The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 2
NC_004431	Escherichia coli CFT073, complete sequence	5231428	909331	981561	5231428	head,terminase,capsid,portal,protease,tail,integrase,tRNA,plate,lysis	Salmonella_phage(70.83%)	81	908857:908883	942338:942364
908857:908883	attL	ATAAATTTCAGGCAACAAAAAACCCAT	NA	NA	NA	NA
WP_000290934.1|909331_910363_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	55.7	1.9e-105
WP_000377448.1|910449_911421_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001181139.1|911433_912303_-	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	39.2	2.2e-30
WP_000188448.1|912448_912670_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000460893.1|912702_913212_+	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	98.8	5.8e-87
WP_000956179.1|913219_913420_+	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	97.0	1.6e-32
WP_000963473.1|913383_913725_+	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	99.1	4.6e-56
WP_001244228.1|913792_914026_+	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	98.7	6.4e-33
WP_000752622.1|914025_914253_+	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	98.7	6.0e-36
WP_000104135.1|914249_915107_+	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	95.8	2.3e-157
WP_000017614.1|915103_917518_+	replication endonuclease	NA	E5G6L9	Salmonella_phage	97.5	0.0e+00
WP_001154434.1|917671_917860_+	hypothetical protein	NA	E5G6M0	Salmonella_phage	98.4	5.5e-27
WP_001217564.1|917870_918104_+	DinI family protein	NA	E5G6M1	Salmonella_phage	98.7	8.0e-36
WP_001292590.1|918324_918525_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000529102.1|918528_919311_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000497736.1|919533_920685_+	TIGR02391 family protein	NA	NA	NA	NA	NA
WP_000520364.1|920736_921771_-|portal	phage portal protein	portal	E5G6M3	Salmonella_phage	89.0	2.4e-172
WP_001098423.1|921770_923537_-|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	99.3	0.0e+00
WP_000216253.1|923679_924513_+|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	90.3	1.8e-122
WP_000742529.1|924529_925588_+|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.1	1.1e-180
WP_000059199.1|925591_926242_+|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	95.4	5.6e-111
WP_000673533.1|926337_926802_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.0	2.4e-76
WP_000868175.1|926801_927005_+|tail	tail protein X	tail	E5G6M9	Salmonella_phage	92.5	1.4e-31
WP_000171570.1|927008_927224_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	80.3	1.4e-26
WP_001069913.1|927204_927717_+	lysozyme	NA	E5G6N1	Salmonella_phage	92.3	2.4e-88
WP_000727854.1|927718_928096_+	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	40.0	5.1e-16
WP_001589059.1|928092_928521_+|lysis	LysB family phage lysis regulatory protein	lysis	E5G6N2	Salmonella_phage	75.9	1.9e-46
WP_001039937.1|928616_929048_+|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	93.7	1.3e-71
WP_000829121.1|929040_929487_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	85.6	1.5e-62
WP_000993767.1|929555_930134_+|plate	phage baseplate assembly protein V	plate	A0A1S6KZX7	Salmonella_phage	87.0	4.2e-94
WP_000177399.1|930130_930490_+	GPW/gp25 family protein	NA	A0A1S6KZZ4	Salmonella_phage	86.6	4.2e-52
WP_000268305.1|930476_931385_+|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	89.7	6.6e-142
WP_001086846.1|931377_931983_+|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	91.5	2.2e-109
WP_000104783.1|931979_933419_+|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	78.2	3.6e-150
WP_000844320.1|933421_933898_+|tail	tail assembly chaperone	tail	A0A0F7LDZ0	Escherichia_phage	39.6	1.4e-26
WP_000817508.1|933881_934913_-	acyltransferase	NA	NA	NA	NA	NA
WP_000046132.1|935126_936299_+|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.3	2.3e-203
WP_001207660.1|936308_936824_+|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	95.3	2.1e-89
WP_001281009.1|936878_937181_+|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	89.0	5.3e-40
WP_000763311.1|937195_937315_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.8e-13
WP_001282781.1|937307_940385_+|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	63.5	0.0e+00
WP_000980398.1|940381_940867_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	80.6	2.8e-67
WP_001011807.1|940863_941964_+	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	86.9	3.5e-174
WP_000972391.1|942054_942273_+	ogr/Delta-like zinc finger family protein	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
WP_001024876.1|942508_944194_-	aspartate:alanine antiporter	NA	NA	NA	NA	NA
942338:942364	attR	ATAAATTTCAGGCAACAAAAAACCCAT	NA	NA	NA	NA
WP_000681104.1|944463_944841_+	inner membrane protein YbjM	NA	NA	NA	NA	NA
WP_001195231.1|944870_945128_-	glutaredoxin 1	NA	A0A2I7SAE2	Vibrio_phage	63.1	7.8e-24
WP_001201570.1|945287_945575_+	DUF1418 family protein	NA	NA	NA	NA	NA
WP_000189167.1|945558_946281_+	nitroreductase NfsA	NA	NA	NA	NA	NA
WP_000684325.1|946341_947244_+	30S ribosomal protein S6--L-glutamate ligase	NA	I3ULC9	Synechococcus_phage	34.4	2.0e-37
WP_000203025.1|947331_947808_+	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_001443198.1|948156_949269_+	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_000996031.1|949363_950497_+	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.0	6.5e-30
WP_000105415.1|950506_951451_+	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_001061658.1|951447_952293_+	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_000389260.1|952352_952841_+	YbjO family protein	NA	NA	NA	NA	NA
WP_001149714.1|952881_954009_+	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A1X9I6F4	Streptococcus_phage	27.3	1.3e-27
WP_001295905.1|954037_954769_-	ABC transporter substrate-binding protein ArtJ	NA	NA	NA	NA	NA
WP_000464491.1|954994_955663_-	arginine ABC transporter permease ArtM	NA	NA	NA	NA	NA
WP_001001691.1|955662_956379_-	arginine ABC transporter permease ArtQ	NA	NA	NA	NA	NA
WP_000756575.1|956385_957117_-	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000027205.1|957134_957863_-	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	36.7	6.0e-29
WP_001298306.1|958080_958596_-	lipoprotein	NA	NA	NA	NA	NA
WP_001160737.1|958721_959045_+	heavy metal-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001255186.1|959041_959872_+	N-acetylmuramoyl-L-alanine amidase AmiD	NA	A0A1B0UZW5	Roseobacter_phage	30.0	5.7e-07
WP_001305933.1|959868_960882_-	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_001136536.1|960980_962411_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_000566393.1|962421_963423_-	low-specificity L-threonine aldolase	NA	NA	NA	NA	NA
WP_000815365.1|963459_965178_-	ubiquinone-dependent pyruvate dehydrogenase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	24.0	8.9e-31
WP_000178696.1|965310_966279_-	NADH oxidoreductase	NA	NA	NA	NA	NA
WP_000458843.1|966290_967943_-	hydroxylamine reductase	NA	NA	NA	NA	NA
WP_000491135.1|968086_968986_-	L-lysine exporter LysO	NA	NA	NA	NA	NA
WP_001298299.1|969479_970175_-	aquaporin Z	NA	NA	NA	NA	NA
WP_000599826.1|970600_972259_+	ATP-dependent endonuclease	NA	NA	NA	NA	NA
WP_001351020.1|972255_973212_-	DUF535 domain-containing protein	NA	NA	NA	NA	NA
WP_000746478.1|973362_974478_+	macrolide transporter subunit MacA	NA	NA	NA	NA	NA
WP_000410785.1|976494_976719_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	2.3e-16
WP_000520781.1|977041_977362_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
WP_000934041.1|977392_979669_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
WP_001040187.1|980353_980572_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_001241667.1|980856_981561_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
>prophage 3
NC_004431	Escherichia coli CFT073, complete sequence	5231428	1183571	1239935	5231428	transposase,protease	Enterobacteria_phage(28.57%)	47	NA	NA
WP_000426105.1|1183571_1184258_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_001528902.1|1184357_1184816_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001167423.1|1185273_1185786_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001443206.1|1186027_1186597_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011076307.1|1186871_1187156_-	S/F1C fimbrial major subunit operon transcriptional regulator	NA	NA	NA	NA	NA
WP_000046975.1|1187511_1187841_+	S/F1C fimbrial major subunit operon transcriptional regulator	NA	NA	NA	NA	NA
WP_000768217.1|1188212_1188755_+	F1C fimbrial major subunit FocA	NA	NA	NA	NA	NA
WP_000703304.1|1188825_1189365_+	S/F1C fimbrial minor subunit SfaD	NA	NA	NA	NA	NA
WP_000975445.1|1189405_1190101_+	sfa/F1C fimbrial biogenesis chaperone	NA	NA	NA	NA	NA
WP_001443207.1|1190170_1192801_+	S/F1C fimbrial usher SfaF/FocD	NA	NA	NA	NA	NA
WP_000237770.1|1192813_1193341_+	S/F1C fimbrial adhesin minor pilin SfaG/FocF	NA	NA	NA	NA	NA
WP_000767894.1|1193362_1193866_+	F1C fimbria minor subunit FocG	NA	NA	NA	NA	NA
WP_001304588.1|1193816_1194827_+	F1C fimbrial protein subunit FocH	NA	NA	NA	NA	NA
WP_000012016.1|1195130_1195871_+	transcriptional regulator SfaY	NA	NA	NA	NA	NA
WP_001445604.1|1196017_1196569_+	HTH-type transcriptional regulator SfaX	NA	NA	NA	NA	NA
WP_000950586.1|1196894_1197932_-|transposase	IS630-like element ISEc40 family transposase	transposase	NA	NA	NA	NA
WP_001222189.1|1198161_1200339_+	siderophore salmochelin receptor IroN	NA	NA	NA	NA	NA
WP_000271272.1|1200383_1201340_-	catecholate siderophore esterase IroE	NA	NA	NA	NA	NA
WP_000933673.1|1201424_1202654_-	catecholate siderophore esterase IroD	NA	NA	NA	NA	NA
WP_001111200.1|1202757_1206417_-	salmochelin/enterobactin export ABC transporter IroC	NA	W8CYL7	Bacillus_phage	29.8	3.6e-45
WP_001221122.1|1206556_1207672_-	salmochelin biosynthesis C-glycosyltransferase IroB	NA	NA	NA	NA	NA
WP_000805228.1|1208209_1208509_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000526115.1|1208686_1209145_+|transposase	IS200/IS605 family transposase	transposase	NA	NA	NA	NA
WP_001528912.1|1210403_1210688_+	hypothetical protein	NA	NA	NA	NA	NA
WP_139371347.1|1212503_1213717_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.7	4.9e-169
WP_001445605.1|1214528_1216499_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_000977398.1|1216517_1217309_+	DUF4198 domain-containing protein	NA	NA	NA	NA	NA
WP_001327488.1|1217572_1218772_+	GTP-binding protein	NA	NA	NA	NA	NA
WP_000516335.1|1219722_1220859_+	SEL1-like repeat protein	NA	NA	NA	NA	NA
WP_000997076.1|1220894_1221437_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001304575.1|1222375_1222735_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001304572.1|1223810_1224107_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001069772.1|1224406_1225279_+	GTPase family protein	NA	NA	NA	NA	NA
WP_000820423.1|1225609_1228729_+	autotransporter adhesin Ag43	NA	NA	NA	NA	NA
WP_024182236.1|1228849_1231366_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000581502.1|1231441_1231897_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001234710.1|1232307_1233129_+	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	36.7	2.2e-43
WP_000855076.1|1233391_1233865_+	antirestriction protein	NA	A0A2D0W9W4	Bordetella_phage	33.1	7.4e-12
WP_001186170.1|1233880_1234357_+	RadC family protein	NA	NA	NA	NA	NA
WP_000174402.1|1234498_1235998_+|transposase	IS21-like element ISEc10 family transposase	transposase	NA	NA	NA	NA
WP_000065240.1|1235994_1236750_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	33.9	3.2e-33
WP_000692312.1|1236835_1237057_+	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	8.5e-11
WP_000094915.1|1237075_1237720_+	hypothetical protein	NA	A0A2I6PI07	Pseudomonas_phage	32.9	7.2e-26
WP_000854739.1|1238190_1238571_+	toxin	NA	NA	NA	NA	NA
WP_001054232.1|1238567_1239056_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000772027.1|1239075_1239273_+	DUF957 domain-containing protein	NA	NA	NA	NA	NA
WP_000526135.1|1239476_1239935_+|transposase	IS200/IS605 family transposase	transposase	NA	NA	NA	NA
>prophage 4
NC_004431	Escherichia coli CFT073, complete sequence	5231428	1311853	1446309	5231428	head,transposase,terminase,capsid,holin,portal,protease,tail,integrase,tRNA,lysis	Enterobacteria_phage(45.53%)	172	1366441:1366458	1449056:1449073
WP_000526135.1|1311853_1312312_+|transposase	IS200/IS605 family transposase	transposase	NA	NA	NA	NA
WP_000179805.1|1312427_1313060_-	TetR family copper-responsive transcriptional repressor ComR	NA	NA	NA	NA	NA
WP_000800153.1|1313300_1313558_+	multiple stress resistance protein BhsA	NA	A0A1B2IFR9	Erwinia_phage	37.1	9.6e-06
WP_016265943.1|1313639_1314602_-	L,D-transpeptidase LdtC	NA	NA	NA	NA	NA
WP_000810242.1|1318319_1319393_-	acyltransferase family protein	NA	NA	NA	NA	NA
WP_000284714.1|1319653_1320853_+	lipoprotein-releasing ABC transporter permease subunit LolC	NA	NA	NA	NA	NA
WP_001033695.1|1320845_1321547_+	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	40.3	1.9e-35
WP_001251365.1|1321546_1322791_+	lipoprotein-releasing ABC transporter permease subunit LolE	NA	NA	NA	NA	NA
WP_000291305.1|1322819_1323731_+	N-acetylglucosamine kinase	NA	NA	NA	NA	NA
WP_000952746.1|1323746_1324568_+	NAD-dependent protein deacylase	NA	A0A2I7S9Y2	Vibrio_phage	35.6	5.6e-23
WP_000723290.1|1324705_1325494_-	TPM domain-containing protein	NA	NA	NA	NA	NA
WP_001443234.1|1325490_1325952_-	DUF3592 domain-containing protein	NA	NA	NA	NA	NA
WP_000759310.1|1326009_1327056_-	spermidine/putrescine ABC transporter substrate-binding protein PotD	NA	NA	NA	NA	NA
WP_000580316.1|1327052_1327847_-	spermidine/putrescine ABC transporter permease PotC	NA	NA	NA	NA	NA
WP_000074984.1|1328013_1329132_-|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	Q77Z04	Phage_21	44.2	5.9e-84
WP_000003742.1|1329100_1329370_-	excisionase	NA	NA	NA	NA	NA
WP_000102136.1|1329431_1331873_-	exonuclease	NA	V5UQJ3	Shigella_phage	46.9	3.1e-114
WP_001070255.1|1331966_1332158_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000854564.1|1332154_1332343_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001171946.1|1332911_1333130_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048901463.1|1333289_1333445_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	55.3	3.0e-07
WP_000362155.1|1333710_1334130_-	hypothetical protein	NA	K7PK07	Enterobacteria_phage	65.1	8.8e-25
WP_000391949.1|1334230_1334512_+	helix-turn-helix domain-containing protein	NA	K7PHA1	Enterobacteria_phage	72.6	8.5e-24
WP_000693837.1|1334495_1334921_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001262379.1|1334992_1336057_+	hypothetical protein	NA	A0A088CD36	Shigella_phage	64.6	7.9e-62
WP_001151225.1|1336097_1336520_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	91.4	3.3e-64
WP_000403785.1|1336577_1336934_+	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	99.2	1.8e-58
WP_001224662.1|1337027_1337210_+	hypothetical protein	NA	A0A2R2Z308	Escherichia_phage	100.0	1.4e-27
WP_000753059.1|1337202_1337379_+	hypothetical protein	NA	A0A2R2X2A8	Escherichia_phage	93.1	9.7e-26
WP_000813254.1|1338300_1338456_+	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
WP_001429486.1|1338914_1339193_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	4.3e-12
WP_001265034.1|1339194_1340244_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.6	2.9e-109
WP_000904092.1|1340256_1340613_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	61.8	1.8e-34
WP_000762890.1|1340627_1341449_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	58.6	6.1e-78
WP_000526115.1|1341699_1342158_+|transposase	IS200/IS605 family transposase	transposase	NA	NA	NA	NA
WP_000562553.1|1343052_1343184_+	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	100.0	3.7e-06
WP_000871291.1|1343464_1343800_-	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	74.8	5.2e-44
WP_000874243.1|1344060_1344249_+	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	95.2	7.2e-27
WP_001327246.1|1344245_1344407_+	hypothetical protein	NA	Q08JA2	Stx2-converting_phage	89.1	2.0e-14
WP_000372595.1|1344556_1344772_+|holin	class II holin family protein	holin	A0A2R2Z340	Escherichia_phage	98.6	3.4e-33
WP_000193296.1|1344776_1345121_+	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	92.9	7.0e-36
WP_000370546.1|1345086_1345359_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000992105.1|1345464_1345998_+	lysozyme	NA	K7PLY1	Enterobacteria_phage	96.0	4.8e-100
WP_001327248.1|1345994_1346462_+|lysis	lysis protein	lysis	Q9AZ06	Salmonella_phage	89.7	5.0e-69
WP_001139682.1|1346449_1346602_+	hypothetical protein	NA	Q716B2	Shigella_phage	100.0	2.1e-21
WP_001059340.1|1346804_1347329_+	Rha family transcriptional regulator	NA	G8C7W4	Escherichia_phage	93.6	2.9e-86
WP_001537735.1|1347631_1348042_-	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	77.8	2.7e-55
WP_000105081.1|1348099_1348333_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	94.4	4.3e-21
WP_000235436.1|1348727_1349237_+|terminase	terminase small subunit	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
WP_001537733.1|1349208_1351137_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.5	9.4e-263
WP_000258993.1|1351120_1351327_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	55.4	3.0e-10
WP_001537684.1|1351323_1352916_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	61.3	2.9e-185
WP_001253953.1|1352905_1354411_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	53.5	2.7e-100
WP_000256835.1|1354447_1354795_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	55.9	2.9e-21
WP_000522583.1|1354852_1355881_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.9	8.6e-114
WP_000201498.1|1355932_1356316_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001204571.1|1356308_1356662_+|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	70.1	1.1e-41
WP_000974995.1|1356677_1357211_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	64.1	1.2e-55
WP_000683079.1|1357207_1357603_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	82.4	1.5e-58
WP_000235037.1|1357610_1358357_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	93.4	8.7e-124
WP_001299690.1|1358375_1358807_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	67.4	2.4e-41
WP_000533402.1|1358833_1359247_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_000082403.1|1359227_1361789_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	86.4	0.0e+00
WP_000847298.1|1361785_1362115_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_001327694.1|1362114_1362813_+|tail	phage minor tail protein L	tail	S5M7Q4	Escherichia_phage	97.0	7.6e-130
WP_001576728.1|1362818_1363562_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	93.4	8.3e-143
WP_072258937.1|1363507_1364140_+|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	92.3	1.7e-96
WP_000514735.1|1364483_1368176_+	DUF1983 domain-containing protein	NA	A0A0P0ZCI5	Stx2-converting_phage	85.8	0.0e+00
1366441:1366458	attL	TGCGTCTGACCAGCGGAA	NA	NA	NA	NA
WP_001228261.1|1368243_1368843_+	Ail/Lom family protein	NA	Q9EV15	Enterobacteria_phage	92.5	4.4e-102
WP_000216560.1|1368994_1371058_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A1X7QGG5	Escherichia_phage	62.7	3.7e-148
WP_001204582.1|1371054_1371333_+	hypothetical protein	NA	A0A0E3JSQ1	Enterobacteria_phage	50.5	1.0e-21
WP_000355700.1|1371342_1371636_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071819026.1|1371675_1371774_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	78.1	9.5e-07
WP_000742375.1|1371828_1372485_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000937496.1|1372553_1372820_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	78.3	2.3e-18
WP_000799413.1|1373051_1373915_-	spermidine/putrescine ABC transporter permease PotB	NA	NA	NA	NA	NA
WP_000531594.1|1373898_1375035_-	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
WP_000359446.1|1375284_1376511_+	peptidase T	NA	NA	NA	NA	NA
WP_001295435.1|1376559_1377681_-	[50S ribosomal protein L16]-arginine 3-hydroxylase	NA	NA	NA	NA	NA
WP_000085269.1|1377929_1379159_+|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	55.6	1.1e-131
WP_000953274.1|1379524_1379713_+	AlpA family transcriptional regulator	NA	A0A2H4JB58	uncultured_Caudovirales_phage	66.0	1.5e-13
WP_001617541.1|1379765_1381052_+	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_000076671.1|1381048_1381279_+	hypothetical protein	NA	A0A1W6JPD9	Morganella_phage	49.1	4.5e-07
WP_001372127.1|1381268_1381490_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001204077.1|1381482_1381704_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001204962.1|1381705_1381939_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000770152.1|1381944_1382244_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_000761835.1|1382240_1383995_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	40.3	9.2e-92
WP_001260558.1|1384283_1384541_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000126698.1|1384537_1384948_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_000233305.1|1384958_1385207_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000796960.1|1385461_1385668_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000216279.1|1385667_1386723_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	43.6	1.3e-69
WP_000380877.1|1386734_1387070_+|head	head decoration protein	head	NA	NA	NA	NA
WP_000224596.1|1387082_1387496_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000565609.1|1387658_1388093_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000133413.1|1388372_1388654_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000734671.1|1389208_1390669_-	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_001265481.1|1390668_1391340_-	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_000423742.1|1391509_1392880_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	1.2e-107
WP_001295971.1|1392883_1393525_-	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_011076353.1|1393560_1394667_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_000476093.1|1394720_1395182_-	phosphatase NudJ	NA	NA	NA	NA	NA
WP_000444487.1|1396017_1397268_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
WP_000741334.1|1397369_1398512_-|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	Q77Z02	Phage_21	99.7	1.1e-205
WP_128890935.1|1398501_1398600_-	excisionase	NA	NA	NA	NA	NA
WP_139371347.1|1398655_1399868_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.7	4.9e-169
WP_000088654.1|1399871_1400051_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000490215.1|1400190_1400430_-	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	93.7	8.8e-38
WP_001304460.1|1400455_1400740_-	ASCH domain-containing protein	NA	A0A2D1GLL3	Escherichia_phage	89.4	4.0e-45
WP_000208010.1|1400732_1401473_-	DUF550 domain-containing protein	NA	K7PGV7	Enterobacterial_phage	67.1	6.5e-47
WP_000951713.1|1401469_1401679_-	hypothetical protein	NA	A0A0F6TJE4	Escherichia_coli_O157_typing_phage	91.2	1.3e-32
WP_001327280.1|1401680_1402214_-	hypothetical protein	NA	Q1MVF7	Enterobacteria_phage	82.1	2.5e-64
WP_001518554.1|1402231_1402486_-	hypothetical protein	NA	A5LH60	Enterobacteria_phage	91.1	1.7e-34
WP_000065240.1|1402869_1403625_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	33.9	3.2e-33
WP_000174402.1|1403621_1405121_-|transposase	IS21-like element ISEc10 family transposase	transposase	NA	NA	NA	NA
WP_000763378.1|1405664_1405886_-	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	97.3	8.4e-35
WP_000188870.1|1405984_1406200_-	hypothetical protein	NA	A0A1I9LJM7	Stx_converting_phage	100.0	1.0e-32
WP_000548537.1|1406276_1406468_-	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	98.4	2.1e-26
WP_000149544.1|1406440_1406623_-	DUF1317 domain-containing protein	NA	A0A1U8QQC1	Enterobacteria_phage	96.7	6.9e-27
WP_000186777.1|1406619_1407300_-	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	97.8	1.6e-129
WP_000100847.1|1407296_1408082_-	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000995434.1|1408087_1408384_-	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	98.0	1.1e-48
WP_000372923.1|1408459_1408603_-	host cell division inhibitory peptide Kil	NA	A0A0N7C2U2	Escherichia_phage	97.9	2.7e-18
WP_001198860.1|1408571_1408736_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	A0A0N6WES3	Escherichia_phage	100.0	1.4e-26
WP_000065374.1|1408808_1409177_-	DUF2528 family protein	NA	M1FPD2	Enterobacteria_phage	100.0	2.0e-65
WP_000213979.1|1409359_1409560_-	antirestriction Ral family protein	NA	A0A0K2FJE6	Enterobacteria_phage	98.5	7.1e-33
WP_001066176.1|1409773_1410355_+	super-infection exclusion protein B	NA	K7P6T7	Enterobacteria_phage	92.2	5.2e-92
WP_000088199.1|1410371_1410644_-	hypothetical protein	NA	A0A0N7C217	Escherichia_phage	98.9	2.8e-40
WP_000438342.1|1410621_1410804_-	hypothetical protein	NA	A0A0N7C057	Escherichia_phage	98.3	1.1e-27
WP_000968518.1|1411080_1411833_-	DUF1828 domain-containing protein	NA	NA	NA	NA	NA
WP_001062368.1|1411829_1412387_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000067727.1|1413204_1413420_+	helix-turn-helix transcriptional regulator	NA	A0A0N7C2U7	Escherichia_phage	100.0	2.2e-35
WP_000442609.1|1413561_1413858_+	hypothetical protein	NA	G9L678	Escherichia_phage	94.9	2.2e-46
WP_000185431.1|1413890_1414790_+	replication protein	NA	K7P7F0	Enterobacteria_phage	99.0	3.5e-172
WP_000788872.1|1414786_1415488_+	Replication protein 14	NA	A0A0P0ZD31	Stx2-converting_phage	99.6	2.9e-129
WP_000145927.1|1415484_1415775_+	protein ren	NA	O48423	Enterobacteria_phage	97.9	2.8e-46
WP_139371347.1|1415866_1417079_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.7	4.9e-169
WP_000736913.1|1417161_1417602_+	recombination protein NinB	NA	M1FPM8	Enterobacteria_phage	100.0	1.2e-80
WP_000153286.1|1417598_1418126_+	phage N-6-adenine-methyltransferase	NA	A0A1I9LJP9	Stx_converting_phage	99.4	4.7e-100
WP_001254243.1|1418122_1418299_+	NinE family protein	NA	A5VW90	Enterobacteria_phage	96.6	3.3e-26
WP_000386643.1|1418301_1418643_+	DUF2591 family protein	NA	Q76H72	Enterobacteria_phage	96.5	1.6e-61
WP_001099712.1|1418849_1419212_+	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.5	4.3e-60
WP_000971053.1|1419208_1419349_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	67.4	3.6e-07
WP_001204776.1|1419434_1419818_+	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	83.3	1.5e-55
WP_000737271.1|1420006_1421089_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	80.1	1.6e-166
WP_000839596.1|1421677_1421893_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_001135277.1|1421892_1422390_+	lysozyme RrrD	NA	M1FJA0	Enterobacteria_phage	97.0	5.4e-90
WP_001228695.1|1422606_1422789_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.3	2.9e-17
WP_001298464.1|1422879_1423173_-	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	92.8	7.0e-45
WP_000830178.1|1423653_1423980_+	TonB family protein	NA	H6WZK5	Escherichia_phage	72.2	3.7e-39
WP_000881610.1|1424186_1424369_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000867568.1|1424931_1425480_+|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	84.2	1.0e-57
WP_001335577.1|1425451_1427380_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.7	2.5e-260
WP_000258997.1|1427363_1427570_+|head	phage head-stabilizing protein	head	K7PM10	Enterobacteria_phage	55.4	3.0e-10
WP_000831760.1|1427566_1429159_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	61.1	6.5e-185
WP_001253913.1|1429148_1430654_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	53.7	3.6e-100
WP_000256791.1|1430690_1431038_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	58.1	2.6e-22
WP_000522648.1|1431095_1432124_+|capsid	minor capsid protein E	capsid	C6ZCY2	Enterobacteria_phage	61.6	5.9e-115
WP_000201530.1|1432175_1432550_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001204540.1|1432542_1432896_+|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	65.0	3.4e-38
WP_000975062.1|1432907_1433486_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.0	2.9e-79
WP_000683101.1|1433482_1433878_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	97.7	5.5e-69
WP_000479129.1|1434637_1435060_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	91.4	2.7e-66
WP_000459474.1|1435041_1435476_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	90.0	9.0e-57
WP_000840269.1|1435468_1438030_+|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	94.5	0.0e+00
WP_000847405.1|1438026_1438356_+|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	94.5	5.4e-54
WP_001152660.1|1438355_1439054_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	97.8	4.0e-131
WP_000140699.1|1439059_1439803_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.2	1.1e-147
WP_000090917.1|1439739_1440372_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	100.0	5.9e-97
WP_000515327.1|1440432_1443915_+	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	89.5	0.0e+00
WP_000654167.1|1446030_1446309_+	hypothetical protein	NA	A0A0E3JSQ1	Enterobacteria_phage	56.5	7.6e-25
1449056:1449073	attR	TTCCGCTGGTCAGACGCA	NA	NA	NA	NA
>prophage 5
NC_004431	Escherichia coli CFT073, complete sequence	5231428	2499669	2509114	5231428		Enterobacteria_phage(85.71%)	10	NA	NA
WP_001305166.1|2499669_2500806_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.7	3.8e-163
WP_001327380.1|2500802_2502806_+	SWIM zinc finger family protein	NA	Q9EYF6	Enterobacteria_phage	95.1	0.0e+00
WP_001296231.1|2502930_2503392_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	99.3	3.2e-76
WP_024182243.1|2503432_2503903_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	99.4	8.8e-82
WP_000598641.1|2503949_2504669_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295431.1|2504665_2506351_-	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_001240404.1|2506572_2507304_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.0	2.2e-111
WP_001216963.1|2507363_2507471_+	protein YohO	NA	NA	NA	NA	NA
WP_000783150.1|2507451_2508183_-	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_000569381.1|2508187_2509114_-	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	2.8e-23
>prophage 6
NC_004431	Escherichia coli CFT073, complete sequence	5231428	2974893	3065315	5231428	head,transposase,capsid,terminase,holin,portal,tail,tRNA	Enterobacteria_phage(38.6%)	102	NA	NA
WP_000083664.1|2974893_2975631_-|tRNA	tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase TrmN	tRNA	NA	NA	NA	NA
WP_000219193.1|2975762_2977097_+	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	30.8	2.9e-45
WP_001298616.1|2977129_2978011_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000189209.1|2978113_2978701_+	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_000627804.1|2978756_2979140_-	autonomous glycyl radical cofactor GrcA	NA	A0A088FS37	Shigella_phage	70.9	4.7e-33
WP_001262725.1|2979444_2980134_+	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	48.4	2.7e-55
WP_000997423.1|2980182_2981220_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_001098726.1|2981426_2981846_+	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	38.5	2.8e-15
WP_001298618.1|2981914_2982613_+|tRNA	tRNA-uridine aminocarboxypropyltransferase	tRNA	NA	NA	NA	NA
WP_000083021.1|2982644_2985305_+	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_001305244.1|2985418_2986774_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_001370843.1|2986819_2987143_+	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_001443088.1|2987139_2988438_-	alpha-ketoglutarate permease	NA	Q6JIH2	Burkholderia_virus	31.7	2.8e-45
WP_001235102.1|2994300_2996874_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.3	2.6e-127
WP_000040136.1|2997003_2997735_-	polyphenol oxidase	NA	NA	NA	NA	NA
WP_000079112.1|2997731_2998712_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_000197686.1|2998846_2999584_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_000178456.1|2999853_3000195_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_001386991.1|3000298_3000346_+	pheA operon leader peptide PheL	NA	NA	NA	NA	NA
WP_000200106.1|3000444_3001605_+	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_000225230.1|3001647_3002769_-	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_001168045.1|3002779_3003850_-	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.2	4.0e-90
WP_001298694.1|3004059_3004425_+	DUF2799 domain-containing protein	NA	NA	NA	NA	NA
WP_001212400.1|3004571_3005090_+	YfiR family protein	NA	NA	NA	NA	NA
WP_000969016.1|3005079_3006306_+	diguanylate cyclase DgcN	NA	NA	NA	NA	NA
WP_000589793.1|3006321_3006804_+	OmpA family protein	NA	NA	NA	NA	NA
WP_000065253.1|3006880_3007228_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_000264777.1|3007269_3008037_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_000043335.1|3008067_3008616_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_000256450.1|3008634_3008883_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_000460035.1|3009019_3010381_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_001338897.1|3010547_3011339_+	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_032140825.1|3011359_3012646_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001296310.1|3012700_3013294_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_001059176.1|3013416_3014295_+	NAD(+) kinase	NA	NA	NA	NA	NA
WP_000880938.1|3014380_3016042_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001203437.1|3016190_3016532_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_001117834.1|3016593_3016884_-	RnfH family protein	NA	NA	NA	NA	NA
WP_000600193.1|3016873_3017350_-	type II toxin-antitoxin system toxin RatA	NA	NA	NA	NA	NA
WP_000162574.1|3017481_3017964_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
WP_001072749.1|3018709_3019630_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001372053.1|3020595_3020709_+	hypothetical protein	NA	A0A1C9IHU6	Salmonella_phage	77.8	1.4e-06
WP_000836769.1|3020777_3021011_+	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	6.4e-33
WP_000086527.1|3021385_3021976_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
WP_001306187.1|3022203_3022497_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001306186.1|3022539_3023580_-|tail	tail fiber domain-containing protein	tail	A0A0E3M4A9	Enterobacteria_phage	67.6	6.4e-125
WP_000654158.1|3023589_3023871_-	hypothetical protein	NA	A0A1X7QHA1	Escherichia_phage	48.9	1.6e-17
WP_000741758.1|3023867_3026267_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0E3M194	Enterobacteria_phage	55.2	3.9e-133
WP_000526135.1|3026387_3026846_-|transposase	IS200/IS605 family transposase	transposase	NA	NA	NA	NA
WP_001228249.1|3027042_3027642_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	92.0	1.5e-102
WP_000515334.1|3027709_3031189_-	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	89.6	0.0e+00
WP_000090890.1|3031249_3031882_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.0	2.2e-96
WP_000140691.1|3031818_3032562_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	93.5	9.8e-144
WP_001152645.1|3032566_3033265_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.3	3.6e-132
WP_000847327.1|3033264_3033594_-|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	99.1	9.6e-59
WP_000840307.1|3033590_3036152_-|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	90.6	0.0e+00
WP_000459451.1|3036144_3036579_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	98.3	1.0e-63
WP_000479167.1|3036560_3036983_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	94.3	4.5e-69
WP_001547293.1|3036998_3037739_-|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	97.2	1.2e-128
WP_000683090.1|3037746_3038142_-|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	96.9	2.5e-69
WP_000985118.1|3038138_3038717_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.0	1.7e-79
WP_000752955.1|3038728_3039082_-|head,tail	head-tail joining protein	head,tail	A0A2R9YJJ5	Escherichia_phage	98.3	2.9e-61
WP_000158882.1|3039093_3039489_-	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	92.4	3.1e-56
WP_000063221.1|3039530_3040556_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	97.9	8.1e-189
WP_001338090.1|3040610_3040943_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	6.5e-55
WP_000123331.1|3040952_3042272_-	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	99.1	5.6e-235
WP_001534239.1|3042252_3043854_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.9	1.1e-309
WP_000198149.1|3043850_3044057_-	gpW family protein	NA	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_001027232.1|3044053_3045979_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	98.9	0.0e+00
WP_000453567.1|3045953_3046499_-|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	93.4	7.8e-90
WP_001300120.1|3046887_3047082_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	98.4	1.5e-27
WP_000548592.1|3047332_3047539_-	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	79.4	3.4e-22
WP_001019207.1|3047834_3048008_-	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_001443523.1|3048180_3048336_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071526745.1|3048483_3048672_-	cold-shock protein	NA	NA	NA	NA	NA
WP_000066495.1|3048682_3048895_-	cold shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
WP_001071776.1|3049259_3049757_-	DUF2514 domain-containing protein	NA	NA	NA	NA	NA
WP_001101173.1|3049753_3050287_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	93.8	1.4e-96
WP_001306174.1|3050400_3050661_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000189904.1|3050608_3051160_-	YdfR family protein	NA	Q08JA0	Stx2-converting_phage	50.6	4.2e-35
WP_000839581.1|3051164_3051380_-|holin	class II holin family protein	holin	A5LH82	Enterobacteria_phage	90.1	7.9e-30
WP_000066482.1|3052132_3052348_-	cold shock-like protein CspB	NA	A0A1W6JNX5	Morganella_phage	76.5	2.6e-25
WP_000087756.1|3052648_3052861_+	cold shock-like protein CspF	NA	NA	NA	NA	NA
WP_122985741.1|3052915_3053005_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001047084.1|3053276_3054029_-	antitermination protein	NA	K7PGU5	Enterobacteria_phage	96.4	1.1e-131
WP_016230662.1|3054042_3055032_-	DUF968 domain-containing protein	NA	S5FV02	Shigella_phage	99.7	4.3e-195
WP_001061410.1|3055039_3055837_-	KilA-N domain-containing protein	NA	A0A0P0ZCS0	Stx2-converting_phage	98.9	4.9e-149
WP_000767122.1|3055856_3056246_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	98.4	1.0e-67
WP_000210150.1|3056242_3056569_-	LexA repressor	NA	A0A0N7KZF7	Stx2-converting_phage	98.1	1.3e-52
WP_001573323.1|3056568_3057063_-	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	97.5	6.2e-86
WP_000104957.1|3057059_3058001_-	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	93.3	1.7e-140
WP_001250269.1|3057990_3058170_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
WP_000515870.1|3058345_3058897_-	hypothetical protein	NA	U5P4K1	Shigella_phage	98.9	1.7e-100
WP_000205494.1|3058934_3059135_-	cell division protein	NA	NA	NA	NA	NA
WP_000450738.1|3059232_3059859_+	LexA family transcriptional regulator	NA	K7PM82	Enterobacteria_phage	48.8	2.5e-47
WP_000500991.1|3060074_3060587_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000135691.1|3061054_3061417_+	hypothetical protein	NA	Q8SBF8	Shigella_phage	98.3	1.2e-59
WP_000081287.1|3061482_3062307_+	DUF2303 family protein	NA	U5P439	Shigella_phage	100.0	6.0e-150
WP_000008221.1|3062434_3062959_+	5'-deoxynucleotidase	NA	S5MW55	Escherichia_phage	97.7	2.0e-95
WP_001075212.1|3063067_3063934_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001331174.1|3063975_3064182_+	hypothetical protein	NA	I6PBM8	Cronobacter_phage	70.3	6.9e-23
WP_000531795.1|3064142_3065315_+	DUF3596 domain-containing protein	NA	I6PDJ1	Cronobacter_phage	67.0	7.4e-146
>prophage 7
NC_004431	Escherichia coli CFT073, complete sequence	5231428	3138249	3145389	5231428		Escherichia_phage(83.33%)	6	NA	NA
WP_000103863.1|3138249_3140811_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.8	1.6e-31
WP_001141289.1|3140916_3141573_+	protein-serine/threonine phosphatase	NA	A0A077SLQ6	Escherichia_phage	45.2	2.8e-49
WP_001298167.1|3141623_3142391_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	57.4	2.2e-69
WP_000847998.1|3142586_3143495_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	5.1e-118
WP_000590418.1|3143491_3144754_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.4	2.2e-135
WP_001279001.1|3144750_3145389_+	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	2.8e-83
>prophage 8
NC_004431	Escherichia coli CFT073, complete sequence	5231428	3376982	3440670	5231428	transposase,protease,integrase,tRNA,lysis	Stx2-converting_phage(45.45%)	60	3396920:3396935	3426945:3426960
WP_001327406.1|3376982_3377741_+|protease	metalloprotease LoiP	protease	NA	NA	NA	NA
WP_000105562.1|3377944_3378865_-	agmatinase	NA	NA	NA	NA	NA
WP_000758911.1|3379000_3379732_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001295380.1|3379877_3381854_-	biosynthetic arginine decarboxylase	NA	NA	NA	NA	NA
WP_001297406.1|3381862_3381994_-	acid stress response protein YqgB	NA	NA	NA	NA	NA
WP_048901457.1|3382129_3382345_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001062128.1|3382648_3383803_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	63.2	4.0e-128
WP_001112301.1|3384238_3385633_+	galactose/proton symporter	NA	NA	NA	NA	NA
WP_000858396.1|3385709_3386207_+|protease	SprT family zinc-dependent metalloprotease	protease	NA	NA	NA	NA
WP_001327408.1|3386301_3387009_+	deoxyribonuclease I	NA	NA	NA	NA	NA
WP_001222509.1|3387088_3387820_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_000593261.1|3387832_3388783_+	glutathione synthase	NA	NA	NA	NA	NA
WP_001053178.1|3388891_3389455_+	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_000017106.1|3389454_3389871_+	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_001327409.1|3390044_3391025_-	type IV pilus twitching motility protein PilT	NA	NA	NA	NA	NA
WP_000997795.1|3391042_3391747_+	pyridoxal phosphate homeostasis protein	NA	NA	NA	NA	NA
WP_001094831.1|3391764_3392331_+	osmotic shock tolerance protein YggT	NA	NA	NA	NA	NA
WP_001277222.1|3392327_3392618_+	YggU family protein	NA	NA	NA	NA	NA
WP_001174738.1|3392625_3393219_+	XTP/dITP diphosphatase	NA	NA	NA	NA	NA
WP_000239981.1|3393211_3394348_+	radical SAM family heme chaperone HemW	NA	NA	NA	NA	NA
WP_000745192.1|3394416_3395424_-	DUF1202 family protein	NA	NA	NA	NA	NA
WP_000394106.1|3395540_3396587_-	L-asparaginase 2	NA	NA	NA	NA	NA
WP_000984796.1|3396762_3397482_-	DUF2884 domain-containing protein	NA	NA	NA	NA	NA
3396920:3396935	attL	AATGGGTTACCGCCGC	NA	NA	NA	NA
WP_001107565.1|3397665_3397992_-	YggL family protein	NA	NA	NA	NA	NA
WP_000786915.1|3397991_3398711_-|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_001327411.1|3398871_3399924_+	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_000091699.1|3399951_3400227_+	oxidative damage protection protein	NA	NA	NA	NA	NA
WP_000760323.1|3400291_3401371_+	membrane-bound lytic murein transglycosylase MltC	NA	NA	NA	NA	NA
WP_001327414.1|3401572_3402829_+	nucleoside permease NupG	NA	NA	NA	NA	NA
WP_000839794.1|3402877_3405013_-	ornithine decarboxylase	NA	NA	NA	NA	NA
WP_000234491.1|3405411_3406119_+	DUF554 domain-containing protein	NA	NA	NA	NA	NA
WP_001218870.1|3406497_3407763_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	38.1	6.1e-77
WP_000147023.1|3408018_3409062_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000839179.1|3410472_3410877_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	100.0	3.0e-70
WP_000612626.1|3410873_3411221_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
WP_000995840.1|3413217_3414690_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	27.9	1.9e-21
WP_001066996.1|3414690_3415410_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	35.2	4.2e-35
WP_000726551.1|3416148_3416892_+	molybdopterin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_000789528.1|3416946_3417189_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001546261.1|3418371_3418884_+	alpha-hemolysin-activating lysine-acyltransferase HlyC	NA	NA	NA	NA	NA
WP_001142375.1|3418895_3421970_+	RTX toxin hemolysin HlyA	NA	NA	NA	NA	NA
WP_000376545.1|3422040_3424164_+	type I secretion system permease/ATPase	NA	W8CYL7	Bacillus_phage	29.7	1.4e-46
WP_000860472.1|3424182_3425619_+	alpha-hemolysin T1SS ABC transporter subunit HlyD	NA	NA	NA	NA	NA
WP_085962335.1|3425930_3427087_-|transposase	IS3-like element IS600 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	2.8e-68
3426945:3426960	attR	GCGGCGGTAACCCATT	NA	NA	NA	NA
WP_001171554.1|3427189_3427570_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|3427566_3427914_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_071529140.1|3428321_3428429_+|transposase	transposase domain-containing protein	transposase	A0A0P0ZEB3	Stx2-converting_phage	97.1	1.1e-13
WP_001298062.1|3428778_3429330_-	HTH-type transcriptional regulator PapX	NA	NA	NA	NA	NA
WP_000758683.1|3429592_3430603_-	P fimbria tip G-adhesin PapG-II	NA	NA	NA	NA	NA
WP_000113351.1|3430646_3431147_-	P fimbrial tip protein PapF	NA	NA	NA	NA	NA
WP_000723799.1|3431221_3431743_-	P fimbrial minor subunit PapE	NA	NA	NA	NA	NA
WP_000597713.1|3431769_3432306_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_000261297.1|3432315_3432897_-	protein papJ	NA	NA	NA	NA	NA
WP_000265729.1|3432933_3433668_-	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_000654937.1|3433738_3436249_-	P fimbrial usher protein PapC	NA	NA	NA	NA	NA
WP_001239363.1|3436307_3436895_-	P fimbrial minor subunit PapH	NA	NA	NA	NA	NA
WP_000597756.1|3436964_3437531_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_000930062.1|3437737_3438052_-	major pilus subunit operon regulatory protein PapB	NA	NA	NA	NA	NA
WP_000006206.1|3438456_3438690_+	major pilus subunit operon transcriptional regulator PapI	NA	NA	NA	NA	NA
WP_001513409.1|3440556_3440670_-|lysis	lysis protein	lysis	NA	NA	NA	NA
