The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_003317	Brucella melitensis bv. 1 str. 16M chromosome I, complete sequence	2117144	1040487	1050508	2117144	transposase,integrase	Brucella_phage(37.5%)	15	1035485:1035525	1050586:1050626
1035485:1035525	attL	TGCGGGTATGATGTAATGGTAGCCTGTCAGCTTCCCAAGCT	NA	NA	NA	NA
WP_004685623.1|1040487_1041939_-	hypothetical protein	NA	A0A141GEY6	Brucella_phage	57.1	1.3e-136
WP_002967634.1|1042269_1043043_-	hypothetical protein	NA	A0A141GEY5	Brucella_phage	97.8	1.3e-122
WP_193334352.1|1043043_1043801_-|transposase	IS5 family transposase	transposase	A0A0N9SJT9	Paenibacillus_phage	41.0	4.7e-16
WP_004683741.1|1044641_1044887_+	BrnT family toxin	NA	NA	NA	NA	NA
WP_004683740.1|1044886_1045201_+	BrnA antitoxin family protein	NA	K4NZP3	Burkholderia_phage	42.1	2.0e-05
WP_004686810.1|1045548_1045719_+	YegP family protein	NA	A0A2P1N580	Mycobacterium_phage	43.1	9.1e-05
WP_004683739.1|1046066_1046777_-	porin family protein	NA	O11861	Bartonella_henselae_phage	36.8	5.1e-41
WP_004683738.1|1047011_1047599_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002964092.1|1047621_1047897_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002964091.1|1047893_1048124_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005968944.1|1048120_1048825_-	hypothetical protein	NA	A0A076GD06	Sinorhizobium_phage	46.8	4.5e-05
WP_002964088.1|1048874_1049078_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005968947.1|1049074_1049290_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004683737.1|1049292_1049496_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004686809.1|1049482_1050508_+|integrase	site-specific integrase	integrase	A0A141GEZ3	Brucella_phage	36.4	3.7e-48
1050586:1050626	attR	TGCGGGTATGATGTAATGGTAGCCTGTCAGCTTCCCAAGCT	NA	NA	NA	NA
>prophage 2
NC_003317	Brucella melitensis bv. 1 str. 16M chromosome I, complete sequence	2117144	1119539	1131467	2117144	tRNA	uncultured_Mediterranean_phage(90.0%)	13	NA	NA
WP_011005223.1|1119539_1121867_-	protein translocase subunit SecDF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	43.5	6.2e-51
WP_002964021.1|1121986_1122328_-	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	40.2	9.1e-12
WP_002964020.1|1122487_1123354_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_002964019.1|1123402_1124701_-	peptidoglycan DD-metalloendopeptidase family protein	NA	Q8SBN9	Clostridium_phage	41.1	1.0e-18
WP_002964018.1|1124749_1124935_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004683704.1|1125079_1125748_-	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	38.5	6.6e-14
WP_004683703.1|1125744_1126512_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	40.2	1.0e-39
WP_004683702.1|1126660_1127944_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	47.2	2.6e-104
WP_004683701.1|1128020_1128845_-	twin-arginine translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	41.5	2.6e-44
WP_004686803.1|1128841_1129423_-	twin-arginine translocase subunit TatB	NA	NA	NA	NA	NA
WP_002964012.1|1129533_1129752_-	twin-arginine translocase TatA/TatE family subunit	NA	A0A1B1IVR9	uncultured_Mediterranean_phage	65.1	1.5e-07
WP_004683699.1|1129897_1130623_-	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	45.1	4.3e-43
WP_004683698.1|1130615_1131467_-	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	33.5	4.4e-31
>prophage 3
NC_003317	Brucella melitensis bv. 1 str. 16M chromosome I, complete sequence	2117144	1356176	1403283	2117144	tail,portal,integrase,protease	Mesorhizobium_phage(14.29%)	41	1346976:1346990	1360420:1360434
1346976:1346990	attL	CCGCTTCGCACTTTT	NA	NA	NA	NA
WP_004686787.1|1356176_1357103_+|integrase	site-specific integrase	integrase	A0A076YL28	Mesorhizobium_phage	31.6	4.5e-29
WP_002963781.1|1358615_1358990_+	DUF423 domain-containing protein	NA	NA	NA	NA	NA
WP_004683357.1|1359034_1359685_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004683355.1|1360342_1361113_+	YitT family protein	NA	NA	NA	NA	NA
1360420:1360434	attR	CCGCTTCGCACTTTT	NA	NA	NA	NA
WP_004683353.1|1361172_1361430_-	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_004686532.1|1361699_1361939_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002963776.1|1361935_1362283_+	DUF2147 domain-containing protein	NA	NA	NA	NA	NA
WP_004683348.1|1362341_1363052_-	glutathione S-transferase N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_002971518.1|1363246_1363414_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004683346.1|1363410_1363578_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004683344.1|1363618_1365121_+	AMP nucleosidase	NA	NA	NA	NA	NA
WP_004686786.1|1365273_1366242_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_004683340.1|1366356_1368048_-	electron transfer flavoprotein-ubiquinone oxidoreductase	NA	NA	NA	NA	NA
WP_002963769.1|1368436_1369309_+	uracil-DNA glycosylase	NA	NA	NA	NA	NA
WP_005969556.1|1369470_1370727_+	MFS transporter	NA	NA	NA	NA	NA
WP_002963767.1|1370731_1371691_-	DMT family transporter	NA	NA	NA	NA	NA
WP_004683334.1|1371916_1374568_+	aminopeptidase N	NA	NA	NA	NA	NA
WP_002963765.1|1374958_1377310_+	PAS-domain containing protein	NA	A0A1V0SGX0	Hokovirus	34.8	6.3e-27
WP_004683330.1|1377580_1379692_+	O-antigen ligase family protein	NA	NA	NA	NA	NA
WP_004683327.1|1379736_1382688_-	bifunctional [glutamine synthetase] adenylyltransferase/[glutamine synthetase]-adenylyl-L-tyrosine phosphorylase	NA	NA	NA	NA	NA
WP_005969562.1|1382810_1384217_-	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_004683323.1|1384213_1384921_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_004683321.1|1385014_1386556_-|protease	DegQ family serine endoprotease	protease	A0A1B1IT49	uncultured_Mediterranean_phage	29.8	1.7e-28
WP_004683319.1|1386697_1387174_-	cytochrome c-type biogenesis protein CcmH	NA	NA	NA	NA	NA
WP_002963758.1|1387170_1389162_-	heme lyase CcmF/NrfE family subunit	NA	NA	NA	NA	NA
WP_002963757.1|1389181_1389679_-	cytochrome c maturation protein CcmE	NA	NA	NA	NA	NA
WP_004686785.1|1389675_1390815_-	c-type cytochrome biogenesis protein CcmI	NA	NA	NA	NA	NA
WP_025198991.1|1390915_1391368_-	membrane protein	NA	NA	NA	NA	NA
WP_002969444.1|1391461_1392772_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002963753.1|1392846_1393536_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_002971526.1|1393614_1393911_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002969445.1|1394072_1394279_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004683307.1|1398211_1398646_-	C40 family peptidase	NA	NA	NA	NA	NA
WP_004683305.1|1398642_1399518_-	DUF2163 domain-containing protein	NA	A0A0K1Y6Z2	Rhodobacter_phage	38.9	4.5e-47
WP_002963747.1|1399514_1400147_-	TIGR02217 family protein	NA	A0A0B5A2K3	Paracoccus_phage	47.6	2.9e-48
WP_002970984.1|1400149_1400695_-|tail	phage tail tape measure protein	tail	A0A0S2SYD9	Pseudomonas_phage	46.4	2.8e-07
WP_004683301.1|1400699_1400870_-|tail	phage tail assembly chaperone	tail	NA	NA	NA	NA
WP_004683300.1|1400913_1401255_-	gene transfer agent family protein	NA	NA	NA	NA	NA
WP_002963743.1|1401251_1401665_-|tail	phage major tail protein, TP901-1 family	tail	NA	NA	NA	NA
WP_002967499.1|1401715_1402093_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002963736.1|1402089_1403283_-|portal	phage portal protein	portal	W8ECU7	Geobacillus_phage	40.0	7.0e-67
