NA	NA	NA	NA	NA
WP_192807309.1|378339_378660_-	hypothetical protein	NA	NA	NA	NA	NA
WP_141692898.1|378864_379317_-	hypothetical protein	NA	NA	NA	NA	NA
WP_141692899.1|379313_379604_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041767008.1|379734_380124_-	hypothetical protein	NA	A0A222Z9H8	Arthrobacter_phage	42.9	4.5e-07
WP_041767010.1|380359_380566_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011185385.1|380599_381547_-	glycoside hydrolase family 25 protein	NA	NA	NA	NA	NA
WP_141692900.1|381557_381953_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041767016.1|382570_382762_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011185387.1|382999_383269_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041767020.1|383268_384378_-	hypothetical protein	NA	A6N209	Microbacterium_phage	26.5	4.1e-13
WP_041767022.1|385674_386214_-|tail	phage tail family protein	tail	NA	NA	NA	NA
WP_011185389.1|386200_386503_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011185390.1|386502_388065_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011185391.1|388106_389075_-	tape measure protein	NA	A6N208	Microbacterium_phage	54.5	1.4e-60
388624:388639	attR	CCGGATGCGGCGGCGG	NA	NA	NA	NA
WP_041767025.1|389112_389466_+	hypothetical protein	NA	A0A1D8ETF1	Propionibacterium_phage	57.6	4.1e-15
WP_011185392.1|389462_389849_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041767028.1|389915_390107_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011185393.1|390182_390878_-	hypothetical protein	NA	A0A2R4A127	Microbacterium_phage	38.8	9.8e-29
WP_041767031.1|390986_391421_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011185394.1|391741_392080_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041767034.1|392076_392454_-	hypothetical protein	NA	NA	NA	NA	NA
WP_141692843.1|392470_392782_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041767039.1|392793_393723_-	hypothetical protein	NA	A0A142K8P8	Gordonia_phage	63.2	1.5e-101
WP_011185397.1|393750_394119_-	DUF2190 family protein	NA	NA	NA	NA	NA
WP_011185398.1|394140_394698_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041767042.1|394880_395363_-	hypothetical protein	NA	A0A1D8ETP7	Propionibacterium_phage	37.0	2.2e-19
WP_081423057.1|395409_396180_-|portal	phage portal protein	portal	A0A220NQP2	Corynebacterium_phage	49.3	5.0e-58
WP_011185401.1|396179_396866_-|portal	phage portal protein	portal	A0A1J0MDH9	Mycobacterium_phage	43.2	1.2e-23
WP_011185523.1|397084_397894_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	42.3	5.3e-50
WP_011185402.1|399502_400588_-	hypothetical protein	NA	A0A1D8ETI8	Propionibacterium_phage	53.8	1.2e-97
WP_050737980.1|400541_400724_-	hypothetical protein	NA	A0A088FQ67	Mycobacterium_phage	56.4	6.7e-06
>prophage 2
NC_006087	Leifsonia xyli subsp. xyli str. CTCB07, complete sequence	2584158	728026	796277	2584158	tRNA,protease,transposase	Gordonia_phage(18.18%)	58	NA	NA
WP_041768170.1|728026_728929_+|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	NA	NA	NA	NA
WP_041767240.1|728960_729329_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011185654.1|729373_729856_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011185655.1|729852_730797_+	bifunctional riboflavin kinase/FAD synthetase	NA	NA	NA	NA	NA
WP_041767243.1|734531_735389_+	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_011185658.1|735477_736443_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_050737837.1|737445_737931_+	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_050737838.1|737940_738288_+	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_011185659.1|738284_738791_+	pyridoxamine 5'-phosphate oxidase family protein	NA	NA	NA	NA	NA
WP_041767245.1|738860_739445_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011185661.1|739509_740037_-	O-acetyl-ADP-ribose deacetylase	NA	A0A0K1L687	Scale_drop_disease_virus	43.0	1.3e-20
WP_011185662.1|740038_740317_-	metal-sensitive transcriptional regulator	NA	NA	NA	NA	NA
WP_011185663.1|740375_740600_+	heavy-metal-associated domain-containing protein	NA	NA	NA	NA	NA
WP_050737988.1|740641_742729_+	cadmium-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	30.4	6.5e-60
WP_083219756.1|742880_743441_+	recombinase family protein	NA	NA	NA	NA	NA
WP_041767247.1|743796_745521_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011185667.1|745657_745906_-	glutaredoxin family protein	NA	NA	NA	NA	NA
WP_041767249.1|746119_746335_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041767251.1|746382_746712_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081423076.1|747515_747746_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011185669.1|748682_750848_+	DEAD/DEAH box helicase	NA	A0A1W6DX52	Sphingobium_phage	25.2	1.1e-25
WP_041767253.1|750963_751149_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041768177.1|751190_751817_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_011185671.1|751825_753016_-	sensor histidine kinase	NA	NA	NA	NA	NA
WP_041767255.1|753158_753785_+	CYTH domain-containing protein	NA	NA	NA	NA	NA
WP_041767257.1|753982_755011_+	6-phosphofructokinase	NA	H8ZJH0	Ostreococcus_tauri_virus	29.9	6.3e-08
WP_041768179.1|755053_756013_+	NADP-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_176714743.1|759115_761083_-	amino acid transporter	NA	NA	NA	NA	NA
WP_176714742.1|762244_762316_-	ribonucleotide-diphosphate reductase subunit beta	NA	NA	NA	NA	NA
WP_155806775.1|762712_762865_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041767261.1|762861_763251_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011185681.1|763247_763502_-	hypothetical protein	NA	NA	NA	NA	NA
WP_141692777.1|763909_764536_+	hypothetical protein	NA	NA	NA	NA	NA
WP_141692776.1|764547_764760_+	hypothetical protein	NA	NA	NA	NA	NA
WP_192807314.1|764817_765384_+	PrgI family protein	NA	NA	NA	NA	NA
WP_041768183.1|765380_767606_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050737840.1|767602_769723_+	type IV secretory system conjugative DNA transfer family protein	NA	NA	NA	NA	NA
WP_041767267.1|770089_770557_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041767269.1|770976_771243_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050737841.1|771330_772890_-	relaxase/mobilization nuclease domain-containing protein	NA	A0A1B0RXG0	Streptococcus_phage	45.9	7.4e-08
WP_176714741.1|772908_773370_-	relaxase/mobilization nuclease domain-containing protein	NA	NA	NA	NA	NA
WP_176714740.1|773427_773775_-	plasmid mobilization relaxosome protein MobC	NA	NA	NA	NA	NA
WP_176714739.1|774093_774579_+|transposase	IS3 family transposase	transposase	A0A1B3AZE5	Gordonia_phage	63.5	1.6e-46
WP_081423081.1|774580_774997_+|transposase	transposase	transposase	A0A1B3AZE5	Gordonia_phage	75.2	2.3e-57
WP_081423193.1|775377_776277_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081423194.1|778201_779638_+	polygalacturonase	NA	NA	NA	NA	NA
WP_011185689.1|780191_780614_+	Hsp20/alpha crystallin family protein	NA	NA	NA	NA	NA
WP_011185157.1|781176_782388_+|transposase	IS30-like element ISLxx5 family transposase	transposase	W5R8L2	Staphylococcus_phage	36.1	1.1e-40
WP_141692775.1|782680_783271_+	hypothetical protein	NA	NA	NA	NA	NA
WP_192807315.1|783258_783435_+	hypothetical protein	NA	NA	NA	NA	NA
WP_141692774.1|785175_785571_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083219751.1|786214_786949_-	lysozyme	NA	NA	NA	NA	NA
WP_141692774.1|787843_788239_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011185693.1|791453_792854_+	trigger factor	NA	NA	NA	NA	NA
WP_011185694.1|792927_793413_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_011185695.1|793535_794129_+|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	52.9	4.6e-43
WP_011185696.1|794170_794842_+|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	48.5	1.1e-40
WP_011185697.1|795002_796277_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	59.0	5.8e-136
>prophage 3
NC_006087	Leifsonia xyli subsp. xyli str. CTCB07, complete sequence	2584158	1351121	1416584	2584158	holin,tRNA,protease,integrase,transposase	Anomala_cuprea_entomopoxvirus(16.67%)	57	1346450:1346465	1410778:1410793
1346450:1346465	attL	GCGAGACGCCCTCCCC	NA	NA	NA	NA
WP_141692928.1|1351121_1351727_+|transposase	IS3 family transposase	transposase	A0A1B3AZE5	Gordonia_phage	41.5	1.6e-19
WP_011185382.1|1352016_1353126_+|transposase	IS110-like element ISLxx2 family transposase	transposase	NA	NA	NA	NA
WP_011186130.1|1353208_1353445_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_141692929.1|1353492_1353717_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041767536.1|1353952_1354501_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011186132.1|1354497_1355637_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_011186133.1|1355651_1356206_-	HAD family hydrolase	NA	NA	NA	NA	NA
WP_011186136.1|1358119_1359328_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A159B6R2	Tsukamurella_phage	32.2	1.1e-35
WP_011186137.1|1359320_1359521_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_011186138.1|1359870_1360812_-	NAD(P)/FAD-dependent oxidoreductase	NA	A0A1V0SIN1	Klosneuvirus	21.3	2.0e-08
WP_041767537.1|1360816_1362331_-|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_011186140.1|1362359_1363145_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_011186143.1|1364221_1365355_-	branched-chain amino acid aminotransferase	NA	NA	NA	NA	NA
WP_011186144.1|1365377_1366451_-	3-isopropylmalate dehydrogenase	NA	NA	NA	NA	NA
WP_155806800.1|1366510_1366684_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011186145.1|1366823_1368416_-	phosphoglycerate dehydrogenase	NA	A0A1J0F959	Only_Syngen_Nebraska_virus	30.9	3.2e-27
WP_011186148.1|1369391_1370420_-	ketol-acid reductoisomerase	NA	NA	NA	NA	NA
WP_011186149.1|1370483_1370993_-	acetolactate synthase small subunit	NA	NA	NA	NA	NA
WP_011186150.1|1370996_1372817_-	acetolactate synthase large subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	30.5	1.8e-58
WP_011186151.1|1372874_1374569_-	dihydroxy-acid dehydratase	NA	NA	NA	NA	NA
WP_011186152.1|1374667_1375471_-	trehalose-phosphatase	NA	NA	NA	NA	NA
WP_176714825.1|1375507_1377031_-	alpha,alpha-trehalose-phosphate synthase (UDP-forming)	NA	NA	NA	NA	NA
WP_081423103.1|1377454_1378204_-	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
WP_041767538.1|1378295_1379450_-	arsenic transporter	NA	NA	NA	NA	NA
WP_041767539.1|1379541_1379730_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050737871.1|1379836_1380271_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011186157.1|1381714_1383490_+	glycoside hydrolase family 15 protein	NA	NA	NA	NA	NA
WP_011186158.1|1383489_1383783_+|protease	ATP-dependent Clp protease adapter ClpS	protease	NA	NA	NA	NA
WP_011186159.1|1383779_1384283_+	DUF2017 domain-containing protein	NA	NA	NA	NA	NA
WP_050737872.1|1385129_1386386_-	ROK family protein	NA	NA	NA	NA	NA
WP_050737873.1|1388772_1389342_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011186162.1|1389365_1389569_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011186163.1|1390283_1391063_+	histidinol-phosphatase	NA	NA	NA	NA	NA
WP_011186164.1|1391069_1391438_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_050737993.1|1391590_1392466_+	ATP-binding cassette domain-containing protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	31.6	7.8e-23
WP_011186166.1|1392467_1393709_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_011186167.1|1394358_1395381_+	adenosine deaminase	NA	NA	NA	NA	NA
WP_011186168.1|1395456_1396902_+	APC family permease	NA	NA	NA	NA	NA
WP_011186169.1|1396912_1398682_-	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.9	2.1e-51
WP_141692791.1|1401249_1401885_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041767543.1|1401944_1402685_-	tyrosine-protein phosphatase	NA	NA	NA	NA	NA
WP_011186173.1|1402688_1403165_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	52.3	6.0e-38
WP_011186174.1|1403238_1404144_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_011186175.1|1404140_1405202_-	cell division ATP-binding protein FtsE	NA	G9BWD6	Planktothrix_phage	38.2	2.2e-27
WP_011186176.1|1405293_1406412_-	peptide chain release factor 2	NA	NA	NA	NA	NA
WP_192807293.1|1406864_1407026_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041767544.1|1407159_1407747_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050737874.1|1407828_1408095_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050737875.1|1408450_1409164_+	VTT domain-containing protein	NA	NA	NA	NA	NA
WP_011186180.1|1409168_1409768_-	RdgB/HAM1 family non-canonical purine NTP pyrophosphatase	NA	NA	NA	NA	NA
WP_011186181.1|1409767_1410523_-	ribonuclease PH	NA	NA	NA	NA	NA
WP_011186182.1|1410565_1411384_-	glutamate racemase	NA	NA	NA	NA	NA
1410778:1410793	attR	GCGAGACGCCCTCCCC	NA	NA	NA	NA
WP_011186183.1|1411418_1412729_+	nicotinate phosphoribosyltransferase	NA	G3MA18	Bacillus_virus	37.4	2.3e-55
WP_041767545.1|1412736_1413015_-	DUF3039 domain-containing protein	NA	A0A2R4A1S7	Microbacterium_phage	48.5	9.3e-15
WP_011186185.1|1413045_1414572_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041767546.1|1414583_1415576_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	26.0	1.7e-18
WP_041768316.1|1415891_1416584_+|holin	phosphocholine cytidylyltransferase family protein	holin	NA	NA	NA	NA
>prophage 4
NC_006087	Leifsonia xyli subsp. xyli str. CTCB07, complete sequence	2584158	1425681	1487209	2584158	transposase,protease,tRNA,integrase	Planktothrix_phage(22.22%)	53	1414132:1414151	1467211:1467230
1414132:1414151	attL	CGCCGCCGCCGCGACGCGGG	NA	NA	NA	NA
WP_011185157.1|1425681_1426893_-|transposase	IS30-like element ISLxx5 family transposase	transposase	W5R8L2	Staphylococcus_phage	36.1	1.1e-40
WP_155806802.1|1427604_1427778_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081423054.1|1427774_1428008_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011185382.1|1428632_1429742_+|transposase	IS110-like element ISLxx2 family transposase	transposase	NA	NA	NA	NA
WP_011186888.1|1429809_1430388_-|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_011186196.1|1430600_1430738_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041767551.1|1430772_1431573_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	35.1	3.4e-33
WP_041767552.1|1431569_1433243_-|transposase	IS21-like element ISLxx3 family transposase	transposase	NA	NA	NA	NA
WP_081423107.1|1434412_1434589_-	Hin recombinase	NA	NA	NA	NA	NA
WP_141692793.1|1434826_1435714_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011186199.1|1436635_1437826_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_011186204.1|1440445_1440862_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_176714754.1|1441495_1441651_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011186206.1|1441643_1442000_+	ribbon-helix-helix protein, CopG family	NA	NA	NA	NA	NA
WP_176714755.1|1442292_1442958_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_041767555.1|1443142_1443880_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081423110.1|1445541_1445823_+	Ig-like domain-containing protein	NA	NA	NA	NA	NA
WP_011186209.1|1446030_1446579_+	exosortase R	NA	NA	NA	NA	NA
WP_011186210.1|1446575_1447925_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_041767556.1|1448201_1449251_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011186212.1|1449433_1450852_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_050737879.1|1451175_1452291_-	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAI1	Catovirus	27.6	1.8e-32
WP_141692794.1|1452493_1452823_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_083219755.1|1452803_1453436_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_011186216.1|1453729_1454797_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_050737880.1|1454803_1455892_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.7	1.3e-22
WP_141692797.1|1455969_1457556_+	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_011186218.1|1457552_1458446_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155806803.1|1458442_1458604_+	hypothetical protein	NA	NA	NA	NA	NA
WP_141692796.1|1458636_1459311_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_011186220.1|1459307_1460312_+	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_011186221.1|1460419_1461286_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011186222.1|1461867_1462212_+	Lsr2 family protein	NA	A0A2R4A0B2	Microbacterium_phage	52.1	2.0e-06
WP_011186223.1|1462765_1463389_-	oligoribonuclease	NA	A0A1B3B0T8	Gordonia_phage	32.8	1.7e-19
WP_041768337.1|1463399_1464239_-	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
WP_011186225.1|1464331_1464631_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_041767560.1|1465023_1465776_+	hypothetical protein	NA	A0A2L1IVL5	Streptomyces_phage	60.6	9.9e-27
WP_041767561.1|1465833_1466037_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081423114.1|1466036_1466390_+	metallopeptidase family protein	NA	NA	NA	NA	NA
WP_011186229.1|1466652_1467276_-	hypothetical protein	NA	NA	NA	NA	NA
1467211:1467230	attR	CGCCGCCGCCGCGACGCGGG	NA	NA	NA	NA
WP_041767563.1|1467259_1468039_-	energy-coupling factor transporter transmembrane protein EcfT	NA	NA	NA	NA	NA
WP_176714757.1|1468035_1469463_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	30.5	1.2e-09
WP_011186232.1|1469558_1470173_-	ECF transporter S component	NA	NA	NA	NA	NA
WP_050737881.1|1470385_1470679_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011186234.1|1470784_1471702_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_041767564.1|1471739_1473014_-	DNA polymerase IV	NA	NA	NA	NA	NA
WP_041767565.1|1475856_1476393_-	DUF1697 domain-containing protein	NA	NA	NA	NA	NA
WP_011186239.1|1478637_1480137_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB	tRNA	NA	NA	NA	NA
WP_011186240.1|1480136_1481684_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA	tRNA	NA	NA	NA	NA
WP_011186241.1|1481701_1481998_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC	tRNA	NA	NA	NA	NA
WP_011186242.1|1482250_1483606_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011186243.1|1483760_1486028_-	NAD-dependent DNA ligase LigA	NA	A0A0A8J9A9	Ralstonia_phage	33.2	4.2e-89
WP_011186244.1|1486108_1487209_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
>prophage 5
NC_006087	Leifsonia xyli subsp. xyli str. CTCB07, complete sequence	2584158	2208129	2216038	2584158	tRNA,protease	Pandoravirus(50.0%)	9	NA	NA
WP_011186823.1|2208129_2208666_-	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	S4W084	Pandoravirus	35.6	4.2e-11
WP_176714810.1|2208662_2209073_-	dihydroneopterin aldolase	NA	NA	NA	NA	NA
WP_176714817.1|2209026_2209827_-	dihydropteroate synthase	NA	S4VNV0	Pandoravirus	32.5	3.9e-21
WP_011186826.1|2209835_2210411_-	GTP cyclohydrolase I FolE	NA	S4VV34	Pandoravirus	43.9	1.9e-30
WP_011186827.1|2210422_2212426_-|protease	ATP-dependent zinc metalloprotease FtsH	protease	G8DDJ2	Micromonas_pusilla_virus	44.7	1.2e-108
WP_011186828.1|2212510_2213062_-	hypoxanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_041767803.1|2213078_2214155_-|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_011186830.1|2214208_2214700_+	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	51.0	2.6e-36
WP_041767805.1|2214763_2216038_-	C40 family peptidase	NA	A0A1J0GW44	Streptomyces_phage	44.2	1.9e-14
>prophage 6
NC_006087	Leifsonia xyli subsp. xyli str. CTCB07, complete sequence	2584158	2305208	2323864	2584158	transposase	Gordonia_phage(33.33%)	19	NA	NA
WP_076611640.1|2305208_2306087_+|transposase	IS5-like element ISLxx6 family transposase	transposase	NA	NA	NA	NA
WP_050737938.1|2306096_2306708_-|transposase	IS3 family transposase	transposase	A0A1B3AZE5	Gordonia_phage	77.0	1.3e-80
WP_011186891.1|2308416_2308794_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041767850.1|2310053_2310341_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011185382.1|2310938_2312048_-|transposase	IS110-like element ISLxx2 family transposase	transposase	NA	NA	NA	NA
WP_011186894.1|2312600_2312822_+	cold-shock protein	NA	A0A2I7QP13	Vibrio_phage	49.2	5.7e-07
WP_050737939.1|2314186_2314858_+|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_176714799.1|2314818_2314929_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155806824.1|2314948_2315116_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050737940.1|2315529_2316171_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_011186898.1|2317087_2318053_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_011186899.1|2318198_2318546_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041768556.1|2318706_2319570_+	DMT family transporter	NA	NA	NA	NA	NA
WP_011186901.1|2319903_2320344_-	universal stress protein	NA	NA	NA	NA	NA
WP_141692887.1|2320634_2321258_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_068981872.1|2321441_2321750_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050737942.1|2321774_2321969_+	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_141692886.1|2322155_2322407_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011185157.1|2322652_2323864_+|transposase	IS30-like element ISLxx5 family transposase	transposase	W5R8L2	Staphylococcus_phage	36.1	1.1e-40
>prophage 7
NC_006087	Leifsonia xyli subsp. xyli str. CTCB07, complete sequence	2584158	2448341	2473857	2584158	tail,capsid,portal,head,protease,integrase	Gordonia_phage(16.67%)	42	2444096:2444114	2454687:2454705
2444096:2444114	attL	AGATCCGCGGCGACGGCGG	NA	NA	NA	NA
WP_081423170.1|2448341_2448911_+|integrase	site-specific integrase	integrase	A0A2K9VH95	Gordonia_phage	43.6	1.1e-25
WP_081423171.1|2448949_2449321_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A1W6JQ88	Corynebacterium_phage	47.5	3.1e-13
WP_141692866.1|2449330_2449702_-	hypothetical protein	NA	NA	NA	NA	NA
WP_068981862.1|2449823_2450027_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155806828.1|2450023_2450245_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_141692865.1|2450708_2450987_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050737961.1|2451126_2451393_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_141692873.1|2451511_2451730_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_041767331.1|2451924_2452188_-	hypothetical protein	NA	NA	NA	NA	NA
WP_141692864.1|2452165_2452480_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041767901.1|2453134_2453371_+	hypothetical protein	NA	NA	NA	NA	NA
WP_141692872.1|2453435_2454203_+	phage antirepressor KilAC domain-containing protein	NA	A6N1W8	Microbacterium_phage	49.0	3.3e-54
WP_155806829.1|2454735_2454900_+	hypothetical protein	NA	NA	NA	NA	NA
2454687:2454705	attR	AGATCCGCGGCGACGGCGG	NA	NA	NA	NA
WP_041767903.1|2454896_2455217_+	hypothetical protein	NA	NA	NA	NA	NA
WP_141692863.1|2455499_2456435_+	YqaJ viral recombinase family protein	NA	Q0H280	Geobacillus_phage	28.4	1.8e-17
WP_192807303.1|2456461_2457241_+	recombinase RecT	NA	A0A0U4K896	Arthrobacter_phage	28.6	5.0e-13
WP_050737962.1|2457237_2457669_+	hypothetical protein	NA	A0A0U4KB50	Arthrobacter_phage	35.9	7.2e-06
WP_011187009.1|2457665_2458004_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041767906.1|2458000_2459113_+	site-specific DNA-methyltransferase	NA	A0A2D1G604	Mycobacterium_phage	51.5	2.6e-116
WP_041767907.1|2459109_2459532_+	hypothetical protein	NA	NA	NA	NA	NA
WP_192807304.1|2459528_2460320_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011187012.1|2460316_2460535_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155806831.1|2460608_2460791_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011185404.1|2460781_2460970_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041767911.1|2460981_2461392_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011187014.1|2461388_2462090_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050737963.1|2462817_2463129_+	hypothetical protein	NA	NA	NA	NA	NA
WP_141692861.1|2463097_2464558_+	hypothetical protein	NA	A0A1B3AZV7	Gordonia_phage	41.7	1.8e-88
WP_155806832.1|2464567_2464714_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011187018.1|2464710_2465955_+|portal	phage portal protein	portal	G1D3P6	Mycobacterium_virus	36.0	2.1e-53
WP_050737964.1|2465941_2466658_+|head,protease	HK97 family phage prohead protease	head,protease	A0A0F7L115	uncultured_marine_virus	39.7	2.8e-23
WP_041767915.1|2466831_2468133_+|capsid	phage major capsid protein	capsid	S5VVT7	Mycobacterium_phage	38.6	9.0e-68
WP_011187021.1|2468210_2468384_+	hypothetical protein	NA	NA	NA	NA	NA
WP_141692860.1|2468420_2469017_+|head,tail	phage gp6-like head-tail connector protein	head,tail	NA	NA	NA	NA
WP_041767917.1|2469013_2469478_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011187023.1|2469489_2469687_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011187024.1|2469683_2470682_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041767919.1|2470800_2471151_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011187026.1|2471151_2471451_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011187028.1|2471604_2471793_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011187029.1|2471779_2473006_+	hypothetical protein	NA	K7RVY9	Vibrio_phage	25.3	7.8e-05
WP_141692859.1|2472993_2473857_+|tail	phage tail family protein	tail	NA	NA	NA	NA
