The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_004337	Shigella flexneri 2a str. 301 chromosome, complete genome	4607202	12161	19381	4607202		Escherichia_phage(50.0%)	7	NA	NA
NP_705973.1|12161_14078_+	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	51.1	9.0e-149
NP_705974.2|14166_15297_+	molecular chaperone DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	37.1	1.4e-27
YP_008439227.1|15400_15553_-	hypothetical protein	NA	A0A0U2QV81	Escherichia_phage	78.0	1.6e-13
NP_705975.1|16139_17306_+	pH-dependent sodium/proton antiporter	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	50.3	4.9e-89
NP_705976.2|17371_18271_+	transcriptional activator NhaR	NA	NA	NA	NA	NA
NP_705977.1|18683_19079_-	insertion element IS1 protein InsB	NA	Q71TF0	Escherichia_phage	90.8	6.3e-65
NP_705978.1|19105_19381_-	insertion element IS1 protein InsA	NA	Q71TE9	Escherichia_phage	93.4	6.6e-45
>prophage 2
NC_004337	Shigella flexneri 2a str. 301 chromosome, complete genome	4607202	203274	267434	4607202	coat,tRNA,terminase,transposase,head	Escherichia_phage(28.57%)	62	NA	NA
NP_706133.1|203274_204573_+|tRNA	tRNA(Ile)-lysidine synthetase	tRNA	NA	NA	NA	NA
NP_706134.1|204621_204882_-	Rho-binding antiterminator	NA	NA	NA	NA	NA
NP_706135.1|204868_205087_-	hypothetical protein	NA	NA	NA	NA	NA
NP_706136.1|205234_205780_+	hypothetical protein	NA	NA	NA	NA	NA
NP_706137.1|205776_206199_+	hypothetical protein	NA	NA	NA	NA	NA
NP_706138.1|206212_206923_+	copper homeostasis and adhesion lipoprotein	NA	NA	NA	NA	NA
NP_706139.2|207077_207902_-	hypothetical protein	NA	NA	NA	NA	NA
NP_706140.2|207954_209673_-|tRNA	prolyl-tRNA synthetase	tRNA	NA	NA	NA	NA
NP_706141.1|209783_210491_-	hypothetical protein	NA	NA	NA	NA	NA
NP_706142.1|210487_210892_-	outer membrane lipoprotein	NA	NA	NA	NA	NA
NP_706143.1|211009_211825_-	DL-methionine transporter substrate-binding protein	NA	NA	NA	NA	NA
NP_706144.1|211864_212518_-	DL-methionine transporter permease	NA	NA	NA	NA	NA
NP_706145.1|212510_213542_-	DL-methionine transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.7	3.6e-35
NP_706146.1|213729_214305_+	D,D-heptose 1,7-bisphosphate phosphatase	NA	NA	NA	NA	NA
NP_706147.1|220421_221225_+	2,5-diketo-D-gluconate reductase B	NA	A0A1V0SDE7	Indivirus	36.2	1.6e-38
NP_706148.1|221263_222610_-|transposase	insertion sequence IS4 transposase InsG	transposase	NA	NA	NA	NA
NP_706149.1|222659_223574_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
NP_706150.1|223814_224615_+	hypothetical protein	NA	NA	NA	NA	NA
NP_706151.2|224842_225463_+	biotin synthase	NA	NA	NA	NA	NA
NP_706152.2|225510_226857_-	membrane-bound lytic murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	35.1	3.7e-08
NP_706153.1|226928_227684_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
NP_706154.1|227714_228440_+	hypothetical protein	NA	NA	NA	NA	NA
NP_706155.3|228436_229015_-	RNase HI	NA	J9Q745	Salmonella_phage	58.7	2.9e-50
NP_706156.2|228968_229700_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	38.6	7.6e-40
NP_706157.1|230039_231086_-	hypothetical protein	NA	NA	NA	NA	NA
NP_706159.1|231655_233539_-	outer membrane usher protein	NA	NA	NA	NA	NA
NP_706160.2|233554_234049_-	hypothetical protein	NA	NA	NA	NA	NA
NP_706164.1|235829_236240_+	IS2 repressor TnpA	NA	Q76S41	Shigella_phage	99.2	4.1e-59
NP_706165.1|236197_237103_+|transposase	IS2 transposase TnpB	transposase	Q9ZXG3	Shigella_phage	99.3	1.7e-177
NP_706166.1|237159_237447_-	hypothetical protein	NA	A0A1P8DTP0	Salmonella_phage	60.0	1.8e-29
NP_706170.1|238840_239743_+|terminase	terminase large subunit	terminase	I1TEI5	Salmonella_phage	99.3	6.0e-180
NP_706171.2|239743_241909_+	packaging glycoprotein	NA	A0A2D1GLJ6	Escherichia_phage	99.2	0.0e+00
NP_706172.1|241922_242834_+	scaffolding protein	NA	A0A2D1GLN7	Escherichia_phage	99.0	2.0e-159
NP_706173.1|242833_244129_+|coat	coat protein	coat	A0A2D1GLV2	Escherichia_phage	98.4	1.5e-240
NP_706174.2|244173_244404_+	bacteriophage protein	NA	A0A2D1GLK1	Escherichia_phage	69.3	1.2e-23
NP_706175.1|244381_244882_+	DNA stabilization protein	NA	G8EYJ2	Enterobacteria_phage	99.4	6.5e-91
NP_706176.1|244881_246300_+	packaged DNA stabilization protein	NA	Q9AYZ4	Salmonella_phage	98.7	1.2e-272
NP_706177.1|246299_247148_+	packaged DNA stabilization protein	NA	Q716G6	Shigella_phage	98.6	2.1e-102
NP_706178.2|247147_247603_+|head	head assembly protein	head	A0A2D1GLX4	Escherichia_phage	99.3	8.8e-87
NP_706179.1|247605_248298_+	DNA transfer protein	NA	G5DA80	Enterobacteria_phage	99.6	2.1e-111
NP_706180.1|248307_249639_+	prophage DNA injection protein	NA	A0A2D1GLX5	Escherichia_phage	99.8	3.1e-217
NP_706181.2|249639_251370_+	DNA transfer protein	NA	A0A088CQ71	Enterobacteria_phage	97.9	6.8e-281
NP_706182.1|251495_251822_+	insertion sequence element IS629 protein	NA	Q6H9S4	Enterobacteria_phage	96.3	1.6e-53
NP_706184.1|252755_253094_-	hypothetical protein	NA	NA	NA	NA	NA
NP_706185.1|253194_254679_-	alkaline phosphatase	NA	NA	NA	NA	NA
NP_706186.1|254710_254971_-	anti-RssB factor	NA	NA	NA	NA	NA
YP_008439229.1|255152_255356_-	hypothetical protein	NA	NA	NA	NA	NA
NP_706187.1|255433_256528_+	D-alanyl-alanine synthetase A	NA	NA	NA	NA	NA
NP_706188.2|256551_256791_-	hypothetical protein	NA	NA	NA	NA	NA
NP_706189.1|257023_257332_+	hypothetical protein	NA	NA	NA	NA	NA
NP_706190.1|257390_258485_-	hypothetical protein	NA	NA	NA	NA	NA
NP_706191.2|258497_259718_-	microcin B17 transporter	NA	NA	NA	NA	NA
NP_706192.1|260069_261227_+	beta-lactam binding protein AmpH	NA	A0A2H4JAN9	uncultured_Caudovirales_phage	22.1	3.9e-06
NP_706193.1|261227_261776_-	hypothetical protein	NA	NA	NA	NA	NA
NP_706194.1|262365_263178_-	hypothetical protein	NA	U5P429	Shigella_phage	93.0	5.5e-148
NP_706195.1|263451_264270_-	insertion sequence element IS600 protein	NA	A0A0P0I4A4	Acinetobacter_phage	44.9	2.9e-64
NP_706196.1|264305_264608_-|transposase	insertion sequence element IS600 transposase	transposase	NA	NA	NA	NA
NP_706197.1|264840_265410_-	hypothetical protein	NA	NA	NA	NA	NA
NP_706198.1|265384_266290_-|transposase	IS2 transposase TnpB	transposase	Q9ZXG3	Shigella_phage	99.3	7.4e-178
NP_706199.3|266247_266658_-	IS2 repressor TnpA	NA	Q76S41	Shigella_phage	100.0	1.4e-59
NP_706200.1|266736_267012_+	insertion element IS1 protein InsA	NA	Q71TE9	Escherichia_phage	93.4	6.6e-45
NP_706201.1|267038_267434_+	insertion element IS1 protein InsB	NA	Q71TF0	Escherichia_phage	91.6	2.8e-65
>prophage 3
NC_004337	Shigella flexneri 2a str. 301 chromosome, complete genome	4607202	306598	334061	4607202	transposase,integrase,tail	Shigella_phage(46.15%)	29	311231:311290	328080:328139
NP_706241.2|306598_307654_-	outer membrane phosphoporin protein E	NA	Q1MVN1	Enterobacteria_phage	60.9	3.5e-118
NP_706242.1|307829_308105_+	insertion element IS1 protein InsA	NA	Q71TE9	Escherichia_phage	92.3	1.9e-44
NP_706243.1|308131_308527_+	insertion element IS1 protein InsB	NA	Q71TF0	Escherichia_phage	92.4	2.0e-66
NP_706244.2|308717_309821_+	gamma-glutamyl kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.1	4.1e-61
NP_706245.1|309832_311086_+	gamma-glutamyl phosphate reductase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	5.8e-96
311231:311290	attL	ATTCGTAATGCGAAGGTCGTAGGTTCGACTCCTATTATCGGCACCATTTAAATCAATAAG	NA	NA	NA	NA
NP_706246.1|311290_311755_-|integrase	phage integrase	integrase	U5P434	Shigella_phage	96.1	3.5e-83
NP_706247.1|311781_312600_-	insertion sequence element IS600 protein	NA	A0A0P0I4A4	Acinetobacter_phage	44.9	2.9e-64
NP_706248.1|312635_312938_-|transposase	insertion sequence element IS600 transposase	transposase	NA	NA	NA	NA
NP_706249.1|312994_313720_-|integrase	phage integrase	integrase	U5P434	Shigella_phage	98.7	2.1e-135
NP_706250.1|313946_314252_-	hypothetical protein	NA	U5P0J0	Shigella_phage	100.0	6.8e-51
NP_706251.1|314251_314629_-	bacteriophage protein	NA	U5P092	Shigella_phage	99.0	1.8e-53
NP_706253.1|315477_315804_-	insertion sequence element IS629 protein	NA	Q6H9S4	Enterobacteria_phage	95.4	1.3e-52
NP_706254.1|316046_316349_+|transposase	insertion sequence element IS600 transposase	transposase	NA	NA	NA	NA
NP_706255.1|316384_317203_+	insertion sequence element IS600 protein	NA	A0A0P0I4A4	Acinetobacter_phage	44.9	1.7e-64
NP_706257.1|317866_318229_+	flippase	NA	U5P0S6	Shigella_phage	99.2	2.3e-58
NP_706258.1|318225_319155_+	bactoprenol glucosyl transferase	NA	S5FKN0	Shigella_phage	100.0	6.0e-175
NP_706259.1|319151_320612_+	glucosyl transferase II	NA	O21944	Shigella_phage	99.2	4.3e-268
NP_706260.1|321001_322192_-	hypothetical protein	NA	S5FM71	Shigella_phage	99.5	3.7e-225
NP_706261.1|322642_323692_+	hypothetical protein	NA	S5FNR8	Shigella_phage	99.4	4.1e-196
NP_706262.1|324464_324899_-|tail	phage tail fiber protein	tail	S5FXM8	Shigella_phage	100.0	1.9e-78
NP_706263.1|324870_325521_-	bacteriophage protein	NA	S5FKM2	Shigella_phage	100.0	1.2e-116
NP_706264.1|325573_326392_-	insertion sequence element IS600 protein	NA	A0A0P0I4A4	Acinetobacter_phage	44.9	4.5e-65
NP_706265.1|326427_326730_-|transposase	insertion sequence element IS600 transposase	transposase	NA	NA	NA	NA
NP_706266.1|326915_328079_+|integrase	phage integrase	integrase	U5P434	Shigella_phage	99.5	4.5e-228
NP_706267.1|328427_329600_+	acyltransferase	NA	A0A088CPR9	Enterobacteria_phage	99.5	1.1e-210
328080:328139	attR	CTTATTGATTTAAATGGTGCCGATAATAGGAGTCGAACCTACGACCTTCGCATTACGAAT	NA	NA	NA	NA
NP_706269.1|330403_331222_-	insertion sequence element IS600 protein	NA	A0A0P0I4A4	Acinetobacter_phage	44.9	1.7e-64
NP_706270.1|331257_331620_-|transposase	insertion sequence element IS600 transposase	transposase	A0A0N7BTS3	Escherichia_phage	96.2	4.6e-06
NP_706272.1|332468_332795_-	insertion sequence element IS629 protein	NA	Q6H9S4	Enterobacteria_phage	92.6	5.6e-51
NP_706273.1|332945_334061_+	diguanylate cyclase AdrA	NA	A0A127AWB9	Bacillus_phage	34.5	1.5e-18
>prophage 4
NC_004337	Shigella flexneri 2a str. 301 chromosome, complete genome	4607202	386124	452093	4607202	transposase,protease	Bacillus_phage(20.0%)	58	NA	NA
NP_706325.1|386124_386799_-|transposase	insertion sequence element ISSfl4 transposase	transposase	A0A0P0ZCV4	Stx2-converting_phage	30.1	5.8e-10
NP_706326.1|387168_388644_-	muropeptide transporter	NA	NA	NA	NA	NA
NP_706327.4|388687_389368_-	polymerase/proteinase	NA	NA	NA	NA	NA
NP_706328.3|389537_389888_+	murein genes regulator	NA	NA	NA	NA	NA
NP_706329.2|389896_390085_+	hypothetical protein	NA	NA	NA	NA	NA
NP_706330.1|390231_391530_+	trigger factor	NA	NA	NA	NA	NA
NP_706331.2|391776_392400_+|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	63.9	2.9e-64
NP_706332.1|392525_393800_+|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	56.4	8.7e-132
NP_706333.2|393987_396342_+|protease	DNA-binding ATP-dependent protease La	protease	A0A0R6PGP8	Moraxella_phage	52.3	1.0e-223
NP_706334.1|396550_396823_+	transcriptional regulator HU subunit beta	NA	A7KV42	Bacillus_phage	58.4	1.1e-20
NP_706335.1|397014_398886_+	periplasmic folding chaperone	NA	NA	NA	NA	NA
NP_706336.1|399036_399408_+	hypothetical protein	NA	NA	NA	NA	NA
NP_706337.1|399501_399900_+	hypothetical protein	NA	NA	NA	NA	NA
NP_706338.1|399951_400647_-	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	68.0	1.9e-88
NP_706339.3|400711_402136_-	transporter	NA	NA	NA	NA	NA
NP_706340.1|402491_403322_+	thiamin pyrimidine pyrophosphate hydrolase	NA	NA	NA	NA	NA
NP_706341.2|403388_403934_+	LRP-like transcriptional regulator	NA	NA	NA	NA	NA
NP_706342.1|403963_405736_+	multidrug transporter membrane protein\ATP-binding protein	NA	W8CYL7	Bacillus_phage	28.3	3.7e-48
NP_706343.2|405728_407510_+	multidrug transporter membrane protein\ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.0	3.7e-40
NP_706344.2|407690_408029_+	nitrogen regulatory protein P-II 2	NA	NA	NA	NA	NA
NP_706345.1|408058_409345_+	ammonium transporter	NA	NA	NA	NA	NA
NP_706346.2|409393_410254_-	acyl-CoA thioesterase II	NA	NA	NA	NA	NA
NP_706347.1|410471_411044_+	hypothetical protein	NA	NA	NA	NA	NA
NP_706348.1|411136_412483_+|transposase	insertion sequence IS4 transposase InsG	transposase	NA	NA	NA	NA
NP_706349.2|412512_412824_-	hypothetical protein	NA	NA	NA	NA	NA
NP_706350.1|413202_413556_+	hypothetical protein	NA	NA	NA	NA	NA
NP_706351.2|413597_415148_-	hypothetical protein	NA	NA	NA	NA	NA
NP_706352.2|415311_415782_-	hypothetical protein	NA	NA	NA	NA	NA
NP_706353.2|416620_416839_-	gene expression modulator	NA	NA	NA	NA	NA
NP_706354.1|416864_417239_-	Hha toxicity attenuator	NA	NA	NA	NA	NA
NP_706355.1|417784_420934_-	multidrug efflux system protein AcrB	NA	S5VTK5	Leptospira_phage	23.9	1.1e-53
NP_706356.2|420956_422150_-	multidrug efflux system transporter AcrA	NA	NA	NA	NA	NA
NP_706357.1|422291_422939_+	DNA-binding transcriptional repressor AcrR	NA	NA	NA	NA	NA
NP_706358.1|423066_426429_+	hypothetical protein	NA	NA	NA	NA	NA
NP_706359.1|426640_426802_-	hypothetical protein	NA	NA	NA	NA	NA
NP_706360.1|426815_427343_-	primosomal replication protein N''	NA	NA	NA	NA	NA
NP_706361.1|427412_427790_+	hypothetical protein	NA	NA	NA	NA	NA
NP_706362.2|427942_428494_+	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	47.3	3.7e-31
NP_706363.1|428622_430548_+	DNA polymerase III subunits gamma and tau	NA	A0A1L2BWV7	Bacteriophage	41.5	5.1e-43
NP_706364.2|430600_430930_+	hypothetical protein	NA	NA	NA	NA	NA
NP_706365.1|430929_431535_+	recombination protein RecR	NA	NA	NA	NA	NA
NP_706366.1|431644_433519_+	heat shock protein 90	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	38.0	1.8e-117
NP_706367.2|433699_434344_+	adenylate kinase	NA	NA	NA	NA	NA
NP_706368.1|434475_435438_+	ferrochelatase	NA	NA	NA	NA	NA
NP_706369.1|435575_436394_-	acetylesterase	NA	L7RDF8	Acanthamoeba_polyphaga_moumouvirus	25.8	2.5e-15
NP_706370.1|436545_437850_+	inosine/guanosine kinase	NA	NA	NA	NA	NA
NP_706371.1|437982_439659_-	cation:proton antiport protein	NA	NA	NA	NA	NA
NP_706372.1|439896_441117_-	fosmidomycin resistance protein	NA	NA	NA	NA	NA
NP_706373.1|441334_442987_+	bifunctional UDP-sugar hydrolase/5'-nucleotidase	NA	NA	NA	NA	NA
NP_706374.1|443023_443503_-	hypothetical protein	NA	NA	NA	NA	NA
NP_706375.1|443706_444501_-	ligase	NA	NA	NA	NA	NA
NP_706376.1|444584_444980_+	hypothetical protein	NA	A0A222YWD7	Escherichia_phage	74.5	5.9e-39
NP_706377.1|445194_447699_-	copper exporting ATPase	NA	A0A218MNH6	uncultured_virus	37.9	3.8e-115
NP_706378.1|447960_448893_+	glutaminase	NA	NA	NA	NA	NA
NP_706379.1|448895_450188_+	amino acid/amine transport protein	NA	NA	NA	NA	NA
NP_706380.1|450312_450720_+	DNA-binding transcriptional regulator CueR	NA	NA	NA	NA	NA
NP_706381.2|450720_451176_-	hypothetical protein	NA	NA	NA	NA	NA
NP_706382.1|451175_452093_-|protease	protease	protease	NA	NA	NA	NA
>prophage 5
NC_004337	Shigella flexneri 2a str. 301 chromosome, complete genome	4607202	656763	747734	4607202	tail,tRNA,terminase,transposase,integrase,capsid,head	Enterobacteria_phage(31.37%)	90	709946:710005	717397:717797
NP_706551.1|656763_658188_+|tRNA	(dimethylallyl)adenosine tRNA methylthiotransferase	tRNA	NA	NA	NA	NA
NP_706552.2|658301_659381_+	pho regulon ATP-binding protein	NA	A0A0S0MVD6	Pseudomonas_phage	46.6	4.3e-47
NP_706553.1|659377_659845_+	metal-binding heat shock protein	NA	NA	NA	NA	NA
NP_706554.1|659934_660813_+	magnesium/cobalt efflux protein CorC	NA	NA	NA	NA	NA
NP_706555.1|660837_662376_+	apolipoprotein N-acyltransferase	NA	NA	NA	NA	NA
NP_706556.2|662772_663681_+	glutamate and aspartate transporter subunit	NA	NA	NA	NA	NA
NP_706557.1|663850_664591_+	glutamate/aspartate transport system permease	NA	NA	NA	NA	NA
NP_706558.1|664590_665265_+	glutamate/aspartate transport system permease GltK	NA	NA	NA	NA	NA
NP_706559.1|665264_665990_+	glutamate/aspartate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.6	1.7e-31
NP_706560.2|666107_667043_+	ribonucleoside hydrolase 1	NA	NA	NA	NA	NA
NP_706561.1|668856_670308_-	hypothetical protein	NA	NA	NA	NA	NA
NP_706562.1|670304_671012_-|tRNA	tRNA ligase	tRNA	NA	NA	NA	NA
NP_706563.1|671113_671668_+	hypothetical protein	NA	NA	NA	NA	NA
NP_706564.1|671677_673105_-	hypothetical protein	NA	NA	NA	NA	NA
NP_706565.1|673101_673809_-	hypothetical protein	NA	NA	NA	NA	NA
NP_706566.1|673966_674950_+	hypothetical protein	NA	NA	NA	NA	NA
NP_706567.1|675019_675502_-	hypothetical protein	NA	NA	NA	NA	NA
NP_706568.2|675736_678319_+|tRNA	leucyl-tRNA synthetase	tRNA	A0A2H4PQS0	Staphylococcus_phage	42.3	1.4e-184
NP_706569.1|678333_678915_+	LPS-assembly lipoprotein RlpB	NA	NA	NA	NA	NA
NP_706570.1|678914_679946_+	DNA polymerase III subunit delta	NA	NA	NA	NA	NA
NP_706571.1|679947_680589_+	nicotinic acid mononucleotide adenylyltransferase	NA	NA	NA	NA	NA
NP_706572.2|680612_681224_+	alpha-ribazole-5'-phosphate phosphatase	NA	NA	NA	NA	NA
NP_706573.2|681483_681801_+	hypothetical protein	NA	NA	NA	NA	NA
NP_706574.1|681804_682272_+	23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH	NA	NA	NA	NA	NA
NP_706575.1|682302_684204_+	penicillin-binding protein 2	NA	NA	NA	NA	NA
NP_706576.1|684206_685319_+	cell wall shape-determining protein	NA	NA	NA	NA	NA
NP_706577.1|685329_686418_+	rare lipoprotein A	NA	F5B3X9	Synechococcus_phage	53.2	3.6e-09
NP_706578.1|686556_687768_+	D-alanyl-D-alanine carboxypeptidase subunit A	NA	B6DZZ7	Stx2-converting_phage	47.2	7.5e-101
NP_706579.1|687878_688142_+	hypothetical protein	NA	NA	NA	NA	NA
NP_706580.4|688308_688884_+	lipoate biosynthesis protein LipB	NA	NA	NA	NA	NA
NP_706581.2|689295_690096_+	DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
NP_706582.1|690304_691270_+	lipoyl synthase	NA	NA	NA	NA	NA
NP_706583.1|691370_691574_-	twin arginine translocase E	NA	NA	NA	NA	NA
NP_706584.3|691702_692491_-	amidase	NA	NA	NA	NA	NA
NP_706585.1|692583_692967_+	chromosome condensation membrane protein	NA	A0A2H4J148	uncultured_Caudovirales_phage	53.6	6.8e-24
NP_706586.2|693020_693230_-	cold shock protein CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	2.7e-22
NP_706587.1|693404_693965_-	phospholipid:lipid A palmitoyltransferase	NA	NA	NA	NA	NA
NP_706588.2|694553_695939_+	C4-dicarboxylate transporter DcuC	NA	NA	NA	NA	NA
NP_706589.1|696658_697168_-	repressor protein	NA	NA	NA	NA	NA
NP_706590.2|697730_699185_+|transposase	phage transposase	transposase	C9DGL1	Escherichia_phage	97.1	1.6e-283
NP_706591.1|699246_699549_+|transposase	insertion sequence element IS600 transposase	transposase	NA	NA	NA	NA
NP_706592.1|699584_700403_+	insertion sequence element IS600 protein	NA	A0A0P0I4A4	Acinetobacter_phage	44.9	2.9e-64
NP_706593.1|700414_700690_+	hypothetical protein	NA	NA	NA	NA	NA
NP_706594.1|700686_701628_-	bacteriophage protein	NA	A0A0M3ULD3	Salmonella_phage	85.6	2.3e-153
NP_706596.1|702132_703353_-	bacteriophage protein	NA	A0A0M4R5A6	Salmonella_phage	85.6	2.5e-192
NP_706597.3|703356_704100_-	bacteriophage protein	NA	A0A0M4REK0	Salmonella_phage	84.4	5.3e-89
NP_706598.1|703990_705457_-	bacteriophage protein	NA	A0A0M4S6U1	Salmonella_phage	91.0	9.6e-260
NP_706600.1|706201_707107_-|transposase	IS2 transposase TnpB	transposase	Q9ZXG3	Shigella_phage	99.0	3.7e-177
NP_706601.3|707064_707475_-	IS2 repressor TnpA	NA	Q76S41	Shigella_phage	99.2	4.1e-59
NP_706602.2|707505_708129_-	bacteriophage protein	NA	K4NXU1	Acinetobacter_phage	73.8	2.9e-88
NP_706603.1|708139_708904_-	bacteriophage protein	NA	G8C7P2	Escherichia_phage	55.4	7.0e-12
NP_706604.1|709098_709611_+	hypothetical protein	NA	NA	NA	NA	NA
709946:710005	attL	TGAAGTGGCACACTGAATTTGGCCACCTGAACAGAGGTGATATGCTCACCTCAGAACAAC	NA	NA	NA	NA
NP_706605.1|709981_710320_+|transposase	insertion sequence element IS911 transposase InsN	transposase	Q716C1	Shigella_phage	100.0	9.5e-46
NP_706606.1|710346_711186_+|integrase	insertion sequence element IS911 integrase core domain-containing protein	integrase	Q716C2	Shigella_phage	99.6	1.3e-168
NP_706607.1|711214_711637_+	bacteriophage protein	NA	A0A0U2S606	Escherichia_phage	63.4	9.4e-43
NP_706608.1|712949_713768_-	insertion sequence element IS600 protein	NA	A0A0P0I4A4	Acinetobacter_phage	44.9	2.9e-64
NP_706609.1|713803_714106_-|transposase	insertion sequence element IS600 transposase	transposase	NA	NA	NA	NA
NP_706610.1|714381_716241_+	bacteriophage protein	NA	B0FEC9	Escherichia_phage	98.0	0.0e+00
NP_706611.1|716215_717055_-|integrase	insertion sequence element IS911 integrase core domain-containing protein	integrase	Q716C2	Shigella_phage	99.6	1.3e-168
NP_706612.1|717081_717420_-|transposase	insertion sequence element IS911 transposase InsN	transposase	Q716C1	Shigella_phage	100.0	9.5e-46
NP_706613.2|717476_718355_+	replication protein DnaC	NA	Q8W641	Enterobacteria_phage	95.6	3.0e-139
717397:717797	attR	GTTGTTCTGAGGTGAGCATATCACCTCTGTTCAGGTGGCCAAATTCAGTGTGCCACTTCAGACATTCTGAGGTGACAGCGATGATGACGTTTAACCTGCGTGAACAACAAAAAAGACTACAGGCGCGAATGGATGAGTTACGGGCAGAGATTGCATTTGCTCAGAAGGGCGAAAAGCCATGGCCTTATCGTTCCTGCCTGATGCGTGAAGGTCGCGGATATTGCGAAAAACATGGCGAATATCACACGCATATACTGGTGTGGAGCGATCGTAATGGCGAGGACAGAGAAGAAATTTCATGCTGCCCTGACTGCTTAATCGCTGAGGCCAACGATTTGACCATGGAGCTGTCGTCCATCAAGGCGGAAGAGCTGACTGATAACGCCGGAATTGCCCTGCGT	NA	NA	NA	NA
NP_706614.1|718351_719743_+	helicase	NA	Q8W640	Enterobacteria_phage	95.7	3.6e-256
NP_706615.1|719739_719997_+	bacteriophage protein	NA	Q8W639	Enterobacteria_phage	93.8	1.1e-33
NP_706616.2|720284_720665_+	Q protein	NA	A0A088CD47	Shigella_phage	87.9	8.2e-62
NP_706617.1|721467_721683_+	S protein	NA	M1FN85	Enterobacteria_phage	94.4	2.2e-32
NP_706618.1|721686_722316_+	bacteriophage protein	NA	Q08JA0	Stx2-converting_phage	57.6	4.7e-30
NP_706619.3|722381_722915_+	endolysin R of prophage CP-933V	NA	K7PLY1	Enterobacteria_phage	98.3	1.6e-100
NP_706620.2|722911_723316_+	endopeptidase	NA	Q9AZ06	Salmonella_phage	96.3	1.6e-63
NP_706621.1|723377_723680_+|transposase	insertion sequence element IS600 transposase	transposase	NA	NA	NA	NA
NP_706624.1|724599_724926_-	insertion sequence element IS629 protein	NA	Q6H9S4	Enterobacteria_phage	93.5	2.5e-51
NP_706625.1|725010_725829_+	insertion sequence element IS600 protein	NA	A0A0P0I4A4	Acinetobacter_phage	45.2	1.5e-65
NP_706626.1|725856_726180_+|terminase	DNA packaging protein of prophage; terminase small subunit	terminase	NA	NA	NA	NA
NP_706631.1|729845_731351_+|head,tail	head-tail preconnector gp5	head,tail	A0A2I6TC87	Escherichia_phage	53.0	4.3e-98
NP_706632.1|731387_731735_+|capsid	capsid protein small subunit	capsid	A0A2R9YJN3	Escherichia_phage	55.9	6.4e-21
NP_706633.1|731792_732821_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	62.8	1.8e-116
NP_706634.2|732872_733259_+	DNA-packaging protein	NA	NA	NA	NA	NA
NP_706635.1|733270_733648_+|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	57.3	2.5e-31
NP_706636.2|733634_734219_+|tail	prophage CP-933K tail protein	tail	A5LH33	Enterobacteria_phage	87.6	6.0e-88
NP_706637.1|734215_734617_+|tail	prophage CP-933K tail protein	tail	A0A291AWY2	Escherichia_phage	94.0	1.1e-69
NP_706638.1|734621_735368_+|tail	prophage CP-933K tail protein	tail	A5LH35	Enterobacteria_phage	96.3	3.4e-128
NP_706639.1|735408_735813_+|tail	prophage CP-933K tail protein	tail	A5LH36	Enterobacteria_phage	92.2	5.1e-62
NP_706640.1|735821_736151_+|tail	prophage CP-933K tail protein	tail	A5LH37	Enterobacteria_phage	99.1	1.3e-55
NP_706641.1|736122_739164_+|tail	tail length tape measure protein	tail	A0A291AWX1	Escherichia_phage	86.5	0.0e+00
NP_706642.1|739163_739493_+|tail	minor tail protein	tail	A5LH39	Enterobacteria_phage	97.2	2.4e-57
NP_706643.1|739492_740191_+|tail	minor tail protein	tail	A0A0K2FJ01	Enterobacteria_phage	89.7	8.4e-121
NP_706644.1|740195_740939_+|tail	tail assembly protein	tail	K7PLW1	Enterobacteria_phage	94.7	6.8e-145
NP_706645.1|740902_741478_+|tail	phage tail protein	tail	A5LH42	Enterobacteria_phage	84.5	1.4e-81
NP_706646.1|741538_745018_+	host specificity protein	NA	A5LH43	Enterobacteria_phage	87.3	0.0e+00
NP_706647.1|745085_745685_+	membrane protein	NA	H6WZM8	Escherichia_phage	93.0	1.8e-103
NP_706649.1|747110_747734_+|tail	prophage CP-933K tail protein	tail	A0A0U2QQK4	Escherichia_phage	75.9	5.1e-77
>prophage 6
NC_004337	Shigella flexneri 2a str. 301 chromosome, complete genome	4607202	836693	966062	4607202	transposase,protease,integrase,tRNA	Escherichia_phage(20.0%)	111	867208:867267	932413:932595
NP_706730.1|836693_837902_-|transposase	insertion element iso-IS10R transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	100.0	1.8e-235
NP_706731.1|837953_838661_+	nitroreductase A	NA	NA	NA	NA	NA
NP_706732.1|838721_839624_+	ribosomal protein S6 modification protein	NA	I3ULC9	Synechococcus_phage	34.4	1.7e-36
NP_706733.2|839711_840188_+	sensory transduction regulator	NA	NA	NA	NA	NA
NP_706734.2|840539_841652_+	putrescine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
NP_706735.3|841665_842880_+	putrescine ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.0	2.6e-29
NP_706736.1|842889_843843_+	putrescine ABC transporter permease	NA	NA	NA	NA	NA
NP_706737.2|843839_844685_+	putrescine ABC transporter permease	NA	NA	NA	NA	NA
NP_706738.2|844744_845233_+	hypothetical protein	NA	NA	NA	NA	NA
NP_706739.1|845273_846401_+	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A1X9I6F4	Streptococcus_phage	27.6	3.5e-28
NP_706740.2|846575_847307_-	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
NP_706741.1|847598_848267_-	arginine transporter permease subunit ArtM	NA	NA	NA	NA	NA
NP_706742.1|848266_848983_-	arginine transporter permease subunit ArtQ	NA	NA	NA	NA	NA
NP_706743.1|848989_849721_-	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
NP_706744.2|849738_850467_-	arginine transporter ATP-binding subunit	NA	G9BWD6	Planktothrix_phage	36.7	6.0e-29
NP_706745.2|850684_851200_-	lipoprotein	NA	NA	NA	NA	NA
NP_706746.2|851848_853618_+	hypothetical protein	NA	NA	NA	NA	NA
NP_706747.1|853828_854152_+	hypothetical protein	NA	NA	NA	NA	NA
NP_706748.1|854148_854979_+	regulator	NA	A0A1B0UZW5	Roseobacter_phage	30.0	3.3e-07
NP_706749.2|854975_856025_-	nucleotide di-P-sugar epimerase or dehydratase	NA	NA	NA	NA	NA
NP_706750.2|856087_857518_-	hypothetical protein	NA	NA	NA	NA	NA
NP_706751.1|857528_858530_-	L-threonine aldolase	NA	NA	NA	NA	NA
NP_706752.1|858566_860285_-	pyruvate dehydrogenase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	24.1	1.8e-31
NP_706753.2|860417_861386_-	HCP oxidoreductase, NADH-dependent	NA	NA	NA	NA	NA
NP_706754.3|861397_863056_-	prismane HCP protein	NA	NA	NA	NA	NA
NP_706755.1|863193_864141_-	surface protein	NA	NA	NA	NA	NA
NP_706756.1|864218_865124_-|transposase	IS2 transposase TnpB	transposase	Q9ZXG3	Shigella_phage	99.3	1.7e-177
NP_706757.1|865081_865492_-	IS2 repressor TnpA	NA	Q76S41	Shigella_phage	99.2	4.1e-59
NP_706758.2|865889_866585_-	aquaporin Z	NA	NA	NA	NA	NA
NP_706759.2|866636_867140_-	insertion element IS1 protein InsB	NA	U5P0U6	Shigella_phage	91.9	2.2e-83
NP_706760.1|867058_867334_-	insertion element IS1 protein InsA	NA	Q71TE9	Escherichia_phage	92.3	2.5e-44
867208:867267	attL	ACTGTAGTTGCCATGTTTTACGGCAATGAGAGCAGAGATAGCGCTGATGTCCGGCAGTGC	NA	NA	NA	NA
NP_706761.1|867785_869444_+	hypothetical protein	NA	NA	NA	NA	NA
NP_706762.1|869440_870433_-	hypothetical protein	NA	NA	NA	NA	NA
NP_706763.1|870501_870636_+	hypothetical protein	NA	NA	NA	NA	NA
NP_706764.2|870547_871663_+	macrolide transporter subunit MacA	NA	NA	NA	NA	NA
NP_706765.1|871659_873606_+	macrolide transporter ATP-binding /permease	NA	G9BWD6	Planktothrix_phage	39.6	5.5e-37
NP_706766.1|873678_873903_-	stationary phase/starvation inducible regulatory protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	2.3e-16
NP_706767.1|874225_874546_+|protease	ATP-dependent Clp protease adaptor protein ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
NP_706768.2|874576_876853_+|protease	ATP-dependent Clp protease ATP-binding subunit	protease	A0A223W0B1	Agrobacterium_phage	42.4	6.2e-165
NP_706769.1|877596_877815_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
NP_706770.1|878099_878804_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
NP_706771.1|878845_880567_-	cysteine/glutathione ABC transporter membrane/ATP-binding protein	NA	W8CYL7	Bacillus_phage	25.2	2.2e-21
NP_706772.1|880567_882334_-	cysteine/glutathione ABC transporter membrane/ATP-binding protein	NA	W8CYL7	Bacillus_phage	24.0	4.6e-22
NP_706773.2|882456_883422_-	thioredoxin reductase	NA	A0A2I2L5E1	Orpheovirus	44.3	3.2e-62
NP_706774.2|883965_884460_+	leucine-responsive transcriptional regulator	NA	NA	NA	NA	NA
NP_706775.1|884594_888623_+	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	1.2e-86
NP_706776.1|888774_889389_+	lipoprotein chaperone	NA	NA	NA	NA	NA
NP_706777.1|889399_890743_+	recombination factor protein RarA	NA	G3MBE0	Bacillus_virus	41.0	4.3e-81
NP_706778.1|890833_892126_+|tRNA	seryl-tRNA synthetase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.2	1.5e-94
NP_706780.1|894819_895437_+	anaerobic dimethyl sulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	60.6	3.8e-77
NP_706781.2|895438_896230_+	anaerobic dimethyl sulfoxide reductase subunit C	NA	NA	NA	NA	NA
NP_706782.1|896265_896892_-	hypothetical protein	NA	NA	NA	NA	NA
NP_706783.1|897206_898355_+	MFS family transporter protein	NA	NA	NA	NA	NA
NP_706784.1|898667_899342_+|transposase	insertion sequence element ISSfl4 transposase	transposase	A0A0P0ZCV4	Stx2-converting_phage	30.1	5.8e-10
NP_706785.1|899338_899686_+	insertion sequence element ISSfl4 ORF2	NA	A0A0P0ZDM8	Stx2-converting_phage	73.8	4.1e-44
NP_706786.1|899705_901307_+|transposase	insertion sequence element ISSfl4 transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	61.5	4.9e-148
NP_706788.1|901846_902686_-|integrase	insertion sequence element IS911 integrase core domain-containing protein	integrase	Q716C2	Shigella_phage	99.6	1.3e-168
NP_706789.1|902712_903051_-|transposase	insertion sequence element IS911 transposase InsN	transposase	Q716C1	Shigella_phage	100.0	9.5e-46
NP_706790.1|903198_903489_-	bacteriophage protein	NA	A0A0U2KD41	Escherichia_phage	88.5	9.6e-47
NP_706791.1|903786_904089_+|transposase	insertion sequence element IS600 transposase	transposase	NA	NA	NA	NA
NP_706792.1|904124_904943_+	insertion sequence element IS600 protein	NA	A0A0P0I4A4	Acinetobacter_phage	44.9	6.5e-64
NP_706793.2|904982_905354_-	bacteriophage protein	NA	A0A0U2RT94	Escherichia_phage	93.5	1.2e-62
NP_706794.1|905392_905680_-	hypothetical protein	NA	NA	NA	NA	NA
YP_008439234.1|905929_906142_-	hypothetical protein	NA	A0A0P0ZAX5	Stx2-converting_phage	90.0	4.0e-26
NP_706795.1|906312_906879_-	hypothetical protein	NA	NA	NA	NA	NA
YP_008439235.1|907146_907560_-	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	97.5	4.6e-58
NP_706797.1|907560_907983_-	bacteriophage protein	NA	A0A2I6TCA7	Escherichia_phage	76.6	5.9e-53
NP_706798.1|908889_909522_-	bacteriophage protein	NA	G9L6A8	Escherichia_phage	65.3	1.3e-43
NP_706799.1|909599_910022_-	bacteriophage protein	NA	A0A0U2RXZ9	Escherichia_phage	93.6	3.8e-68
NP_706800.1|910005_910233_-	DNA-binding transcriptional regulator DicC	NA	NA	NA	NA	NA
NP_706801.1|910309_910717_+	transcriptional repressor DicA	NA	I6PD69	Cronobacter_phage	49.6	1.7e-28
NP_706802.2|910919_911075_+	hypothetical protein	NA	M4QQ57	Salicola_phage	53.2	5.2e-07
NP_706803.1|911521_912427_-|transposase	IS2 transposase TnpB	transposase	Q9ZXG3	Shigella_phage	99.0	3.7e-177
NP_706804.3|912384_912795_-	IS2 repressor TnpA	NA	Q76S41	Shigella_phage	100.0	1.4e-59
NP_706805.1|913189_914146_+	bacteriophage protein	NA	A0A0P0ZE80	Stx2-converting_phage	57.0	1.1e-54
NP_706806.1|914659_914962_+|transposase	insertion sequence element IS600 transposase	transposase	NA	NA	NA	NA
NP_706807.1|914997_915816_+	insertion sequence element IS600 protein	NA	A0A0P0I4A4	Acinetobacter_phage	44.5	1.9e-63
NP_706808.1|915840_916485_-	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	96.2	7.3e-111
NP_706809.1|916828_917647_-	insertion sequence element IS600 protein	NA	A0A0P0I4A4	Acinetobacter_phage	44.5	7.2e-63
NP_706810.1|917682_917985_-|transposase	insertion sequence element IS600 transposase	transposase	NA	NA	NA	NA
NP_706811.2|918050_918668_+	bacteriophage protein	NA	A0A0U2QQK4	Escherichia_phage	76.5	5.7e-81
NP_706812.2|921554_922550_+	6-phosphogluconolactonase	NA	NA	NA	NA	NA
NP_706813.2|923832_924780_+	hypothetical protein	NA	NA	NA	NA	NA
NP_706814.2|924918_926289_+	membrane pump protein	NA	NA	NA	NA	NA
NP_706815.2|926471_928652_+	hydratase	NA	NA	NA	NA	NA
NP_706816.1|928792_930076_-	acyl-CoA thioesterase	NA	NA	NA	NA	NA
NP_706818.1|931192_932011_-	insertion sequence element IS600 protein	NA	A0A0P0I4A4	Acinetobacter_phage	44.5	6.5e-64
NP_706819.1|932046_932349_-|transposase	insertion sequence element IS600 transposase	transposase	NA	NA	NA	NA
NP_706820.2|932757_933498_-	pyruvate formate lyase-activating enzyme 1	NA	A0A2P0VNQ0	Tetraselmis_virus	26.5	8.0e-21
932413:932595	attR	ACTGTAGTTGCCATGTTTTACGGCAATGAGAGCAGAGATAGCGCTGATGTCCGGCAGTGCTTTTGCCGTTACGCACCACGCCTTCAGTAGCGGAGCAGGAAGGACATCTGATGGAAATGGAAGCCACGCAAGCACCTTAAAATCACCATCATACACTAAATCAGTAAGTTGGCAGCATTACCG	NA	NA	NA	NA
NP_706821.1|933689_935972_-	formate acetyltransferase 1	NA	A0A2P0VNR5	Tetraselmis_virus	41.2	4.9e-162
NP_706822.2|936026_936884_-	formate transporter	NA	NA	NA	NA	NA
NP_706823.2|937289_939050_-	hypothetical protein	NA	NA	NA	NA	NA
NP_706825.1|940004_941093_+	3-phosphoserine/phosphohydroxythreonine aminotransferase	NA	M1Q1P2	Streptococcus_phage	46.8	3.5e-81
NP_706826.1|941163_942447_+	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
NP_706827.1|942572_943919_+|transposase	insertion sequence IS4 transposase InsG	transposase	NA	NA	NA	NA
NP_706828.2|944054_944819_+	heat shock protein	NA	NA	NA	NA	NA
NP_706829.1|944991_945675_+	cytidylate kinase	NA	NA	NA	NA	NA
NP_706830.1|945785_947459_+	30S ribosomal protein S1	NA	NA	NA	NA	NA
NP_706831.1|947618_947903_+	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	40.2	3.2e-10
NP_706832.1|950405_952154_+	lipid transporter ATP-binding/permease	NA	W8CYL7	Bacillus_phage	29.8	3.3e-57
NP_706833.1|952150_953137_+	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
NP_706834.1|953173_954406_+	hypothetical protein	NA	NA	NA	NA	NA
NP_706835.1|954457_954640_+	hypothetical protein	NA	NA	NA	NA	NA
NP_706836.1|954636_955383_+	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
NP_706837.1|955536_956430_+	hypothetical protein	NA	NA	NA	NA	NA
NP_706838.2|956406_957186_-	hypothetical protein	NA	NA	NA	NA	NA
NP_706839.2|957321_958107_+	S-adenosyl-L-methionine-dependent methyltransferase	NA	NA	NA	NA	NA
NP_706840.1|958103_959426_+	condesin subunit F	NA	NA	NA	NA	NA
NP_706841.2|959433_960111_+	condesin subunit E	NA	NA	NA	NA	NA
NP_706842.1|960110_964571_+	cell division protein MukB	NA	NA	NA	NA	NA
NP_706843.1|964715_966062_+|transposase	insertion sequence IS4 transposase InsG	transposase	NA	NA	NA	NA
>prophage 7
NC_004337	Shigella flexneri 2a str. 301 chromosome, complete genome	4607202	1023691	1081082	4607202	transposase,protease	Escherichia_phage(18.18%)	55	NA	NA
NP_706897.1|1023691_1024279_+|protease	hydrogenase 1 maturation protease	protease	NA	NA	NA	NA
NP_706898.1|1024275_1024674_+	hydrogenase-1 operon protein HyaE	NA	NA	NA	NA	NA
NP_706899.1|1024670_1025660_+	Hydrogenase-1 operon protein hyaF	NA	NA	NA	NA	NA
NP_706901.2|1026166_1027711_+	cytochrome bd-II oxidase subunit 1	NA	NA	NA	NA	NA
NP_706902.1|1027722_1028859_+	cytochrome bd-II oxidase subunit 2	NA	NA	NA	NA	NA
NP_706903.2|1029042_1030341_+	phosphoanhydride phosphorylase	NA	NA	NA	NA	NA
NP_706904.1|1030455_1032402_-	hypothetical protein	NA	NA	NA	NA	NA
NP_706905.3|1032641_1033100_-	phosphatase	NA	NA	NA	NA	NA
NP_706906.2|1033075_1034215_-	polysaccharide export protein Wza	NA	NA	NA	NA	NA
NP_706907.1|1034260_1036357_-	hypothetical protein	NA	NA	NA	NA	NA
NP_706908.1|1036356_1037103_-	hypothetical protein	NA	NA	NA	NA	NA
NP_706909.1|1037099_1037744_-	regulator	NA	NA	NA	NA	NA
NP_706910.2|1037850_1038174_-	hypothetical protein	NA	NA	NA	NA	NA
NP_706911.1|1038597_1038810_-	cold shock-like protein CspH	NA	NA	NA	NA	NA
NP_706912.2|1039107_1039308_+	cold shock protein CspG	NA	A0A1W6JNX5	Morganella_phage	71.2	3.1e-20
NP_706913.1|1039481_1039712_+	cold shock gene	NA	NA	NA	NA	NA
NP_706914.1|1039701_1039875_+	hypothetical protein	NA	NA	NA	NA	NA
NP_706915.2|1039923_1040997_-	hypothetical protein	NA	NA	NA	NA	NA
NP_706916.1|1041098_1043528_-	histidine protein kinase/phosphatase	NA	Q8QKV7	Ectocarpus_siliculosus_virus	33.8	1.6e-25
NP_706917.1|1043892_1044921_+	TMAO reductase system periplasmic protein TorT	NA	NA	NA	NA	NA
NP_706918.1|1044893_1045586_-	DNA-binding transcriptional regulator TorR	NA	W8CYM9	Bacillus_phage	28.0	1.0e-17
NP_706919.2|1045672_1046845_+	trimethylamine N-oxide reductase cytochrome c-type subunit	NA	NA	NA	NA	NA
NP_706920.1|1049587_1049983_-	insertion element IS1 protein InsB	NA	Q71TF0	Escherichia_phage	92.4	2.0e-66
NP_706921.1|1050009_1050285_-	insertion element IS1 protein InsA	NA	Q71TE9	Escherichia_phage	92.3	4.2e-44
NP_706922.2|1050850_1051156_-	chaperone-modulator protein CbpM	NA	NA	NA	NA	NA
NP_706923.1|1051155_1052076_-	curved DNA-binding protein CbpA	NA	A0A1V0SIM1	Klosneuvirus	43.0	4.2e-11
NP_706924.1|1052336_1053593_+	hypothetical protein	NA	NA	NA	NA	NA
NP_706925.2|1053885_1055127_+	glucose-1-phosphatase/inositol phosphatase	NA	NA	NA	NA	NA
NP_706926.1|1055164_1055392_-	hypothetical protein	NA	NA	NA	NA	NA
NP_706927.1|1055412_1056009_-	NAD(P)H:quinone oxidoreductase	NA	NA	NA	NA	NA
NP_706928.1|1056570_1057965_-	transporter	NA	Q9KX94	Enterobacteria_phage	98.4	4.7e-232
NP_706929.2|1057919_1058378_-	hypothetical protein	NA	Q9KX93	Enterobacteria_phage	96.9	1.0e-50
NP_706930.1|1058424_1059015_-	malonic semialdehyde reductase	NA	NA	NA	NA	NA
NP_706931.2|1059024_1059825_-	acetyltransferase	NA	NA	NA	NA	NA
NP_706932.1|1059832_1060219_-	hypothetical protein	NA	NA	NA	NA	NA
NP_706933.1|1060230_1060965_-	synthetase	NA	NA	NA	NA	NA
NP_706934.2|1060922_1062071_-	hypothetical protein	NA	NA	NA	NA	NA
NP_706935.1|1062301_1062940_+	HTH-type transcriptional regulator RutR	NA	NA	NA	NA	NA
NP_706936.1|1063234_1064422_-|transposase	insertion sequence IS91 transposase	transposase	NA	NA	NA	NA
NP_706937.1|1064421_1064844_-	insertion sequence IS91 protein	NA	NA	NA	NA	NA
NP_706938.1|1064942_1065551_+	cytochrome	NA	NA	NA	NA	NA
NP_706939.1|1065608_1066736_+	hypothetical protein	NA	NA	NA	NA	NA
NP_706940.1|1066741_1068007_+	hypothetical protein	NA	NA	NA	NA	NA
NP_706941.1|1068478_1069402_+	hypothetical protein	NA	R4II13	Cronobacter_phage	75.7	1.0e-89
NP_706942.1|1069511_1070378_-|transposase	insertion sequence IS3A transposase InsF	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	2.3e-51
NP_706943.1|1070374_1070683_-|transposase	insertion sequence IS3 transposase InsE	transposase	NA	NA	NA	NA
NP_706944.1|1071265_1072252_+	hypothetical protein	NA	NA	NA	NA	NA
NP_706945.1|1073759_1074497_+	hydrolase	NA	NA	NA	NA	NA
NP_706946.1|1074520_1075075_+	oxidoreductase subunit	NA	NA	NA	NA	NA
NP_706947.2|1075146_1075668_+	hypothetical protein	NA	NA	NA	NA	NA
NP_706948.1|1076771_1077980_-|transposase	insertion element iso-IS10R transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	100.0	1.8e-235
NP_706949.1|1078312_1078702_-	curli assembly protein CsgE	NA	NA	NA	NA	NA
NP_706950.2|1078706_1079357_-	DNA-binding transcriptional regulator CsgD	NA	NA	NA	NA	NA
NP_706951.2|1080110_1080566_+	curlin minor subunit CsgB	NA	NA	NA	NA	NA
NP_706952.1|1080779_1081082_+|transposase	insertion sequence element IS600 transposase	transposase	NA	NA	NA	NA
>prophage 8
NC_004337	Shigella flexneri 2a str. 301 chromosome, complete genome	4607202	1095293	1102070	4607202	transposase,integrase	Shigella_phage(50.0%)	9	1090813:1090827	1108975:1108989
1090813:1090827	attL	ATCCGGCAAAAACAA	NA	NA	NA	NA
NP_706965.1|1095293_1095620_-	insertion sequence element IS629 protein	NA	Q6H9S4	Enterobacteria_phage	96.3	1.6e-53
NP_706966.1|1096015_1096354_+|transposase	insertion sequence element IS911 transposase InsN	transposase	Q716C1	Shigella_phage	100.0	9.5e-46
NP_706967.1|1096380_1097220_+|integrase	insertion sequence element IS911 integrase core domain-containing protein	integrase	Q716C2	Shigella_phage	99.3	6.4e-168
NP_706968.1|1097225_1097729_-	bacteriophage protein	NA	A0A0D4DAW4	Salmonella_phage	74.4	3.0e-35
NP_706969.3|1097747_1098158_+	IS2 repressor TnpA	NA	Q76S41	Shigella_phage	100.0	1.4e-59
NP_706970.1|1098115_1099021_+|transposase	IS2 transposase TnpB	transposase	Q9ZXG3	Shigella_phage	98.7	4.8e-177
NP_706971.1|1099416_1099743_+	insertion sequence element IS629 protein	NA	Q6H9S4	Enterobacteria_phage	96.3	1.6e-53
NP_706973.1|1100913_1101216_+|transposase	insertion sequence element IS600 transposase	transposase	NA	NA	NA	NA
NP_706974.1|1101251_1102070_+	insertion sequence element IS600 protein	NA	A0A0P0I4A4	Acinetobacter_phage	44.5	6.5e-64
1108975:1108989	attR	ATCCGGCAAAAACAA	NA	NA	NA	NA
>prophage 9
NC_004337	Shigella flexneri 2a str. 301 chromosome, complete genome	4607202	1178709	1210174	4607202	tail,terminase,transposase,portal,head,protease	uncultured_Caudovirales_phage(53.85%)	33	NA	NA
NP_707046.2|1178709_1180458_+	bacteriophage P4 DNA primase	NA	Q7M2A8	Enterobacteria_phage	39.5	7.3e-89
NP_707047.3|1180746_1181025_+	bacteriophage protein	NA	NA	NA	NA	NA
NP_707048.3|1181561_1181864_+	bacteriophage protein	NA	NA	NA	NA	NA
NP_707049.2|1183361_1183934_+|head,protease	head maturation protease of prophage CP-933C	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	63.5	1.6e-61
NP_707050.1|1183935_1185147_+|head,portal	head portal protein	head,portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	78.2	6.9e-187
NP_707051.1|1185143_1185482_+|head,tail	head-tail adaptor	head,tail	A0A2H4JHK5	uncultured_Caudovirales_phage	52.7	1.7e-31
NP_707052.1|1185478_1185775_+	bacteriophage protein	NA	A0A2H4JD08	uncultured_Caudovirales_phage	62.2	2.2e-30
NP_707053.3|1185774_1186215_+	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	72.6	2.5e-62
NP_707054.1|1186198_1186381_+	hypothetical protein	NA	NA	NA	NA	NA
NP_707055.1|1186451_1186763_+	bacteriophage protein	NA	A0A2H4JHS3	uncultured_Caudovirales_phage	82.4	1.1e-43
NP_707056.2|1186929_1188408_+|terminase	terminase of prophage CP-933C	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	82.5	1.5e-247
NP_707057.1|1188421_1188703_+	bacteriophage protein	NA	NA	NA	NA	NA
NP_707058.1|1189499_1190960_-	sensor protein PhoQ	NA	NA	NA	NA	NA
NP_707059.1|1190959_1191631_-	DNA-binding transcriptional regulator PhoP	NA	NA	NA	NA	NA
NP_707060.1|1191799_1193170_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	4.7e-107
NP_707061.2|1193173_1193815_-	lysogenization regulator	NA	NA	NA	NA	NA
NP_707062.3|1193850_1195002_-	hypothetical protein	NA	NA	NA	NA	NA
NP_707063.1|1195010_1195472_-	phosphohydrolase	NA	NA	NA	NA	NA
NP_707064.1|1195481_1196105_-	23S rRNA pseudouridine(2457) synthase	NA	NA	NA	NA	NA
NP_707065.1|1196306_1197557_+	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
NP_707066.2|1198441_1199965_+	hypothetical protein	NA	NA	NA	NA	NA
YP_008439239.1|1200060_1200297_+	membrane protein	NA	NA	NA	NA	NA
YP_008439240.1|1200715_1200925_+	ATPase	NA	NA	NA	NA	NA
NP_707067.1|1201041_1203363_+	hypothetical protein	NA	A0A2L1IV18	Escherichia_phage	43.3	1.6e-91
NP_707068.1|1203419_1203755_-	hypothetical protein	NA	NA	NA	NA	NA
NP_707069.2|1203758_1204043_-	hypothetical protein	NA	NA	NA	NA	NA
YP_008439241.1|1204612_1205023_+	hypothetical protein	NA	NA	NA	NA	NA
NP_707070.1|1205394_1205661_-	cell division topological specificity factor MinE	NA	NA	NA	NA	NA
NP_707071.1|1205664_1206477_-	cell division inhibitor MinD	NA	NA	NA	NA	NA
NP_707072.2|1206500_1207196_-	septum formation inhibitor	NA	NA	NA	NA	NA
NP_707073.1|1207919_1208825_-|transposase	IS2 transposase TnpB	transposase	Q9ZXG3	Shigella_phage	99.3	1.7e-177
NP_707074.3|1208782_1209193_-	IS2 repressor TnpA	NA	Q76S41	Shigella_phage	100.0	1.4e-59
NP_707075.1|1209865_1210174_+|transposase	insertion sequence IS3 transposase InsE	transposase	NA	NA	NA	NA
>prophage 10
NC_004337	Shigella flexneri 2a str. 301 chromosome, complete genome	4607202	1387235	1421884	4607202	transposase,integrase,tail	Escherichia_phage(45.16%)	41	1404418:1404477	1421143:1421817
NP_707234.1|1387235_1388432_+|transposase	insertion sequence element ISSfl2 transposase	transposase	NA	NA	NA	NA
NP_707236.1|1388807_1389728_-	hypothetical protein	NA	NA	NA	NA	NA
NP_707237.1|1390344_1391163_-	insertion sequence element IS600 protein	NA	A0A0P0I4A4	Acinetobacter_phage	44.5	1.4e-63
NP_707238.1|1391198_1391501_-|transposase	insertion sequence element IS600 transposase	transposase	NA	NA	NA	NA
NP_707239.1|1392028_1392934_-|transposase	IS2 transposase TnpB	transposase	Q9ZXG3	Shigella_phage	99.3	1.7e-177
NP_707240.3|1392891_1393302_-	IS2 repressor TnpA	NA	Q76S41	Shigella_phage	100.0	1.4e-59
NP_707241.4|1394095_1394842_+	DnaC-like chromosome replication protein	NA	V5UQI5	Shigella_phage	88.8	1.1e-121
NP_707242.1|1394856_1395279_+	bacteriophage protein	NA	A0A2I6TCA7	Escherichia_phage	75.9	1.1e-51
NP_707243.1|1395279_1395693_+	bacteriophage protein	NA	A0A2R2Z307	Escherichia_phage	97.5	4.6e-58
NP_707244.1|1395785_1396004_+	hypothetical protein	NA	A0A1I9LJM2	Stx_converting_phage	90.3	1.2e-28
NP_707245.1|1396005_1396371_+	hypothetical protein	NA	A0A2R2Z2X9	Escherichia_phage	99.2	2.5e-68
NP_707246.1|1396367_1397033_+	hypothetical protein	NA	A0A076G611	Escherichia_phage	44.9	6.1e-36
NP_707247.1|1397032_1397398_+	hypothetical protein	NA	Q08J61	Stx2-converting_phage	53.7	6.1e-30
YP_008439244.1|1397795_1398008_+	regulatory protein	NA	A0A0U2QV81	Escherichia_phage	92.9	8.1e-27
YP_008439245.1|1398244_1398496_+	hypothetical protein	NA	NA	NA	NA	NA
NP_707248.1|1398513_1398909_-	insertion element IS1 protein InsB	NA	NA	NA	NA	NA
NP_707249.1|1398935_1399211_-	insertion element IS1 protein InsA	NA	Q71TE9	Escherichia_phage	92.3	2.5e-44
NP_707250.1|1399344_1399944_+	bacteriophage protein	NA	A0A0U2RT94	Escherichia_phage	94.5	1.4e-108
NP_707251.1|1399943_1400234_+	bacteriophage protein	NA	A0A0U2KD41	Escherichia_phage	89.6	3.3e-47
NP_707252.1|1400230_1400785_+	bacteriophage protein	NA	A0A0U2S606	Escherichia_phage	70.5	3.7e-71
NP_707253.1|1401172_1401475_+|transposase	insertion sequence element IS600 transposase	transposase	NA	NA	NA	NA
NP_707254.1|1401510_1402329_+	insertion sequence element IS600 protein	NA	A0A0P0I4A4	Acinetobacter_phage	44.9	1.1e-63
NP_707256.1|1402921_1403293_+|tail	tail fiber assembly protein	tail	Q8W612	Enterobacteria_phage	82.9	2.6e-52
NP_707257.2|1403316_1404585_+|tail	tail fiber protein	tail	Q8W611	Enterobacteria_phage	43.0	2.2e-74
1404418:1404477	attL	GGGATTTCAGTGCCCAGTACTCCCACCGGAACGTATATAGCATCCCCACAATTTTTCATT	NA	NA	NA	NA
NP_707258.2|1404595_1405159_+	hypothetical protein	NA	A0A0U2QQK4	Escherichia_phage	79.1	4.7e-82
NP_707259.1|1405359_1406217_-	iron transporter inner membrane protein	NA	NA	NA	NA	NA
NP_707260.1|1406213_1407071_-	iron ABC transporter permease	NA	NA	NA	NA	NA
NP_707261.1|1407067_1407895_-	iron ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.5	3.8e-11
NP_707262.2|1407894_1408785_-	iron ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
NP_707263.1|1409935_1410211_+	insertion element IS1 protein InsA	NA	Q71TE9	Escherichia_phage	93.4	6.6e-45
NP_707264.1|1410237_1410633_+	insertion element IS1 protein InsB	NA	NA	NA	NA	NA
NP_707266.2|1411036_1411657_-|integrase	insertion sequence element IS629 integrase core domain-containing protein	integrase	Q6H9S3	Enterobacteria_phage	98.5	2.8e-112
NP_707267.1|1411969_1412296_-	insertion sequence element IS629 protein	NA	Q6H9S4	Enterobacteria_phage	97.2	1.8e-54
NP_707268.2|1412370_1413414_-	bacteriophage protein	NA	I6PCV5	Cronobacter_phage	83.6	8.3e-173
NP_707269.1|1413473_1413794_-	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	83.3	2.5e-40
NP_707271.1|1415036_1416461_-	exodeoxyribonuclease VIII	NA	A0A088CD28	Shigella_phage	59.8	4.5e-153
NP_707272.2|1416560_1416836_-	hypothetical protein	NA	A0A0U2QW85	Escherichia_phage	93.4	4.4e-41
NP_707273.1|1417080_1417302_-	FtsZ inhibitor protein	NA	A0A0U2RTC4	Escherichia_phage	97.3	6.9e-37
NP_707274.1|1417378_1418284_-|transposase	IS2 transposase TnpB	transposase	Q9ZXG3	Shigella_phage	99.3	7.4e-178
NP_707275.1|1418241_1418652_-	IS2 repressor TnpA	NA	Q76S41	Shigella_phage	99.2	4.1e-59
NP_707278.1|1421320_1421884_+	hypothetical protein	NA	A0A0U2QQK4	Escherichia_phage	76.5	6.4e-79
1421143:1421817	attR	GGGATTTCAGTGCCCAGTACTCCCACCGGAACGTATATAGCATCCCCACAATTTTTCATTACGGGATGTTCAGAGCATTCATTACCGGGGTCATATTGCGCCCTGTCCGGGGTGCCGGATGCTCATGTCTCTGGCGCAATGCCCGGGCTTTTTATTCGCACATCGTGAGGAATGCACCGTGGAAATTAAAAAAATCATTAATCCCCGTTATACCGAAAGTGGCGCAGTAGACTGTGACGTTTTTTTTGACGACAGGGACCAGGCAGTCCCCTACACAGCCACCGCTGATGATGTCGCTCCGACGGGTCAGCAAATCTGGCAGGAACTGCAAAGCGGCAAATGGGGTGAGATAGCCCCATTCACTGTGACACCAGAAATGCTGGAAGCGGCCAGAGAGGCCAGACGTCAGGAAATTGAAGCATGGCGCGCAGAACAGGAGGCGAAACCGCTCACGTTTGAATGGAACGGTCGTATCTGGAATGCTGGTCCCGATTCACTGGGCCGCCTGTCCCCGGTAGTCATGCTGGCAAAATCTGTCACAGCACAAACACATATGGCGTGGAGCGATGCCGATAATCAGCAGGTGAAACTGTCGATGCCGGAACTGGAAGAACTGGCGGCAGCAATGGTGCAGGCGCAGGTCGATCGCAACGATGAGATTTATCGCCGTCAGCG	NA	NA	NA	NA
>prophage 11
NC_004337	Shigella flexneri 2a str. 301 chromosome, complete genome	4607202	1574203	1632981	4607202	transposase,integrase	Shigella_phage(29.63%)	58	1632006:1632022	1639804:1639820
NP_707422.1|1574203_1574479_+	insertion element IS1 protein InsA	NA	Q71TE9	Escherichia_phage	93.4	6.6e-45
NP_707423.1|1574505_1574901_+	insertion element IS1 protein InsB	NA	Q71TF0	Escherichia_phage	91.6	2.8e-65
NP_707424.1|1574978_1575797_+	insertion sequence element IS600 protein	NA	A0A0P0I4A4	Acinetobacter_phage	44.9	1.1e-63
YP_008439249.1|1576150_1576312_-	hypothetical protein	NA	Q08JA2	Stx2-converting_phage	91.3	5.4e-15
YP_008439250.1|1576308_1576512_-	hypothetical protein	NA	H6WZJ9	Escherichia_phage	95.2	7.7e-27
NP_707425.1|1576756_1577092_+	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	74.8	5.2e-44
NP_707426.1|1578401_1579223_-	antitermination protein	NA	K7P7B9	Enterobacteria_phage	58.6	6.1e-78
NP_707427.1|1579237_1579594_-	endodeoxyribonuclease RUS	NA	V5URS4	Shigella_phage	62.7	6.1e-35
NP_707428.1|1579606_1580656_-	bacteriophage protein	NA	U5P0K4	Shigella_phage	54.2	9.4e-108
NP_707429.2|1581002_1581251_-	hypothetical protein	NA	NA	NA	NA	NA
YP_008439251.1|1581471_1581627_-	regulatory protein	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
NP_707430.1|1581698_1581986_-	hypothetical protein	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	66.0	1.4e-29
NP_707431.1|1581985_1582225_-	bifunctional antitoxin/transcriptional repressor RelB	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	54.4	1.6e-18
NP_707432.1|1582551_1583265_-|integrase	insertion sequence element IS600 integrase core domain-containing protein	integrase	A0A0P0I4A4	Acinetobacter_phage	47.7	8.4e-60
NP_707433.1|1583405_1583708_-|transposase	insertion sequence element IS600 transposase	transposase	NA	NA	NA	NA
NP_707434.1|1583808_1584789_+	low-affinity transport protein	NA	NA	NA	NA	NA
NP_707435.1|1584877_1586338_+	oxidoreductase	NA	H8ZJP8	Ostreococcus_tauri_virus	29.6	1.1e-42
NP_707436.1|1586373_1586577_-	hypothetical protein	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
NP_707438.2|1587529_1588276_-	malonic semialdehyde reductase	NA	NA	NA	NA	NA
NP_707439.2|1588412_1590458_+	dipeptidyl carboxypeptidase II	NA	NA	NA	NA	NA
NP_707440.1|1590502_1591021_-	hypothetical protein	NA	NA	NA	NA	NA
NP_707441.1|1591924_1592743_+	insertion sequence element IS600 protein	NA	A0A0P0I4A4	Acinetobacter_phage	44.9	2.9e-64
NP_707442.1|1593210_1594329_-	transporter	NA	NA	NA	NA	NA
NP_707443.4|1594691_1595492_+	insertion element IS1 protein InsB	NA	NA	NA	NA	NA
NP_707444.1|1595522_1595741_-	hypothetical protein	NA	NA	NA	NA	NA
NP_707445.2|1595772_1596156_-	DNA-binding transcriptional activator MarA	NA	D0R0F8	Streptococcus_phage	32.3	4.7e-09
NP_707446.4|1596175_1596553_-	multiple antibiotic resistance protein	NA	NA	NA	NA	NA
NP_707447.1|1596821_1597487_+	hypothetical protein	NA	NA	NA	NA	NA
NP_707449.1|1598851_1599967_-	hypothetical protein	NA	NA	NA	NA	NA
NP_707450.1|1601045_1601972_+	glutaminase	NA	NA	NA	NA	NA
NP_707452.2|1602940_1603888_+	hypothetical protein	NA	A0A127AWB9	Bacillus_phage	37.5	7.3e-19
NP_707453.1|1604114_1605566_+	altronate oxidoreductase	NA	NA	NA	NA	NA
NP_707455.1|1607070_1607259_-	hypothetical protein	NA	NA	NA	NA	NA
NP_707456.1|1607408_1608374_+	hypothetical protein	NA	NA	NA	NA	NA
NP_707457.1|1608377_1609136_-	trans-aconitate 2-methyltransferase	NA	NA	NA	NA	NA
NP_707458.1|1609175_1609466_-	autoinducer-2 (AI-2) modifying protein LsrG	NA	NA	NA	NA	NA
NP_707459.1|1609489_1610260_-	autoinducer 2 aldolase	NA	NA	NA	NA	NA
NP_707460.3|1610284_1611124_-|transposase	IS2 transposase TnpB	transposase	Q9ZXG3	Shigella_phage	98.6	2.5e-164
NP_707462.1|1612683_1613637_-	transcriptional regulator LsrR	NA	NA	NA	NA	NA
NP_707463.1|1613885_1615421_+	autoinducer 2 ABC transporter ATP-binding protein LsrA	NA	A0A2H4PQG7	Staphylococcus_phage	30.4	9.8e-21
NP_707464.1|1615414_1616443_+	autoinducer 2 ABC transporter permease LsrC	NA	NA	NA	NA	NA
NP_707465.1|1616442_1617435_+	autoinducer 2 import system permease LsrD	NA	NA	NA	NA	NA
NP_707466.3|1618639_1619050_+	IS2 repressor TnpA	NA	Q76S41	Shigella_phage	100.0	1.4e-59
NP_707467.3|1619098_1619923_+|transposase	IS2 transposase TnpB	transposase	Q9ZXG3	Shigella_phage	96.4	5.9e-158
NP_707468.1|1619972_1620785_-	hypothetical protein	NA	U5P429	Shigella_phage	92.6	3.6e-147
NP_707469.1|1620841_1621126_-	hypothetical protein	NA	U5P4I9	Shigella_phage	92.5	4.6e-33
NP_707470.1|1621196_1622411_-	bifunctional D-altronate/D-mannonate dehydratase	NA	Q6A202	Oenococcus_phage	29.0	2.4e-46
NP_707471.2|1622616_1622943_-	hypothetical protein	NA	A0A218MNG8	uncultured_virus	55.6	7.6e-24
NP_707472.1|1623077_1623419_+	hypothetical protein	NA	NA	NA	NA	NA
NP_707473.4|1624016_1624763_-	hypothetical protein	NA	NA	NA	NA	NA
NP_707474.2|1624834_1625140_+	hypothetical protein	NA	NA	NA	NA	NA
NP_707477.2|1627482_1628472_-	hypothetical protein	NA	NA	NA	NA	NA
NP_707478.1|1628556_1629048_-	hypothetical protein	NA	NA	NA	NA	NA
NP_707479.2|1629368_1629869_-	hypothetical protein	NA	NA	NA	NA	NA
NP_707480.2|1629858_1630374_-	hypothetical protein	NA	NA	NA	NA	NA
NP_707481.1|1630804_1631173_-	hypothetical protein	NA	NA	NA	NA	NA
NP_707482.1|1631584_1632070_-|integrase	integrase	integrase	NA	NA	NA	NA
1632006:1632022	attL	GTTACAATGTCACGTTT	NA	NA	NA	NA
NP_707483.1|1632141_1632981_-|integrase	insertion sequence element IS911 integrase core domain-containing protein	integrase	Q716C2	Shigella_phage	99.6	1.3e-168
NP_707483.1|1632141_1632981_-|integrase	insertion sequence element IS911 integrase core domain-containing protein	integrase	Q716C2	Shigella_phage	99.6	1.3e-168
1639804:1639820	attR	GTTACAATGTCACGTTT	NA	NA	NA	NA
>prophage 12
NC_004337	Shigella flexneri 2a str. 301 chromosome, complete genome	4607202	1802877	1892711	4607202	transposase,protease,integrase,tRNA	Shigella_phage(26.92%)	76	1810908:1810922	1879274:1879674
NP_707628.1|1802877_1804065_+|transposase	insertion sequence IS91 transposase	transposase	NA	NA	NA	NA
NP_707629.1|1804335_1805058_-	colanic acid/biofilm transcriptional regulator	NA	NA	NA	NA	NA
NP_707630.1|1805162_1806359_-	oxidoreductase	NA	NA	NA	NA	NA
NP_707631.1|1806395_1807301_-|transposase	IS2 transposase TnpB	transposase	Q9ZXG3	Shigella_phage	99.0	1.7e-177
NP_707632.3|1807258_1807669_-	IS2 repressor TnpA	NA	Q76S41	Shigella_phage	99.2	5.4e-59
NP_707633.2|1807782_1808301_+	resistance protein	NA	NA	NA	NA	NA
NP_707634.1|1808297_1808747_+	hypothetical protein	NA	NA	NA	NA	NA
NP_707635.1|1808747_1808981_-	hypothetical protein	NA	NA	NA	NA	NA
NP_707636.1|1809066_1809315_-	hypothetical protein	NA	NA	NA	NA	NA
NP_707637.1|1809931_1810741_-	acetyltransferase	NA	A0A2R8FE91	Brazilian_cedratvirus	41.0	5.9e-17
1810908:1810922	attL	TAAAACGATAGTGGC	NA	NA	NA	NA
NP_707638.1|1810950_1812375_-	gamma-aminobutyraldehyde dehydrogenase	NA	NA	NA	NA	NA
1810908:1810922	attL	TAAAACGATAGTGGC	NA	NA	NA	NA
NP_707639.1|1812396_1813191_-	ABC transporter permease	NA	NA	NA	NA	NA
NP_707640.1|1813870_1815217_+|transposase	insertion sequence IS91 transposase	transposase	NA	NA	NA	NA
NP_707642.1|1817789_1818383_-	tellurite resistance protein TehB	NA	NA	NA	NA	NA
NP_707643.2|1818379_1819372_-	potassium-tellurite ethidium and proflavin transporter	NA	NA	NA	NA	NA
NP_707644.1|1819495_1820476_+	hypothetical protein	NA	NA	NA	NA	NA
NP_707645.2|1820470_1821007_-	ribosomal-protein-L7/L12-serine acetyltransferase	NA	NA	NA	NA	NA
NP_707646.2|1821069_1821237_-	hypothetical protein	NA	NA	NA	NA	NA
NP_707648.1|1821433_1823089_-	glucan biosynthesis protein D	NA	NA	NA	NA	NA
NP_707649.1|1823313_1824657_-	hypothetical protein	NA	NA	NA	NA	NA
NP_707650.1|1824732_1825797_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
NP_707651.1|1825834_1827475_-	methyl-accepting chemotaxis protein III	NA	NA	NA	NA	NA
NP_707652.1|1827850_1828333_+	insertion element IS150 protein	NA	A0A2I6AZV8	Macacine_betaherpesvirus	99.3	1.1e-76
NP_707653.1|1828329_1829148_-	insertion sequence element IS600 protein	NA	A0A0P0I4A4	Acinetobacter_phage	44.9	2.9e-64
YP_008439253.1|1829183_1829486_-|transposase	insertion sequence element IS600 transposase	transposase	NA	NA	NA	NA
YP_008439254.1|1829860_1830010_+	protein HokB	NA	NA	NA	NA	NA
NP_707655.1|1830081_1830255_-	hypothetical protein	NA	A0A0R6PKG1	Moraxella_phage	67.4	4.4e-07
NP_707656.3|1830499_1831066_-	cytochrome b(561)	NA	A0A0U2QLA7	Escherichia_phage	44.9	3.4e-19
NP_707657.1|1831218_1831971_+	glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
NP_707658.1|1831967_1832219_+	glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
NP_707659.1|1832260_1833700_-	aldehyde dehydrogenase	NA	NA	NA	NA	NA
NP_707660.1|1834974_1835277_+|transposase	insertion sequence element IS911 transposase InsN	transposase	Q716C1	Shigella_phage	100.0	1.1e-45
NP_707661.1|1835303_1836143_+|integrase	insertion sequence element IS911 integrase core domain-containing protein	integrase	Q716C2	Shigella_phage	99.6	1.3e-168
NP_707662.1|1836187_1836901_+|integrase	insertion sequence element IS600 integrase core domain-containing protein	integrase	A0A0P0I4A4	Acinetobacter_phage	47.3	2.9e-60
1836753:1836767	attR	GCCACTATCGTTTTA	NA	NA	NA	NA
NP_707663.2|1837101_1840947_-	ATP-dependent RNA helicase HrpA	NA	A0A1V0SIV3	Klosneuvirus	29.5	2.2e-53
1836753:1836767	attR	GCCACTATCGTTTTA	NA	NA	NA	NA
NP_707664.1|1841204_1841810_+	azoreductase	NA	NA	NA	NA	NA
YP_008439255.1|1841863_1842472_-	phosphatase	NA	NA	NA	NA	NA
NP_707665.1|1842572_1842875_+|transposase	insertion sequence element IS600 transposase	transposase	NA	NA	NA	NA
NP_707666.1|1842910_1843729_+	insertion sequence element IS600 protein	NA	A0A0P0I4A4	Acinetobacter_phage	44.9	2.6e-65
NP_707667.1|1843769_1844480_-	hypothetical protein	NA	NA	NA	NA	NA
NP_707668.1|1844430_1846188_-	hypothetical protein	NA	NA	NA	NA	NA
NP_707670.2|1847098_1847704_-	hypothetical protein	NA	NA	NA	NA	NA
NP_707671.3|1847874_1850184_-	hypothetical protein	NA	NA	NA	NA	NA
NP_707672.1|1850297_1850801_+	insertion element IS1 protein InsB	NA	U5P0U6	Shigella_phage	93.2	9.1e-85
NP_707673.1|1851237_1852227_-	fermentative D-lactate dehydrogenase	NA	M1I4S0	Paramecium_bursaria_Chlorella_virus	44.0	3.3e-70
NP_707674.1|1852434_1855074_+	hypothetical protein	NA	NA	NA	NA	NA
NP_707675.1|1855070_1855256_+	hypothetical protein	NA	NA	NA	NA	NA
NP_707676.2|1855260_1855590_+	hypothetical protein	NA	NA	NA	NA	NA
NP_707677.1|1856041_1856317_+	insertion element IS1 protein InsA	NA	Q71TE9	Escherichia_phage	93.4	6.6e-45
NP_707678.1|1856343_1856739_+	insertion element IS1 protein InsB	NA	Q71TF0	Escherichia_phage	91.6	2.8e-65
NP_707679.1|1856871_1857234_-	hypothetical protein	NA	NA	NA	NA	NA
NP_707680.1|1857410_1860935_+	oxidoreductase, Fe-S subunit	NA	NA	NA	NA	NA
NP_707682.2|1862499_1863006_+	universal stress protein F	NA	A0A1W6JNV4	Morganella_phage	52.8	1.2e-28
NP_707683.1|1863181_1864117_+|tRNA	tRNA 2-thiocytidine biosynthesis protein TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	97.3	3.2e-144
NP_707684.2|1864245_1865613_-	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.2e-51
NP_707685.1|1866090_1867074_-	zinc transporter	NA	NA	NA	NA	NA
NP_707686.1|1869398_1870853_-	multidrug resistant protein-like protein	NA	NA	NA	NA	NA
NP_707687.1|1871357_1871546_+	hypothetical protein	NA	NA	NA	NA	NA
NP_707688.1|1871555_1872755_+|transposase	IS1294 transposase	transposase	NA	NA	NA	NA
NP_707689.3|1873662_1874478_+	hypothetical protein	NA	NA	NA	NA	NA
YP_008439256.1|1874807_1875011_+	hypothetical protein	NA	NA	NA	NA	NA
NP_707690.1|1875021_1875537_+	O-6-alkylguanine-DNA:cysteine-protein methyltransferase	NA	M1PFU9	Streptococcus_phage	42.8	1.1e-24
NP_707691.2|1875731_1876484_+	fumarate/nitrate reduction transcriptional regulator	NA	NA	NA	NA	NA
NP_707692.2|1876635_1877586_+	universal stress protein UspE	NA	NA	NA	NA	NA
NP_707693.1|1878092_1878932_-|integrase	insertion sequence element IS911 integrase core domain-containing protein	integrase	Q716C2	Shigella_phage	99.6	1.3e-168
NP_707694.1|1878958_1879261_-|transposase	insertion sequence element IS911 transposase InsN	transposase	Q716C1	Shigella_phage	100.0	1.1e-45
NP_707695.1|1879388_1880420_+	hypothetical protein	NA	NA	NA	NA	NA
NP_707696.1|1880470_1882105_-	transport protein	NA	NA	NA	NA	NA
NP_707697.1|1882951_1883254_+|transposase	insertion sequence element IS600 transposase	transposase	NA	NA	NA	NA
NP_707700.1|1884173_1884500_-	insertion sequence element IS629 protein	NA	Q6H9S4	Enterobacteria_phage	93.5	2.5e-51
NP_707701.1|1884584_1885403_+	insertion sequence element IS600 protein	NA	A0A0P0I4A4	Acinetobacter_phage	44.9	3.4e-65
NP_707703.1|1887236_1887578_-	hypothetical protein	NA	NA	NA	NA	NA
NP_707704.1|1888466_1888841_-	hypothetical protein	NA	NA	NA	NA	NA
NP_707705.2|1888979_1889210_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	61.8	1.3e-14
NP_707706.2|1889991_1890654_+	exodeoxyribonuclease X	NA	Q6UAU3	Klebsiella_phage	41.6	3.5e-07
NP_707707.1|1890650_1892711_-|protease	protease 2	protease	NA	NA	NA	NA
>prophage 13
NC_004337	Shigella flexneri 2a str. 301 chromosome, complete genome	4607202	1912620	1962809	4607202	tail,tRNA,transposase,integrase,protease	Enterobacteria_phage(40.0%)	45	1944799:1944858	1962445:1962845
NP_707725.1|1912620_1914393_-|tRNA	aspartyl-tRNA synthetase	tRNA	NA	NA	NA	NA
NP_707726.1|1915148_1916345_+|transposase	insertion sequence element ISSfl2 transposase	transposase	NA	NA	NA	NA
NP_707727.1|1917073_1917322_+	bacteriophage protein	NA	K7PLW4	Enterobacteria_phage	98.8	4.1e-38
NP_707728.1|1917921_1919673_+	invasion plasmid antigen	NA	NA	NA	NA	NA
NP_707729.1|1919852_1920476_-|tail	prophage CP-933K tail protein	tail	A0A0U2QQK4	Escherichia_phage	75.9	5.1e-77
NP_707731.1|1921901_1922501_-	membrane protein	NA	H6WZM8	Escherichia_phage	93.0	1.8e-103
NP_707732.1|1922568_1926048_-	host specificity protein	NA	A5LH43	Enterobacteria_phage	87.3	0.0e+00
NP_707733.2|1926108_1926651_-|tail	phage tail protein	tail	A0A291AWV5	Escherichia_phage	84.1	3.7e-76
NP_707734.2|1926647_1927247_-|tail	tail assembly protein	tail	K7PLW1	Enterobacteria_phage	97.0	6.1e-120
NP_707735.1|1927395_1928094_-|tail	minor tail protein	tail	A0A0K2FJ01	Enterobacteria_phage	89.7	8.4e-121
NP_707736.1|1928093_1928423_-|tail	minor tail protein	tail	A5LH39	Enterobacteria_phage	97.2	2.4e-57
NP_707737.1|1928422_1931464_-|tail	tail length tape measure protein	tail	A0A291AWX1	Escherichia_phage	86.5	0.0e+00
NP_707738.2|1931435_1931711_-|tail	prophage CP-933K tail protein	tail	A5LH37	Enterobacteria_phage	98.9	2.9e-45
NP_707739.2|1931773_1932160_-|tail	prophage CP-933K tail protein	tail	A5LH36	Enterobacteria_phage	92.2	1.4e-61
NP_707740.2|1932218_1932959_-|tail	prophage CP-933K tail protein	tail	A5LH35	Enterobacteria_phage	96.7	1.5e-128
NP_707741.1|1932969_1933371_-|tail	prophage CP-933K tail protein	tail	A0A291AWY2	Escherichia_phage	97.7	1.6e-71
NP_707742.1|1933367_1933958_-|tail	prophage CP-933K tail protein	tail	A5LH33	Enterobacteria_phage	78.2	7.4e-78
NP_707743.1|1933944_1934316_-|tail	tail attachment protein	tail	NA	NA	NA	NA
NP_707744.1|1934327_1934729_-	DNA-packaging protein	NA	A0A2R9YJP4	Escherichia_phage	66.2	3.3e-37
NP_707745.1|1934992_1936189_+|transposase	insertion sequence element ISSfl2 transposase	transposase	NA	NA	NA	NA
NP_707746.2|1937374_1938064_-	Q antiterminator encoded by prophage CP-933P	NA	I6PDF8	Cronobacter_phage	49.4	2.9e-57
NP_707747.1|1938060_1938420_-	crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	66.1	8.3e-40
NP_707748.1|1938623_1938926_+|transposase	insertion sequence element IS600 transposase	transposase	NA	NA	NA	NA
NP_707749.1|1938961_1939780_+	insertion sequence element IS600 protein	NA	A0A0P0I4A4	Acinetobacter_phage	44.9	4.5e-65
NP_707750.2|1940292_1940796_-	insertion element IS1 protein InsB	NA	Q71TF0	Escherichia_phage	100.0	1.5e-95
NP_707752.1|1941075_1941903_+|protease	serine protease	protease	Q8W654	Enterobacteria_phage	94.2	8.7e-125
NP_707753.2|1941946_1942696_+	bacteriophage protein	NA	A0A1B5FPC0	Escherichia_phage	96.0	1.7e-135
NP_707754.1|1942692_1943262_+	bacteriophage protein	NA	A0A088C4R7	Shewanella_sp._phage	39.4	6.8e-28
YP_008439258.1|1943385_1943628_+	hypothetical protein	NA	Q6H9Z8	Enterobacteria_phage	85.0	6.2e-31
NP_707755.1|1943958_1944798_-|integrase	insertion sequence element IS911 integrase core domain-containing protein	integrase	Q716C2	Shigella_phage	99.6	1.3e-168
1944799:1944858	attL	AGGATAATGCGCTCTGAGTTTCCCGATTATCGAGAACTGTTCAGGGAGTCTGACATCAAG	NA	NA	NA	NA
NP_707756.1|1944824_1945163_-|transposase	insertion sequence element IS911 transposase InsN	transposase	Q716C1	Shigella_phage	100.0	9.5e-46
NP_707757.2|1945759_1946155_+	hypothetical protein	NA	NA	NA	NA	NA
NP_707758.1|1946195_1946939_+|tRNA	tRNA cmo(5)U34 methyltransferase	tRNA	F5B419	Synechococcus_phage	30.0	4.6e-24
NP_707759.1|1946935_1947907_+|tRNA	tRNA mo(5)U34 methyltransferase	tRNA	NA	NA	NA	NA
NP_707760.2|1948071_1950501_-	biotin sulfoxide reductase	NA	NA	NA	NA	NA
NP_707761.2|1950525_1951626_-	cytochrome C-type protein	NA	NA	NA	NA	NA
NP_707762.3|1952013_1952760_-	copper homeostasis protein	NA	NA	NA	NA	NA
NP_707763.2|1952773_1953340_-	hypothetical protein	NA	NA	NA	NA	NA
NP_707764.1|1953555_1955289_+|tRNA	arginyl-tRNA synthetase	tRNA	A0A2K9L6Z2	Tupanvirus	33.7	6.8e-87
NP_707765.1|1955465_1955954_+	hypothetical protein	NA	NA	NA	NA	NA
NP_707768.1|1957042_1957369_-	insertion sequence element IS629 protein	NA	Q6H9S4	Enterobacteria_phage	94.4	2.3e-52
NP_707769.2|1957420_1957759_-	flagellar protein FlhE	NA	NA	NA	NA	NA
NP_707770.1|1959782_1960976_-	flagellar biosynthesis protein FlhB	NA	NA	NA	NA	NA
NP_707771.1|1961604_1962444_-|integrase	insertion sequence element IS911 integrase core domain-containing protein	integrase	Q716C2	Shigella_phage	99.6	1.3e-168
NP_707772.1|1962470_1962809_-|transposase	insertion sequence element IS911 transposase InsN	transposase	Q716C1	Shigella_phage	100.0	9.5e-46
1962445:1962845	attR	AGGATAATGCGCTCTGAGTTTCCCGATTATCGAGAACTGTTCAGGGAGTCTGACATCAAGAGCGCGGTAGCCTTTTTTAATATTTCATTCTCCATTTCAATGCGTTGTAGCTTTTTCCTGAGCTCACGGATTTCAATTTGTTCCGGGGTAATGGGGGAGGCTTTTGGTGTTTTGCCCTGACGCTCATCACGCAGTTGTTTGACCCATCTTGTCATTGTGGAAAGGCCAACATCCATAGCTTTGGCGGCATCTGCCACCGTGTATTTCTGGTCAACAACCAGTTGAGCGGATTCGCGTTTAAACTCTGCGCTAAAATTTCTTTTTTTCATTGGAGCACCTGTGTTGTTCTGAGGTGAGCATATCACCTCTGTTCAGGTGGCCAAATTCAGTGTGCCACTTCA	NA	NA	NA	NA
>prophage 14
NC_004337	Shigella flexneri 2a str. 301 chromosome, complete genome	4607202	2030313	2087783	4607202	lysis,transposase,integrase,tail	Enterobacteria_phage(27.78%)	59	2051095:2051154	2095727:2096472
NP_707843.1|2030313_2030784_-	DNA mismatch endonuclease	NA	E5E3X5	Burkholderia_phage	47.6	7.6e-33
NP_707844.1|2030764_2032183_-	DNA cytosine methylase	NA	E5E3X6	Burkholderia_phage	55.1	1.0e-101
NP_707845.1|2033087_2033900_-	hypothetical protein	NA	U5P429	Shigella_phage	92.6	3.6e-147
NP_707846.1|2033956_2034241_-	hypothetical protein	NA	U5P4I9	Shigella_phage	92.5	4.6e-33
NP_707847.1|2034261_2035110_+	outer membrane pore protein	NA	Q1MVN1	Enterobacteria_phage	52.5	1.6e-65
NP_707848.1|2035080_2035986_-|transposase	IS2 transposase TnpB	transposase	Q9ZXG3	Shigella_phage	99.3	1.7e-177
NP_707849.3|2035943_2036354_-	IS2 repressor TnpA	NA	Q76S41	Shigella_phage	100.0	1.4e-59
NP_707850.1|2037209_2037485_+	insertion element IS1 protein InsA	NA	Q71TE9	Escherichia_phage	93.4	6.6e-45
NP_707851.1|2037511_2037907_+	insertion element IS1 protein InsB	NA	Q71TF0	Escherichia_phage	92.4	2.0e-66
NP_707852.1|2037952_2038804_+	chaperone protein HchA	NA	NA	NA	NA	NA
NP_707853.1|2038911_2040270_-	2-component sensor protein	NA	NA	NA	NA	NA
NP_707854.2|2040269_2040941_-	transcriptional regulatory protein YedW	NA	W8CYM9	Bacillus_phage	35.2	5.4e-32
NP_707855.1|2041073_2041487_+	5-hydroxyisourate hydrolase	NA	NA	NA	NA	NA
NP_707856.1|2042600_2043236_+	sulfite oxidase subunit YedZ	NA	NA	NA	NA	NA
NP_707857.1|2043493_2044144_+	zinc/cadmium-binding protein	NA	NA	NA	NA	NA
YP_008439260.1|2045221_2045491_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	81.7	1.2e-19
NP_707858.1|2045547_2046216_+	hypothetical protein	NA	NA	NA	NA	NA
NP_707859.1|2047251_2048460_+|transposase	insertion element iso-IS10R transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	100.0	1.8e-235
NP_707860.2|2049692_2050307_-	hypothetical protein	NA	A0A0U2QQK4	Escherichia_phage	81.0	1.5e-68
NP_707861.2|2050212_2051031_-	insertion sequence element IS600 protein	NA	A0A0P0I4A4	Acinetobacter_phage	44.9	6.5e-64
2051095:2051154	attL	TTTAGTGTATGATGGTGATTTTAAGGTGCTTGCGTGGCTTCCATTTCCATCAGATGTCCT	NA	NA	NA	NA
NP_707862.1|2051321_2051825_+	insertion element IS1 protein InsB	NA	U5P0U6	Shigella_phage	93.2	9.1e-85
NP_707863.1|2051917_2052400_-	hypothetical protein	NA	NA	NA	NA	NA
NP_707864.1|2052467_2054417_-|tail	tail protein	tail	Q8W620	Enterobacteria_phage	98.2	0.0e+00
NP_707865.1|2054501_2054837_-	bacteriophage protein	NA	Q8W621	Enterobacteria_phage	97.2	9.8e-51
NP_707866.1|2054836_2055193_-	bacteriophage protein	NA	Q8W622	Enterobacteria_phage	98.3	5.3e-63
NP_707867.1|2055192_2056689_-	sheath protein	NA	Q8W623	Enterobacteria_phage	97.4	5.9e-273
NP_707869.1|2057240_2058059_-	insertion sequence element IS600 protein	NA	A0A0P0I4A4	Acinetobacter_phage	44.5	1.4e-63
NP_707870.1|2058094_2058397_-|transposase	insertion sequence element IS600 transposase	transposase	NA	NA	NA	NA
NP_707872.1|2059295_2059643_-	insertion sequence element ISSfl4 ORF2	NA	A0A0P0ZDM8	Stx2-converting_phage	72.9	2.7e-43
NP_707873.1|2059639_2060314_-|transposase	insertion sequence element ISSfl4 transposase	transposase	A0A0P0ZCV4	Stx2-converting_phage	30.1	5.8e-10
NP_707874.1|2060412_2060628_-|lysis	lysis protein S	lysis	M1FN85	Enterobacteria_phage	98.6	5.3e-34
NP_707875.2|2061428_2062112_-	Q antiterminator of prophage	NA	I6PDF8	Cronobacter_phage	49.8	2.0e-58
NP_707876.1|2062108_2062474_-	crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	68.1	7.1e-39
NP_707877.2|2062474_2063461_-	bacteriophage protein	NA	U5P0K4	Shigella_phage	48.5	4.4e-83
NP_707878.1|2063534_2063813_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	45.0	4.5e-09
YP_008439261.1|2063615_2063939_+	hypothetical protein	NA	NA	NA	NA	NA
YP_008439262.1|2063980_2064193_-	regulatory protein	NA	A0A0U2QV81	Escherichia_phage	95.7	6.6e-29
YP_008439263.1|2064395_2064614_-	membrane protein	NA	NA	NA	NA	NA
NP_707879.2|2064787_2065123_-	bacteriophage protein	NA	A0A076GCN9	Escherichia_phage	72.0	1.2e-24
NP_707881.1|2066592_2067429_+	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
NP_707884.1|2069135_2069975_-|integrase	insertion sequence element IS911 integrase core domain-containing protein	integrase	Q716C2	Shigella_phage	99.6	1.3e-168
NP_707885.1|2070001_2070340_-|transposase	insertion sequence element IS911 transposase InsN	transposase	Q716C1	Shigella_phage	100.0	9.5e-46
NP_707886.1|2070930_2071233_+|transposase	insertion sequence element IS600 transposase	transposase	NA	NA	NA	NA
NP_707887.1|2071268_2072060_+	insertion sequence element IS600 protein	NA	A0A0P0I4A4	Acinetobacter_phage	42.3	1.5e-57
NP_707888.2|2072411_2073866_+	AMP nucleosidase	NA	NA	NA	NA	NA
NP_707889.1|2074208_2074925_+	hypothetical protein	NA	NA	NA	NA	NA
NP_707890.1|2077301_2078252_-	transcriptional regulator Cbl	NA	NA	NA	NA	NA
NP_707891.2|2078353_2079271_-	nitrogen assimilation transcriptional regulator	NA	NA	NA	NA	NA
NP_707892.1|2079730_2080666_-	L,D-transpeptidase	NA	NA	NA	NA	NA
NP_707893.1|2080727_2081807_-	nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase	NA	NA	NA	NA	NA
NP_707894.2|2081818_2082562_-	adenosylcobinamide-GDP ribazoletransferase	NA	NA	NA	NA	NA
NP_707895.1|2082558_2083068_-	adenosylcobinamide kinase/adenosylcobinamide phosphate guanyltransferase	NA	NA	NA	NA	NA
NP_707896.1|2083079_2083898_-	insertion sequence element IS600 protein	NA	A0A0P0I4A4	Acinetobacter_phage	44.9	2.9e-64
NP_707897.1|2083933_2084236_-|transposase	insertion sequence element IS600 transposase	transposase	NA	NA	NA	NA
NP_707898.1|2084478_2084805_+	insertion sequence element IS629 protein	NA	Q6H9S4	Enterobacteria_phage	95.4	1.3e-52
NP_707899.1|2085019_2085688_+|integrase	insertion sequence element IS629 integrase core domain-containing protein	integrase	Q6H9S3	Enterobacteria_phage	98.2	4.0e-120
NP_707900.1|2085909_2086392_+	hypothetical protein	NA	NA	NA	NA	NA
NP_707901.1|2086550_2086946_-	hypothetical protein	NA	NA	NA	NA	NA
NP_707902.1|2087162_2087783_+|integrase	insertion sequence element IS629 integrase core domain-containing protein	integrase	Q6H9S3	Enterobacteria_phage	98.1	6.3e-112
2095727:2096472	attR	AGGACATCTGATGGAAATGGAAGCCACGCAAGCACCTTAAAATCACCATCATACACTAAATCAGTAAGTTGGCAGCATTACCCACTCAATAATGTCCTTTTCCGTTCCTTTGCCTGATTTCAGGCTATCGATTGAGTCCATCAATCTCCGGGCGTTAGCGGGGGAACGCAGTAGATAAGCCGTCTCTTCCAGCGAATTGTATTCTTCGAGTGACATCAGAACACAAGCCTCTCCATTCTGACGAGTAATGAGGATCGGGGCATGATCTTCAACGGCTTTCATCATTGTTGCCGACAAATTCTGACGCGCTTCGCTGTAGCTAATTGTACGCATGTAAATCTCCTATTTTGTACAGTTCATTGTACAATGATAGGTGTTAATTAACTATTTATTAATTAGTTTGTAGATCAAGACATTGCCAGCGAGACGAAAAATCAGACTTTGCTCTTTTTGGTGCTGTCAAGTTAGAGGACAGTCCTCTTAGCCCCCTCCTTTCCCCGCTCATTCATTAAACAAATCCATCGCCATAAAATATATAAAAAAGCCCTTGCTTTCTAACGTGAAAGTGGTTTAGGTTAAAAGACATCAGTTGAATAAACATTCACAGAGATTTTTATGACACGCGTTCAATTTAAACACCACCATCATCCTGACTAGTCTTTCAGGCGATGTGTGCTGGAAGACATTCAGATCTTCCAGTGGTGCATGAACGCATGAGAAAGCCCCCGGAAGATCACCTTCCGGGG	NA	NA	NA	NA
>prophage 15
NC_004337	Shigella flexneri 2a str. 301 chromosome, complete genome	4607202	2115216	2121523	4607202		Enterobacteria_phage(50.0%)	6	NA	NA
NP_707933.1|2115216_2115762_-	dTDP-6-deoxy-L-mannose-dehydrogenase	NA	I7HJC4	Enterobacteria_phage	57.3	3.5e-50
NP_707934.1|2115766_2116645_-	glucose-1-phosphate thymidylyltransferase	NA	I7I009	Enterobacteria_phage	64.1	1.9e-106
NP_707935.1|2116703_2117603_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	35.6	4.4e-29
NP_707936.1|2117602_2118688_-	dTDP-glucose 4,6 dehydratase	NA	I7HTA3	Enterobacteria_phage	53.6	5.7e-100
NP_707937.2|2119060_2119954_-	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.0	1.3e-46
NP_707938.1|2120128_2121523_-	colanic acid biosynthesis protein	NA	A0A291LBB9	Klebsiella_phage	30.9	1.8e-18
>prophage 16
NC_004337	Shigella flexneri 2a str. 301 chromosome, complete genome	4607202	2149246	2240202	4607202	transposase,protease,tail,tRNA	Escherichia_phage(32.26%)	68	NA	NA
NP_707961.1|2149246_2150443_-|transposase	insertion sequence element ISSfl2 transposase	transposase	NA	NA	NA	NA
NP_707962.1|2153671_2154520_-	3-methyladenine DNA glycosylase	NA	NA	NA	NA	NA
NP_707964.1|2157954_2158716_-	hypothetical protein	NA	NA	NA	NA	NA
NP_707965.2|2158712_2159372_-	hypothetical protein	NA	NA	NA	NA	NA
NP_707966.1|2159805_2161002_+|transposase	insertion sequence element ISSfl2 transposase	transposase	NA	NA	NA	NA
NP_707967.1|2161003_2162056_+	acriflavin resistance protein AcrA-like protein	NA	NA	NA	NA	NA
NP_707968.1|2165178_2168244_+	multidrug efflux system subunit MdtC	NA	NA	NA	NA	NA
NP_707969.1|2168244_2169660_+	transporter	NA	NA	NA	NA	NA
NP_707970.1|2169656_2171060_+	signal transduction histidine-protein kinase BaeS	NA	W8CYF6	Bacillus_phage	29.4	1.2e-33
NP_707971.1|2171056_2171779_+	DNA-binding transcriptional regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	3.7e-31
NP_707972.1|2171930_2172302_+	hypothetical protein	NA	NA	NA	NA	NA
NP_707973.2|2172448_2173810_+|protease	protease	protease	Q6DW11	Phage_TP	99.5	7.1e-217
NP_707974.1|2174151_2174529_-	hypothetical protein	NA	NA	NA	NA	NA
NP_707975.1|2174874_2175774_+	lipid kinase	NA	A0A1V0SBJ0	Catovirus	29.0	5.7e-13
NP_707976.1|2175855_2176635_-	galactitol utilization operon repressor	NA	NA	NA	NA	NA
NP_707977.1|2176734_2177775_-	galactitol-1-phosphate dehydrogenase	NA	NA	NA	NA	NA
NP_707978.1|2177807_2178203_-	insertion element IS1 protein InsB	NA	NA	NA	NA	NA
NP_707979.1|2178229_2178505_-	insertion element IS1 protein InsA	NA	Q71TE9	Escherichia_phage	92.3	5.5e-44
NP_707980.1|2178599_2179955_-	PTS system galactitol-specific transporter subunit IIC	NA	NA	NA	NA	NA
NP_707981.1|2179958_2180243_-	PTS system galactitol-specific transporter subunit IIB	NA	NA	NA	NA	NA
NP_707982.1|2180273_2180726_-	PTS system galactitol-specific transporter subunit IIA	NA	NA	NA	NA	NA
NP_707983.1|2180735_2181998_-	D-tagatose-1,6-bisphosphate aldolase subunit GatZ	NA	NA	NA	NA	NA
NP_707984.2|2182026_2182881_-	tagatose-bisphosphate aldolase	NA	NA	NA	NA	NA
NP_707985.1|2183188_2184241_-	fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
NP_707986.1|2185280_2186246_+	kinase	NA	NA	NA	NA	NA
NP_707987.1|2186690_2187899_+|transposase	insertion element iso-IS10R transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	100.0	1.8e-235
NP_707988.2|2188351_2189173_-	hypothetical protein	NA	D0R7H8	Paenibacillus_phage	36.2	1.4e-21
NP_707989.1|2189237_2190038_-	bifunctional hydroxy-methylpyrimidine kinase/ hydroxy-phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
NP_707990.1|2190034_2190823_-	hydroxyethylthiazole kinase	NA	NA	NA	NA	NA
NP_707991.1|2191045_2191318_-	transcriptional repressor RcnR	NA	NA	NA	NA	NA
NP_707992.1|2192488_2192827_+	hypothetical protein	NA	NA	NA	NA	NA
NP_707993.1|2193126_2193942_-	type-1 fimbrial protein	NA	NA	NA	NA	NA
NP_707994.2|2193957_2196438_-	fimbrial outer membrane usher protein	NA	NA	NA	NA	NA
NP_707996.2|2197135_2197639_+	insertion element IS1 protein InsB	NA	Q71TF0	Escherichia_phage	100.0	1.5e-95
NP_707997.1|2197984_2198509_-	fimbrial-like protein	NA	NA	NA	NA	NA
NP_707998.1|2198784_2199180_-	insertion element IS1 protein InsB	NA	NA	NA	NA	NA
NP_707999.1|2199206_2199482_-	insertion element IS1 protein InsA	NA	Q71TE9	Escherichia_phage	93.4	6.6e-45
YP_008439264.1|2199578_2199860_-	hypothetical protein	NA	NA	NA	NA	NA
NP_708000.2|2200121_2201231_-	antiporter inner membrane protein	NA	NA	NA	NA	NA
NP_708001.2|2201362_2203396_+|tRNA	methionyl-tRNA synthetase	tRNA	A0A1V0SDF2	Indivirus	27.8	1.0e-54
NP_708002.1|2203791_2204094_+|transposase	insertion sequence element IS600 transposase	transposase	NA	NA	NA	NA
NP_708003.1|2204129_2204948_+	insertion sequence element IS600 protein	NA	A0A0P0I4A4	Acinetobacter_phage	44.5	6.5e-64
NP_708004.1|2205605_2205881_+	insertion element IS1 protein InsA	NA	Q71TE9	Escherichia_phage	92.3	3.3e-44
NP_708005.1|2205907_2206303_+	insertion element IS1 protein InsB	NA	Q71TF0	Escherichia_phage	92.4	2.0e-66
NP_708006.1|2213089_2213497_+	hypothetical protein	NA	NA	NA	NA	NA
NP_708007.2|2213972_2215127_+	hypothetical protein	NA	NA	NA	NA	NA
NP_708008.2|2215137_2217417_+	hypothetical protein	NA	NA	NA	NA	NA
NP_708009.2|2217409_2218546_+	hypothetical protein	NA	Q9EYF7	Enterobacteria_phage	97.4	3.2e-162
NP_708010.2|2218542_2220546_+	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	96.4	0.0e+00
NP_708011.1|2220678_2221152_-	insertion element IS1 protein InsB	NA	U5P0U6	Shigella_phage	82.8	4.3e-68
NP_708012.2|2221436_2221898_+	hypothetical protein	NA	Q9EYF5	Enterobacteria_phage	99.3	1.6e-75
NP_708013.1|2222118_2222514_-	insertion element IS1 protein InsB	NA	Q71TF0	Escherichia_phage	91.6	2.8e-65
NP_708014.1|2222540_2222816_-	insertion element IS1 protein InsA	NA	Q71TE9	Escherichia_phage	93.4	6.6e-45
NP_708015.1|2222849_2223242_-	hypothetical protein	NA	Q9EYF4	Enterobacteria_phage	96.3	3.9e-51
NP_708016.2|2223231_2223951_-	two-component response-regulatory protein YehT	NA	NA	NA	NA	NA
NP_708017.2|2223947_2225633_-	2-component sensor protein	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
NP_708018.1|2227583_2227832_+	DNA-damage-inducible protein	NA	A5LH55	Enterobacteria_phage	97.6	4.1e-38
YP_008439265.1|2227947_2228217_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	81.7	1.2e-19
NP_708019.1|2228273_2228942_+	hypothetical protein	NA	NA	NA	NA	NA
NP_708020.1|2229977_2231186_+|transposase	insertion element iso-IS10R transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	100.0	1.8e-235
NP_708021.3|2232418_2232928_-	bacteriophage protein	NA	A0A0U2QQK4	Escherichia_phage	78.2	2.4e-69
NP_708022.2|2232972_2234262_-|tail	tail fiber protein	tail	Q8W611	Enterobacteria_phage	42.4	1.9e-73
NP_708023.1|2234285_2234774_-|tail	tail fiber assembly protein	tail	Q8W612	Enterobacteria_phage	76.0	4.3e-63
NP_708025.1|2235288_2235564_+	insertion element IS1 protein InsA	NA	Q71TE9	Escherichia_phage	93.4	6.6e-45
NP_708026.1|2235590_2235986_+	insertion element IS1 protein InsB	NA	Q71TF0	Escherichia_phage	91.6	5.7e-66
NP_708027.1|2236684_2237011_+	insertion sequence element IS629 protein	NA	Q6H9S4	Enterobacteria_phage	95.4	1.3e-52
NP_708029.1|2238539_2239271_-	transport system permease	NA	NA	NA	NA	NA
NP_708030.1|2239275_2240202_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.6	9.7e-24
>prophage 17
NC_004337	Shigella flexneri 2a str. 301 chromosome, complete genome	4607202	2616390	2623522	4607202		Escherichia_phage(66.67%)	7	NA	NA
NP_708342.1|2616390_2617209_+	insertion sequence element IS600 protein	NA	A0A0P0I4A4	Acinetobacter_phage	44.5	2.5e-63
YP_008439271.1|2618569_2618722_-	hypothetical protein	NA	G9L6F3	Escherichia_phage	96.0	1.7e-18
NP_708343.1|2618739_2618931_+	hypothetical protein	NA	G9L6F2	Escherichia_phage	100.0	7.3e-27
NP_708344.1|2619241_2619760_+	outer membrane lipoprotein	NA	G9L6F1	Escherichia_phage	99.4	6.5e-62
NP_708345.1|2619775_2620315_+	hypothetical protein	NA	G9L6F0	Escherichia_phage	98.9	1.4e-43
NP_708346.1|2620409_2621987_-	GMP synthase	NA	NA	NA	NA	NA
NP_708347.2|2622055_2623522_-	inosine 5'-monophosphate dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	39.1	2.3e-88
>prophage 19
NC_004337	Shigella flexneri 2a str. 301 chromosome, complete genome	4607202	2863088	2869287	4607202		Escherichia_phage(33.33%)	6	NA	NA
NP_708570.1|2863088_2863592_+	insertion element IS1 protein InsB	NA	U5P0U6	Shigella_phage	93.2	9.1e-85
NP_708571.1|2863630_2864302_-	7-carboxy-7-deazaguanine synthase QueE	NA	A0A2I7S8X1	Vibrio_phage	25.0	1.7e-14
NP_708572.1|2864695_2864971_+	insertion element IS1 protein InsA	NA	Q71TE9	Escherichia_phage	93.4	6.6e-45
NP_708573.1|2864997_2865393_+	insertion element IS1 protein InsB	NA	Q71TF0	Escherichia_phage	91.6	2.8e-65
NP_708575.1|2866263_2867562_-	enolase	NA	A0A1X9I5Z8	Streptococcus_phage	58.8	2.0e-131
NP_708576.1|2867649_2869287_-	CTP synthetase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	50.4	1.8e-153
>prophage 20
NC_004337	Shigella flexneri 2a str. 301 chromosome, complete genome	4607202	2882000	2957516	4607202	transposase,protease,integrase,tRNA	Bacillus_phage(11.76%)	59	2950032:2950048	2957651:2957667
NP_708585.1|2882000_2882783_-|tRNA	tRNA pseudouridine synthase C	tRNA	NA	NA	NA	NA
NP_708586.1|2882782_2883112_-	hypothetical protein	NA	NA	NA	NA	NA
NP_708587.1|2883733_2884279_-	SecY interacting protein Syd	NA	NA	NA	NA	NA
NP_708588.1|2884346_2885195_+	7-cyano-7-deazaguanine reductase	NA	A0A2I7SAX1	Vibrio_phage	37.1	4.7e-41
NP_708589.1|2885306_2886671_+	hypothetical protein	NA	NA	NA	NA	NA
NP_708590.1|2886754_2888101_+|transposase	insertion sequence IS4 transposase InsG	transposase	NA	NA	NA	NA
NP_708591.1|2888664_2889954_+	serine transporter	NA	NA	NA	NA	NA
NP_708592.1|2890011_2891379_+	L-serine dehydratase	NA	NA	NA	NA	NA
NP_708593.1|2891399_2892245_+	flap endonuclease-like protein	NA	F8WQ40	Bacillus_phage	33.5	5.6e-10
NP_708594.2|2892297_2893446_-	L-1,2-propanediol oxidoreductase	NA	NA	NA	NA	NA
NP_708595.1|2893473_2894121_-	L-fuculose phosphate aldolase	NA	NA	NA	NA	NA
NP_708596.1|2894667_2895984_+	L-fucose transporter	NA	NA	NA	NA	NA
NP_708597.1|2896016_2897792_+	L-fucose isomerase	NA	NA	NA	NA	NA
NP_708598.1|2899321_2899744_+	L-fucose mutarotase	NA	NA	NA	NA	NA
NP_708599.2|2899801_2900533_+	DNA-binding transcriptional activator FucR	NA	NA	NA	NA	NA
NP_708600.1|2900576_2901677_-	23S rRNA (cytidine(2498)-2'-O)-methyltransferase RlmM	NA	NA	NA	NA	NA
NP_708601.1|2901669_2902065_-	hypothetical protein	NA	NA	NA	NA	NA
NP_708602.1|2902083_2903001_-	DNA-binding transcriptional activator GcvA	NA	NA	NA	NA	NA
NP_708603.1|2903351_2903582_-	hypothetical protein	NA	NA	NA	NA	NA
NP_708604.2|2903770_2904976_+	cysteine sulfinate desulfinase	NA	Q2XUY6	environmental_halophage	36.8	2.5e-72
NP_708605.1|2904975_2905419_+	CsdA-binding activator	NA	NA	NA	NA	NA
NP_708606.1|2905469_2906276_-	sulfur acceptor protein CsdL	NA	S4VW33	Pandoravirus	33.3	1.7e-16
NP_708607.2|2906513_2907611_-	murein transglycosylase A	NA	NA	NA	NA	NA
NP_708608.1|2908080_2909424_-	amidase	NA	Q5YA51	Bacillus_phage	28.6	2.4e-15
NP_708609.2|2909565_2910897_+	N-acetylglutamate synthase	NA	NA	NA	NA	NA
NP_708610.1|2910958_2912785_-	exonuclease V subunit alpha	NA	A0A1P8DII4	Virus_Rctr197k	27.5	2.3e-24
NP_708611.2|2912784_2916327_-	exonuclease V subunit beta	NA	G3MA40	Bacillus_virus	21.8	1.2e-08
NP_708612.1|2916319_2919208_-|protease	protease3	protease	A0A1V0SJA4	Klosneuvirus	26.0	2.4e-68
NP_708613.1|2919383_2922752_-	exonuclease V subunit gamma	NA	NA	NA	NA	NA
NP_708614.2|2922764_2923115_-	hypothetical protein	NA	NA	NA	NA	NA
NP_708615.4|2923099_2923465_-	hypothetical protein	NA	NA	NA	NA	NA
YP_008439276.1|2923503_2924067_-	hypothetical protein	NA	NA	NA	NA	NA
NP_708616.1|2924721_2925516_-	thymidylate synthase	NA	A6M9A2	Geobacillus_virus	70.5	9.9e-118
NP_708617.1|2925522_2926398_-	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
NP_708618.1|2926548_2928795_-	fused phosphoenolpyruvate-protein phosphotransferase PtsP/GAF domain containing protein	NA	A0A1V0SGR7	Hokovirus	26.2	2.7e-11
NP_708619.1|2928807_2929338_-	RNA pyrophosphohydrolase	NA	NA	NA	NA	NA
NP_708620.1|2930022_2930712_+	DNA mismatch repair protein	NA	NA	NA	NA	NA
NP_708621.1|2930780_2931494_+	transporter	NA	A0A0R6PEZ3	Moraxella_phage	47.3	2.0e-45
NP_708622.1|2931631_2931850_+	hypothetical protein	NA	NA	NA	NA	NA
NP_708623.1|2931957_2932998_+	aldo/keto reductase	NA	NA	NA	NA	NA
NP_708624.1|2933030_2934221_-	lysophospholipid transporter LplT	NA	NA	NA	NA	NA
NP_708625.1|2934213_2936373_-	bifunctional acyl-[acyl carrier protein] synthetase/2-acylglycerophosphoethanolamine acyltransferase	NA	NA	NA	NA	NA
NP_708626.1|2936958_2937990_+	DNA-binding transcriptional regulator GalR	NA	NA	NA	NA	NA
NP_708627.1|2937996_2939259_-	diaminopimelate decarboxylase	NA	NA	NA	NA	NA
NP_708628.1|2939380_2940316_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
NP_708629.1|2940302_2940995_-	racemase	NA	NA	NA	NA	NA
NP_708630.2|2941123_2942542_-	low-affinity L-arabinose transport system proton symport protein	NA	O13311	Aichi_virus	26.9	1.3e-24
NP_708631.1|2942856_2943618_-	2-deoxy-D-gluconate 3-dehydrogenase	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.7	5.9e-19
NP_708632.1|2943647_2944484_-	5-keto-4-deoxyuronate isomerase	NA	NA	NA	NA	NA
NP_708633.2|2944770_2945952_-	acyltransferase	NA	NA	NA	NA	NA
NP_708635.1|2948061_2948370_+|transposase	insertion sequence IS3 transposase InsE	transposase	NA	NA	NA	NA
NP_708636.1|2948366_2949233_+|transposase	insertion sequence IS3A transposase InsF	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.0e-51
NP_708637.1|2949246_2949840_-	hypothetical protein	NA	NA	NA	NA	NA
2950032:2950048	attL	TGGAGCGGGCGAAGGGA	NA	NA	NA	NA
NP_708638.1|2950471_2951461_-	hypothetical protein	NA	NA	NA	NA	NA
NP_708639.1|2951544_2952036_-	hypothetical protein	NA	NA	NA	NA	NA
NP_708640.1|2952333_2953080_-	hypothetical protein	NA	B5AX29	Iodobacteriophage	38.9	4.7e-13
NP_708641.1|2953441_2953780_+|transposase	insertion sequence element IS911 transposase InsN	transposase	Q716C1	Shigella_phage	100.0	9.5e-46
NP_708644.2|2955454_2955787_-	hypothetical protein	NA	NA	NA	NA	NA
NP_708645.1|2955905_2957516_-|integrase	integrase	integrase	A0A059XK29	uncultured_phage	28.4	2.3e-12
2957651:2957667	attR	TGGAGCGGGCGAAGGGA	NA	NA	NA	NA
>prophage 21
NC_004337	Shigella flexneri 2a str. 301 chromosome, complete genome	4607202	2962747	2969979	4607202	transposase,tRNA	Shigella_phage(33.33%)	7	NA	NA
NP_708650.1|2962747_2963023_+	insertion element IS1 protein InsA	NA	Q71TE9	Escherichia_phage	92.3	3.3e-44
NP_708651.1|2963257_2964163_-|transposase	IS2 transposase TnpB	transposase	Q9ZXG3	Shigella_phage	99.3	7.4e-178
NP_708652.3|2964120_2964531_-	IS2 repressor TnpA	NA	Q76S41	Shigella_phage	100.0	1.4e-59
NP_708653.1|2965212_2966730_+	permease	NA	Q9KX94	Enterobacteria_phage	26.3	3.2e-24
NP_708654.1|2966979_2967528_+	isopentenyl-diphosphate delta-isomerase	NA	NA	NA	NA	NA
NP_708655.1|2967570_2969088_-|tRNA	lysyl-tRNA synthetase	tRNA	A0A1V0SAC0	Catovirus	36.7	5.9e-87
YP_008439277.1|2969097_2969979_-	peptide chain release factor	NA	A0A0S4KWG0	Pseudomonas_phage	39.0	1.5e-05
>prophage 22
NC_004337	Shigella flexneri 2a str. 301 chromosome, complete genome	4607202	3015836	3080843	4607202	transposase,protease,integrase,tRNA	Escherichia_phage(25.0%)	57	3025625:3025640	3070770:3070785
NP_708698.1|3015836_3016745_+|protease	serine protease	protease	A0A2C9D0H9	Yersinia_phage	55.7	1.2e-53
NP_708699.2|3016790_3018782_-	transketolase	NA	NA	NA	NA	NA
NP_708700.2|3018933_3019818_+	hypothetical protein	NA	NA	NA	NA	NA
NP_708701.1|3020023_3020944_-	agmatinase	NA	NA	NA	NA	NA
NP_708702.2|3021079_3021454_-	hypothetical protein	NA	NA	NA	NA	NA
NP_708703.1|3021479_3021875_-	insertion element IS1 protein InsB	NA	Q71TF0	Escherichia_phage	90.8	6.3e-65
NP_708704.1|3021901_3022177_-	insertion element IS1 protein InsA	NA	Q71TE9	Escherichia_phage	92.3	3.3e-44
NP_708705.1|3022205_3024212_-	arginine decarboxylase	NA	NA	NA	NA	NA
NP_708706.1|3024208_3024355_-	hypothetical protein	NA	NA	NA	NA	NA
YP_008439278.1|3024687_3024939_-	membrane protein	NA	NA	NA	NA	NA
NP_708707.2|3024994_3026149_+	S-adenosylmethionine synthetase	NA	A0A2H4PQS6	Staphylococcus_phage	63.2	4.0e-128
3025625:3025640	attL	ATTCTGCCCGCTGAAT	NA	NA	NA	NA
NP_708708.2|3026624_3027980_+	MFS family galactose:proton symporter	NA	NA	NA	NA	NA
NP_708709.1|3028056_3028554_+	hypothetical protein	NA	NA	NA	NA	NA
NP_708710.2|3028648_3029356_+	DNA-specific endonuclease I	NA	NA	NA	NA	NA
NP_708711.2|3029435_3030167_+	16S ribosomal RNA methyltransferase RsmE	NA	NA	NA	NA	NA
NP_708712.1|3030179_3031130_+	glutathione synthetase	NA	NA	NA	NA	NA
NP_708713.3|3031166_3031802_+	hypothetical protein	NA	NA	NA	NA	NA
NP_708714.1|3031801_3032218_+	Holliday junction resolvase-like protein	NA	NA	NA	NA	NA
NP_708715.2|3032393_3033419_-	transporter	NA	NA	NA	NA	NA
NP_708716.1|3033391_3034096_+	hypothetical protein	NA	NA	NA	NA	NA
NP_708717.1|3034113_3034680_+	resistance protein	NA	NA	NA	NA	NA
NP_708718.3|3034664_3034967_+	hypothetical protein	NA	NA	NA	NA	NA
NP_708719.1|3034974_3035568_+	dITP/XTP pyrophosphatase	NA	NA	NA	NA	NA
NP_708720.1|3035560_3036697_+	HemN family oxidoreductase	NA	NA	NA	NA	NA
NP_708723.2|3038018_3038522_+	hypothetical protein	NA	NA	NA	NA	NA
NP_708724.1|3038544_3038940_-	insertion element IS1 protein InsB	NA	Q71TF0	Escherichia_phage	92.4	2.0e-66
NP_708725.1|3038966_3039242_-	insertion element IS1 protein InsA	NA	Q71TE9	Escherichia_phage	93.4	6.6e-45
NP_708726.2|3039298_3040600_+	hypothetical protein	NA	NA	NA	NA	NA
NP_708727.2|3040700_3041663_-	hypothetical protein	NA	NA	NA	NA	NA
NP_708728.1|3041779_3042826_-	L-asparaginase II	NA	NA	NA	NA	NA
NP_708729.2|3043001_3043718_-	hypothetical protein	NA	NA	NA	NA	NA
NP_708730.3|3043904_3044261_-	hypothetical protein	NA	NA	NA	NA	NA
NP_708731.1|3044230_3044950_-|tRNA	tRNA (guanine-N(7)-)-methyltransferase	tRNA	NA	NA	NA	NA
NP_708732.2|3045110_3046163_+	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
NP_708733.1|3046190_3046466_+	oxidative damage protection protein	NA	NA	NA	NA	NA
NP_708734.1|3046527_3047610_+	murein transglycosylase C	NA	NA	NA	NA	NA
NP_708735.1|3047763_3049068_+	nucleosides permease	NA	NA	NA	NA	NA
NP_708736.2|3049116_3051312_-	ornithine decarboxylase	NA	NA	NA	NA	NA
NP_708737.1|3051649_3052357_+	transporter	NA	NA	NA	NA	NA
NP_708738.1|3052735_3053998_+|integrase	P4-type integrase	integrase	Q7M297	Enterobacteria_phage	38.3	9.3e-78
NP_708739.1|3054450_3057966_+	superfamily I DNA helicase	NA	NA	NA	NA	NA
YP_008439279.1|3058999_3059248_-	hypothetical protein	NA	NA	NA	NA	NA
NP_708741.2|3059314_3060076_+	hypothetical protein	NA	NA	NA	NA	NA
NP_708742.1|3060436_3064294_+|protease	serine protease	protease	Q9LA58	Enterobacterial_phage	38.3	2.4e-225
NP_708744.1|3065324_3065672_-	hypothetical protein	NA	A0A0P0ZBS5	Stx2-converting_phage	99.1	2.6e-62
NP_708745.1|3065797_3066304_+	hypothetical protein	NA	NA	NA	NA	NA
NP_708746.1|3066390_3067305_+	hypothetical protein	NA	A0A0P0ZBS5	Stx2-converting_phage	72.7	4.2e-128
NP_708747.3|3067736_3071855_-|protease	serine protease	protease	Q9LA54	Enterobacteria_phage	45.8	0.0e+00
3070770:3070785	attR	ATTCTGCCCGCTGAAT	NA	NA	NA	NA
NP_708749.1|3072582_3074091_-	reverse transcriptase-like protein	NA	A0A0U4J920	Pseudomonas_phage	31.8	3.6e-44
NP_708751.1|3074519_3074771_+	hypothetical protein	NA	NA	NA	NA	NA
NP_708753.1|3075172_3075499_-	insertion sequence element IS629 protein	NA	Q6H9S4	Enterobacteria_phage	97.2	2.4e-54
NP_708754.1|3075781_3076207_-	hypothetical protein	NA	NA	NA	NA	NA
NP_708755.1|3076203_3076587_-	hypothetical protein	NA	NA	NA	NA	NA
NP_708756.1|3076959_3077559_-	hypothetical protein	NA	NA	NA	NA	NA
NP_708757.1|3077716_3078925_-|transposase	insertion element iso-IS10R transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	100.0	1.8e-235
NP_708758.3|3079568_3079979_+	IS2 repressor TnpA	NA	Q76S41	Shigella_phage	100.0	1.1e-59
NP_708759.1|3080054_3080843_+|transposase	insertion element IS2 transposase InsD	transposase	Q9ZXG3	Shigella_phage	99.2	9.4e-153
>prophage 23
NC_004337	Shigella flexneri 2a str. 301 chromosome, complete genome	4607202	3173555	3180442	4607202	transposase	Shigella_phage(33.33%)	10	NA	NA
NP_708849.1|3173555_3174716_+	synthetase/amidase	NA	B2ZXR7	Ralstonia_phage	42.9	1.0e-86
NP_708850.1|3174753_3175569_-	LigB family dioxygenase	NA	NA	NA	NA	NA
NP_708851.2|3175684_3176458_+	zinc transporter ZupT	NA	NA	NA	NA	NA
YP_008439283.1|3176515_3176710_-	hypothetical protein	NA	NA	NA	NA	NA
NP_708852.1|3176946_3177600_-	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	44.3	4.9e-46
NP_708853.1|3177913_3178264_+	hypothetical protein	NA	NA	NA	NA	NA
NP_708854.3|3178474_3178885_+	IS2 repressor TnpA	NA	Q76S41	Shigella_phage	99.2	5.4e-59
NP_708855.1|3178842_3179694_+|transposase	insertion element IS2 transposase InsD	transposase	Q9ZXG3	Shigella_phage	99.3	6.1e-166
NP_708856.1|3179744_3180020_+	insertion element IS1 protein InsA	NA	Q71TE9	Escherichia_phage	93.4	6.6e-45
NP_708857.1|3180046_3180442_+	insertion element IS1 protein InsB	NA	Q71TF0	Escherichia_phage	92.4	2.0e-66
>prophage 24
NC_004337	Shigella flexneri 2a str. 301 chromosome, complete genome	4607202	3399223	3406237	4607202		Escherichia_phage(33.33%)	9	NA	NA
NP_709057.2|3399223_3400108_+	methyltransferase	NA	M4QNN5	Ostreococcus_lucimarinus_virus	30.2	2.4e-24
NP_709058.1|3400164_3400392_+	hypothetical protein	NA	NA	NA	NA	NA
NP_709059.1|3400385_3400889_-	insertion element IS1 protein InsB	NA	U5P0U6	Shigella_phage	92.5	2.2e-83
NP_709060.1|3400963_3401290_+	hypothetical protein	NA	NA	NA	NA	NA
NP_709061.1|3401318_3402344_+	substrate-binding transport protein	NA	A0A1B1IT51	uncultured_Mediterranean_phage	39.2	9.9e-70
NP_709063.1|3402972_3403368_-	insertion element IS1 protein InsB	NA	Q71TF0	Escherichia_phage	91.6	2.8e-65
NP_709064.1|3403394_3403670_-	insertion element IS1 protein InsA	NA	Q71TE9	Escherichia_phage	92.3	3.3e-44
NP_709065.2|3404367_3405471_+	transport system permease	NA	NA	NA	NA	NA
NP_709066.1|3405478_3406237_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.7	9.7e-30
>prophage 25
NC_004337	Shigella flexneri 2a str. 301 chromosome, complete genome	4607202	3604779	3611847	4607202	transposase	Shigella_phage(75.0%)	10	NA	NA
NP_709263.3|3604779_3605190_+	IS2 repressor TnpA	NA	Q76S41	Shigella_phage	100.0	1.4e-59
NP_709264.1|3605147_3606053_+|transposase	IS2 transposase TnpB	transposase	Q9ZXG3	Shigella_phage	98.3	3.4e-175
NP_709265.1|3605977_3606865_-	outer membrane pore protein	NA	Q1MVN1	Enterobacteria_phage	51.9	9.8e-66
NP_709266.1|3606885_3607170_+	hypothetical protein	NA	U5P4I9	Shigella_phage	92.5	4.6e-33
NP_709267.1|3607226_3608039_+	hypothetical protein	NA	U5P429	Shigella_phage	93.0	5.5e-148
NP_709268.1|3608358_3608682_-	hypothetical protein	NA	NA	NA	NA	NA
NP_709269.1|3608756_3609260_+	insertion element IS1 protein InsB	NA	U5P0U6	Shigella_phage	91.9	5.0e-83
NP_709270.2|3609888_3610806_-	substrate-binding transport protein	NA	A0A1B1IT51	uncultured_Mediterranean_phage	38.8	1.6e-66
NP_709271.1|3610942_3611269_-	hypothetical protein	NA	NA	NA	NA	NA
NP_709272.1|3611343_3611847_+	insertion element IS1 protein InsB	NA	U5P0U6	Shigella_phage	93.2	9.1e-85
>prophage 26
NC_004337	Shigella flexneri 2a str. 301 chromosome, complete genome	4607202	3624248	3627980	4607202		uncultured_Caudovirales_phage(50.0%)	6	NA	NA
NP_709281.1|3624248_3624644_-	insertion element IS1 protein InsB	NA	Q71TF0	Escherichia_phage	91.6	2.8e-65
NP_709282.1|3624670_3624946_-	insertion element IS1 protein InsA	NA	Q71TE9	Escherichia_phage	93.4	6.6e-45
NP_709283.2|3625016_3625346_+	hypothetical protein	NA	A0A2H4J145	uncultured_Caudovirales_phage	50.5	2.6e-24
NP_709284.2|3625399_3626689_+	arsenical pump membrane protein	NA	A0A2H4J144	uncultured_Caudovirales_phage	73.5	4.6e-173
NP_709285.1|3626701_3627127_+	arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	70.7	1.5e-51
NP_709286.1|3627476_3627980_+	insertion element IS1 protein InsB	NA	U5P0U6	Shigella_phage	92.5	1.3e-83
>prophage 27
NC_004337	Shigella flexneri 2a str. 301 chromosome, complete genome	4607202	3777981	3784700	4607202		Escherichia_phage(33.33%)	10	NA	NA
NP_709410.1|3777981_3778377_-	insertion element IS1 protein InsB	NA	Q71TF0	Escherichia_phage	90.8	6.3e-65
NP_709411.1|3778403_3778679_-	insertion element IS1 protein InsA	NA	Q71TE9	Escherichia_phage	93.4	6.6e-45
NP_709412.1|3778852_3780130_+	3-deoxy-D-manno-octulosonic acid transferase	NA	NA	NA	NA	NA
NP_709413.1|3780137_3780617_+	phosphopantetheine adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	42.0	4.8e-27
NP_709414.2|3780655_3781465_-	formamidopyrimidine/5-formyluracil/ 5-hydroxymethyluracil DNA glycosylase	NA	F8WPX6	Bacillus_phage	32.2	2.6e-25
NP_709415.1|3781562_3781730_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
NP_709416.1|3781750_3781987_-	50S ribosomal protein L28	NA	NA	NA	NA	NA
NP_709417.4|3782203_3782872_-	DNA repair protein	NA	NA	NA	NA	NA
NP_709418.3|3782971_3784264_+	flavoprotein	NA	Q9HH70	Methanothermobacter_phage	33.7	4.5e-43
NP_709419.1|3784241_3784700_+	deoxyuridine 5'-triphosphate nucleotidohydrolase	NA	Q2NP83	Xanthomonas_phage	58.8	1.1e-47
>prophage 28
NC_004337	Shigella flexneri 2a str. 301 chromosome, complete genome	4607202	3794829	3857671	4607202	transposase,protease,integrase,tRNA	Shigella_phage(29.41%)	50	3792375:3792389	3814713:3814727
3792375:3792389	attL	TCAGTATCATGCCCA	NA	NA	NA	NA
NP_709431.1|3794829_3795519_+|tRNA	tRNA guanosine-2'-O-methyltransferase	tRNA	NA	NA	NA	NA
NP_709432.2|3795524_3797606_+	ATP-dependent DNA helicase RecG	NA	NA	NA	NA	NA
NP_709433.1|3797639_3798845_-	glutamate transport protein	NA	NA	NA	NA	NA
NP_709434.2|3799124_3800516_+	transporter	NA	H9YQ34	environmental_Halophage	100.0	1.4e-71
NP_709435.2|3800636_3802346_+	hypothetical protein	NA	NA	NA	NA	NA
NP_709436.1|3802398_3804717_-	alpha-glucosidase	NA	NA	NA	NA	NA
NP_709437.1|3806768_3807980_+|integrase	integrase	integrase	Q7M297	Enterobacteria_phage	69.3	4.2e-160
NP_709438.1|3808391_3809435_+	hypothetical protein	NA	NA	NA	NA	NA
NP_709439.1|3809949_3810411_+	hypothetical protein	NA	NA	NA	NA	NA
NP_709442.1|3811259_3811559_-	hypothetical protein	NA	NA	NA	NA	NA
NP_709445.1|3813225_3813552_-	insertion sequence element IS629 protein	NA	Q6H9S4	Enterobacteria_phage	96.3	1.6e-53
NP_709446.1|3814221_3814494_-	hypothetical protein	NA	NA	NA	NA	NA
NP_709447.1|3814554_3815460_-|transposase	IS2 transposase TnpB	transposase	Q9ZXG3	Shigella_phage	99.3	7.4e-178
3814713:3814727	attR	TGGGCATGATACTGA	NA	NA	NA	NA
NP_709448.3|3815417_3815828_-	IS2 repressor TnpA	NA	Q76S41	Shigella_phage	99.2	4.1e-59
NP_709449.1|3816149_3816344_+	hypothetical protein	NA	NA	NA	NA	NA
NP_709451.1|3818020_3818524_-	insertion element IS1 protein InsB	NA	U5P0U6	Shigella_phage	91.3	5.5e-82
NP_709452.1|3818598_3819570_+	hypothetical protein	NA	NA	NA	NA	NA
NP_709453.1|3819519_3820713_-	membrane transport protein	NA	NA	NA	NA	NA
NP_709454.2|3820791_3822573_+	siderophore biosynthesis protein	NA	NA	NA	NA	NA
NP_709455.1|3822573_3823521_+	siderophore biosynthesis protein	NA	NA	NA	NA	NA
NP_709456.1|3823520_3825263_+	siderophore biosynthesis protein	NA	NA	NA	NA	NA
NP_709457.1|3825259_3826597_+	lysine:N6-hydroxylase	NA	NA	NA	NA	NA
NP_709458.2|3826602_3828798_+	ferric siderophore receptor	NA	NA	NA	NA	NA
NP_709459.1|3829718_3830477_+|protease	serine protease-like protein	protease	NA	NA	NA	NA
NP_709460.1|3830447_3831353_-|transposase	IS2 transposase TnpB	transposase	Q9ZXG3	Shigella_phage	99.3	7.4e-178
NP_709461.3|3831310_3831721_-	IS2 repressor TnpA	NA	Q76S41	Shigella_phage	99.2	4.1e-59
NP_709462.1|3831821_3834344_+	long polar fimbriae	NA	NA	NA	NA	NA
NP_709463.1|3834501_3834897_-	insertion element IS1 protein InsB	NA	Q71TF0	Escherichia_phage	91.6	2.8e-65
NP_709464.1|3834923_3835199_-	insertion element IS1 protein InsA	NA	Q71TE9	Escherichia_phage	92.3	1.9e-44
NP_709465.1|3835509_3836205_+	fimbrial protein	NA	NA	NA	NA	NA
NP_709466.1|3836452_3837493_+	phosphate ABC transporter substrate-binding protein	NA	A0A1D7SRJ6	Cyanophage	38.3	2.7e-51
NP_709467.3|3837639_3838539_+	high-affinity phosphate ABC transporter permease	NA	NA	NA	NA	NA
NP_709468.1|3838538_3839429_+	phosphate ABC transporter permease subunit PtsA	NA	NA	NA	NA	NA
NP_709469.1|3839520_3840294_+	phosphate ABC transporter ATP-binding protein PstB	NA	G9BWD6	Planktothrix_phage	31.6	1.3e-18
NP_709470.2|3840308_3841034_+	transcriptional regulator PhoU	NA	NA	NA	NA	NA
NP_709471.1|3841320_3842142_+	transcriptional antiterminator BglG	NA	NA	NA	NA	NA
NP_709472.2|3842275_3844153_+	PTS system beta-glucoside-specific transporter subunits IIABC	NA	NA	NA	NA	NA
NP_709473.1|3845254_3845530_+	insertion element IS1 protein InsA	NA	Q71TE9	Escherichia_phage	93.4	6.6e-45
NP_709474.1|3845556_3845952_+	insertion element IS1 protein InsB	NA	Q71TF0	Escherichia_phage	91.6	2.8e-65
NP_709475.2|3846466_3848044_+	receptor protein	NA	NA	NA	NA	NA
NP_709476.2|3848070_3849246_+	xylanase	NA	NA	NA	NA	NA
NP_709477.1|3849247_3849970_+	6-phosphogluconolactonase	NA	NA	NA	NA	NA
NP_709479.1|3851558_3851906_-	insertion sequence element ISSfl4 ORF2	NA	A0A0P0ZDM8	Stx2-converting_phage	73.8	4.1e-44
NP_709480.1|3851902_3852577_-|transposase	insertion sequence element ISSfl4 transposase	transposase	A0A0P0ZCV4	Stx2-converting_phage	30.8	2.0e-10
NP_709481.1|3852744_3853218_-	hypothetical protein	NA	NA	NA	NA	NA
NP_709482.1|3853284_3853941_-	6-phosphogluconate phosphatase	NA	NA	NA	NA	NA
NP_709483.2|3854105_3855443_+	membrane / transport protein	NA	A0A0R6PHV4	Moraxella_phage	35.7	2.6e-62
NP_709484.1|3855496_3856063_-	hypothetical protein	NA	NA	NA	NA	NA
NP_709485.2|3856084_3856834_-	hypothetical protein	NA	NA	NA	NA	NA
NP_709486.1|3857368_3857671_+|transposase	insertion sequence element IS600 transposase	transposase	NA	NA	NA	NA
>prophage 29
NC_004337	Shigella flexneri 2a str. 301 chromosome, complete genome	4607202	4357934	4399077	4607202	transposase,integrase	Shigella_phage(33.33%)	42	4379472:4379527	4410187:4410242
NP_709896.1|4357934_4359536_-|transposase	insertion sequence element ISSfl4 transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	61.5	4.9e-148
NP_709898.1|4359880_4360555_-|transposase	insertion sequence element ISSfl4 transposase	transposase	A0A0P0ZCV4	Stx2-converting_phage	30.1	5.8e-10
NP_709899.3|4360669_4361080_+	IS2 repressor TnpA	NA	Q76S41	Shigella_phage	100.0	1.4e-59
NP_709900.1|4361037_4361943_+|transposase	IS2 transposase TnpB	transposase	Q9ZXG3	Shigella_phage	98.7	6.3e-177
NP_709901.4|4362142_4362829_-	hypothetical protein	NA	A0A2R2ZGT8	Clostridioides_phage	45.6	1.1e-37
NP_709902.2|4362964_4363660_+	hypothetical protein	NA	NA	NA	NA	NA
NP_709903.1|4363656_4364118_+	hypothetical protein	NA	NA	NA	NA	NA
NP_709904.1|4364130_4365303_+	isoaspartyl dipeptidase	NA	NA	NA	NA	NA
NP_709905.1|4365367_4366279_+	cell density-dependent motility repressor	NA	NA	NA	NA	NA
NP_709906.2|4366271_4366673_-	DNA replication/recombination/repair protein	NA	NA	NA	NA	NA
NP_709907.1|4366949_4367345_-	insertion element IS1 protein InsB	NA	Q71TF0	Escherichia_phage	91.6	2.8e-65
NP_709908.1|4367371_4367647_-	insertion element IS1 protein InsA	NA	Q71TE9	Escherichia_phage	93.4	6.6e-45
NP_709909.1|4368113_4368944_+	hypothetical protein	NA	NA	NA	NA	NA
NP_709910.1|4369084_4369858_-	DNA-binding transcriptional repressor UxuR	NA	NA	NA	NA	NA
NP_709911.1|4370072_4371533_-	D-mannonate oxidoreductase	NA	H8ZJP8	Ostreococcus_tauri_virus	32.2	2.1e-49
NP_709912.2|4371613_4372798_-	mannonate dehydratase	NA	NA	NA	NA	NA
NP_709913.1|4373137_4374481_+	fructuronate transporter	NA	NA	NA	NA	NA
NP_709914.1|4374731_4375634_-	minor fimbrial subunit, D-mannose specific adhesin	NA	NA	NA	NA	NA
NP_709915.2|4375653_4376157_-	minor fimbrial subunit	NA	NA	NA	NA	NA
NP_709916.2|4376169_4376700_-	minor fimbrial subunit	NA	NA	NA	NA	NA
NP_709917.1|4378773_4379169_-	insertion element IS1 protein InsB	NA	NA	NA	NA	NA
NP_709918.1|4379195_4379471_-	insertion element IS1 protein InsA	NA	Q71TE9	Escherichia_phage	93.4	6.6e-45
4379472:4379527	attL	GCAAGCACCTTAAAATCACCATCATACACTAAATCAGTAAGTTGGCAGCATTACCC	NA	NA	NA	NA
NP_709919.2|4380188_4380914_-	periplasmic chaperone	NA	NA	NA	NA	NA
NP_709920.2|4380950_4381589_-	fimbrial protein	NA	NA	NA	NA	NA
NP_709921.1|4381554_4382103_-	major type 1 subunit fimbrin	NA	NA	NA	NA	NA
NP_709922.1|4382583_4383180_-	tyrosine recombinase	NA	A0A2L1IV36	Escherichia_phage	53.4	3.9e-50
NP_709923.1|4383774_4384260_-	recombinase	NA	NA	NA	NA	NA
NP_709924.3|4385704_4386430_+	hypothetical protein	NA	NA	NA	NA	NA
NP_709925.2|4386341_4387556_+	N-acetylneuraminic acid mutarotase	NA	NA	NA	NA	NA
NP_709926.3|4387620_4388601_+	hypothetical protein	NA	Q08JA2	Stx2-converting_phage	56.2	7.9e-101
NP_709927.1|4389069_4389465_-	insertion element IS1 protein InsB	NA	Q71TF0	Escherichia_phage	90.8	1.8e-64
NP_709928.1|4389491_4389767_-	insertion element IS1 protein InsA	NA	Q71TE9	Escherichia_phage	93.4	6.6e-45
NP_709929.2|4389861_4390557_+	DeoR family transcriptional regulator	NA	NA	NA	NA	NA
NP_709930.1|4391026_4391311_+	hypothetical protein	NA	U5P4I9	Shigella_phage	92.5	4.6e-33
NP_709931.1|4391367_4392180_+	hypothetical protein	NA	U5P429	Shigella_phage	93.0	5.5e-148
NP_709932.1|4392499_4392823_-	hypothetical protein	NA	NA	NA	NA	NA
NP_709933.1|4392897_4393401_+	insertion element IS1 protein InsB	NA	U5P0U6	Shigella_phage	91.9	5.0e-83
NP_709934.1|4393557_4393896_+|transposase	insertion sequence element IS911 transposase InsN	transposase	Q716C1	Shigella_phage	100.0	9.5e-46
NP_709935.1|4393922_4394762_+|integrase	insertion sequence element IS911 integrase core domain-containing protein	integrase	Q716C2	Shigella_phage	99.6	1.3e-168
NP_709936.2|4394736_4395948_-|integrase	P4-type integrase	integrase	B7SYF8	Stenotrophomonas_phage	42.3	2.0e-77
NP_709937.2|4396384_4397446_+	oxidoreductase	NA	A0A0G2Y405	Acanthamoeba_polyphaga_mimivirus	30.2	3.5e-46
NP_709938.1|4397526_4399077_+	hypothetical protein	NA	A0A248XCZ8	Klebsiella_phage	44.3	1.2e-82
4410187:4410242	attR	GGGTAATGCTGCCAACTTACTGATTTAGTGTATGATGGTGATTTTAAGGTGCTTGC	NA	NA	NA	NA
>prophage 30
NC_004337	Shigella flexneri 2a str. 301 chromosome, complete genome	4607202	4511429	4519772	4607202		Escherichia_phage(71.43%)	9	NA	NA
NP_710044.3|4511429_4513913_+	hypothetical protein	NA	Q0GXV6	Lactococcus_phage	33.1	2.9e-67
NP_710045.1|4514092_4514824_+	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
NP_710046.1|4514924_4515200_+	insertion element IS1 protein InsA	NA	Q71TE9	Escherichia_phage	92.3	2.5e-44
NP_710047.1|4515226_4515622_+	insertion element IS1 protein InsB	NA	Q71TF0	Escherichia_phage	91.6	2.8e-65
NP_710048.1|4515887_4516526_+	hypothetical protein	NA	NA	NA	NA	NA
NP_710049.2|4516528_4517692_+	synthetase/amidase	NA	B2ZXR7	Ralstonia_phage	43.5	1.4e-80
NP_710050.1|4517757_4519140_+	carnitine operon oxidoreductase	NA	A0A2L1IV26	Escherichia_phage	96.2	1.4e-05
NP_710051.1|4519074_4519470_-	insertion element IS1 protein InsB	NA	Q71TF0	Escherichia_phage	91.6	4.4e-66
NP_710052.1|4519496_4519772_-	insertion element IS1 protein InsA	NA	Q71TE9	Escherichia_phage	93.4	6.6e-45
>prophage 1
NC_004851	Shigella flexneri 2a str. 301 plasmid pCP301, complete sequence	221618	190	6925	221618		Stx2-converting_phage(33.33%)	8	NA	NA
NP_858134.1|190_493_-	IS2 ORF2	NA	Q9ZXG3	Shigella_phage	88.2	2.3e-35
NP_858135.1|484_949_+	resolvase	NA	NA	NA	NA	NA
NP_858136.1|1175_2042_+	OspB protein	NA	A0A0P0ZCT1	Stx2-converting_phage	32.7	9.4e-29
NP_858137.1|2370_3111_+	PhoN2 (Apy), periplasmic phosphatase, apyrase, ATP diphosphohydrolase	NA	A0A1B1IUP6	uncultured_Mediterranean_phage	28.4	7.5e-11
NP_858138.1|3470_4745_-	OspC4	NA	NA	NA	NA	NA
NP_858139.2|5263_5665_-	hypothetical protein	NA	A0A0P0ZBS5	Stx2-converting_phage	58.2	4.9e-33
NP_858140.1|5744_6095_-	IS600 ORF2	NA	A0A0P0I4A4	Acinetobacter_phage	37.0	2.8e-08
NP_858141.1|6106_6925_-	IS600 ORF2	NA	A0A0P0I4A4	Acinetobacter_phage	44.9	2.9e-64
>prophage 2
NC_004851	Shigella flexneri 2a str. 301 plasmid pCP301, complete sequence	221618	18103	100231	221618	transposase,protease	Escherichia_phage(26.0%)	95	NA	NA
NP_858154.1|18103_18310_+|transposase	transposase	transposase	NA	NA	NA	NA
NP_858155.1|18897_19575_+	protein OspD1	NA	NA	NA	NA	NA
NP_858156.1|20086_20401_+	hypothetical protein	NA	NA	NA	NA	NA
NP_858157.2|20682_21249_+	hypothetical protein	NA	NA	NA	NA	NA
NP_858158.1|21745_22330_+	IS3 ORF2	NA	U5P429	Shigella_phage	51.2	2.5e-46
NP_858159.1|23116_23899_+	IS100 ORF1	NA	A0A2L1IVA1	Escherichia_phage	96.1	3.6e-128
NP_858161.2|23819_25043_-	ISSfl3 ORF	NA	S5FM71	Shigella_phage	58.7	1.8e-126
NP_858160.2|25017_25449_+	IS100 ORF1	NA	A0A2L1IVA1	Escherichia_phage	93.2	5.1e-60
NP_858162.1|25445_26228_+|transposase	transposase/IS protein	transposase	A0A2L1IVB6	Escherichia_phage	98.8	8.5e-138
NP_858163.1|26243_26633_+	iso-IS1 ORF2	NA	A0A0U2RK18	Escherichia_phage	85.2	9.0e-56
NP_858164.1|26954_28154_+	plasmid segregation protein	NA	Q71TL9	Escherichia_phage	75.1	2.0e-175
NP_858165.1|28153_29134_+	plasmid segregation protein	NA	Q38420	Escherichia_phage	58.2	5.0e-95
NP_858167.2|29338_29521_-	hypothetical protein	NA	NA	NA	NA	NA
NP_858166.2|29515_29875_+|transposase	transposase	transposase	NA	NA	NA	NA
NP_858170.1|31155_31551_+	hypothetical protein	NA	NA	NA	NA	NA
NP_858171.1|31391_31811_+	hypothetical protein	NA	NA	NA	NA	NA
NP_858172.1|32083_32752_-	IS629 ORF2	NA	Q6H9S3	Enterobacteria_phage	98.6	1.4e-120
NP_858173.1|32966_33293_-	IS629 ORF1	NA	Q6H9S4	Enterobacteria_phage	94.4	2.3e-52
NP_858174.1|33298_33706_-	IS150 ORF B	NA	A0A2I6AZV9	Macacine_betaherpesvirus	96.9	2.6e-45
NP_858175.1|33761_33950_+|transposase	IS1294 transposase	transposase	NA	NA	NA	NA
NP_858176.1|33959_35159_+|transposase	IS1294 transposase	transposase	NA	NA	NA	NA
NP_858177.1|35564_36086_-	IS150 ORF1(ORF A)	NA	A0A2I6AZV8	Macacine_betaherpesvirus	99.4	6.1e-92
NP_858178.1|36123_36507_+	IS100 ORF2	NA	A0A2L1IVB6	Escherichia_phage	98.1	9.1e-53
NP_858179.2|36448_37237_-	transcriptional activator VirF	NA	NA	NA	NA	NA
NP_858180.1|37779_38067_+	IS2 ORF2	NA	Q9ZXG3	Shigella_phage	69.9	1.7e-27
YP_001449236.1|38248_38515_+	OspE2	NA	NA	NA	NA	NA
NP_858183.2|38611_38824_-	IS1 encoded protein	NA	NA	NA	NA	NA
NP_858182.2|38752_38980_+	IS1 ORF1	NA	Q71TE9	Escherichia_phage	92.0	3.9e-35
NP_858184.1|39006_39402_+	IS1 ORF2	NA	Q71TF0	Escherichia_phage	91.6	6.3e-65
NP_858187.1|41196_42888_+	invasion plasmid antigen	NA	NA	NA	NA	NA
NP_858188.1|42939_43266_+	IS629 ORF1	NA	Q6H9S4	Enterobacteria_phage	96.3	1.6e-53
NP_858189.1|43480_44149_+	IS629 ORF2	NA	Q6H9S3	Enterobacteria_phage	96.8	8.3e-118
NP_858190.1|44188_44377_-	IS600 ORF2	NA	NA	NA	NA	NA
NP_858191.1|44412_44715_-	IS600 ORF1	NA	Q716C1	Shigella_phage	31.3	5.0e-06
NP_858192.1|44782_45265_-	hypothetical protein	NA	NA	NA	NA	NA
NP_858193.2|45255_45558_-	hypothetical protein	NA	NA	NA	NA	NA
YP_145811.1|45829_46102_+	hypothetical protein	NA	NA	NA	NA	NA
NP_858194.1|46082_47291_+|transposase	IS1294 transposase	transposase	NA	NA	NA	NA
NP_858195.1|47360_47591_+	ISSfl1 ORF2	NA	NA	NA	NA	NA
NP_858196.1|47739_49194_-	hypothetical protein	NA	NA	NA	NA	NA
NP_858197.1|49510_49708_-	IS1 encoded protein	NA	NA	NA	NA	NA
NP_858198.1|49782_50241_+	IS1 ORF2	NA	U5P0U6	Shigella_phage	89.9	3.2e-68
NP_858199.1|50266_50593_+	IS629 ORF1	NA	Q6H9S4	Enterobacteria_phage	94.4	2.3e-52
NP_858200.1|50807_51476_+	IS629 ORF2	NA	Q6H9S3	Enterobacteria_phage	98.2	5.2e-120
NP_858201.1|51441_51930_+	hypothetical protein	NA	A0A0P0ZEB3	Stx2-converting_phage	65.4	1.9e-47
NP_858202.1|51949_52576_+	IS21 ORF2	NA	U5N3V8	Enterobacteria_phage	37.4	9.4e-31
NP_858203.1|52744_56839_-|protease	extracellular serine protease SepA	protease	Q9LA58	Enterobacterial_phage	42.3	7.3e-281
NP_858204.1|57240_57429_+|transposase	IS1294 transposase	transposase	NA	NA	NA	NA
NP_858205.1|57438_58638_+|transposase	IS1294 transposase	transposase	NA	NA	NA	NA
NP_858206.1|58934_59264_+	ISSfl1 ORF1	NA	A0A0N9SHJ4	Paenibacillus_phage	51.3	1.4e-12
NP_858207.1|59269_59659_+	ISSfl1 ORF2	NA	A0A1V0SLQ8	Klosneuvirus	37.8	7.7e-07
NP_858208.1|59773_60805_+	IS630 orf	NA	NA	NA	NA	NA
NP_858209.1|60986_61271_+	iso-IS1 ORF1	NA	A0A0U2RK18	Escherichia_phage	69.3	2.6e-28
NP_858210.1|61396_61579_+	iso-IS1 ORF2	NA	A0A0U2RK18	Escherichia_phage	82.1	2.0e-21
NP_858211.1|62213_63911_+	invasion plasmid antigen	NA	NA	NA	NA	NA
NP_858212.1|64338_66063_+	invasion plasmid antigen	NA	NA	NA	NA	NA
NP_858213.1|66114_66441_+	IS629 ORF1	NA	Q6H9S4	Enterobacteria_phage	92.6	5.6e-51
NP_858214.1|66655_67369_+	IS629 ORF2	NA	Q6H9S3	Enterobacteria_phage	99.0	1.0e-113
NP_858215.1|68287_69691_+	invasion plasmid gene product	NA	NA	NA	NA	NA
NP_858216.1|69659_69950_+	hypothetical protein	NA	NA	NA	NA	NA
NP_858217.1|70194_71403_+	iso-IS10R ORF	NA	A0A0F7LAS3	uncultured_marine_virus	99.8	8.8e-235
NP_858218.1|71381_71573_-	IS100 ORF2	NA	A0A2L1IVB6	Escherichia_phage	96.2	6.6e-20
NP_858219.1|71613_72117_-	hypothetical protein	NA	A0A0P0ZEB3	Stx2-converting_phage	65.9	6.6e-59
NP_858220.1|72089_72881_-	IS629 ORF2	NA	Q6H9S3	Enterobacteria_phage	99.5	3.9e-114
NP_858221.1|73095_73422_-	IS629 ORF1	NA	Q6H9S4	Enterobacteria_phage	95.4	1.3e-52
NP_858222.1|73673_74336_+|transposase	transposase/IS protein	transposase	A0A2L1IVB6	Escherichia_phage	99.1	1.8e-117
NP_858223.1|74708_75071_+|transposase	IS1294 transposase	transposase	NA	NA	NA	NA
NP_858297.1|74711_74978_-|transposase	IS1294 transposase	transposase	NA	NA	NA	NA
NP_858224.1|75049_76258_-	iso-IS10R ORF	NA	A0A0F7LAS3	uncultured_marine_virus	100.0	1.8e-235
NP_858225.1|76327_77257_-|transposase	IS1294 transposase	transposase	NA	NA	NA	NA
NP_858226.1|77912_79610_-	hypothetical protein	NA	NA	NA	NA	NA
NP_858227.1|79938_81351_-	protein OspC1	NA	NA	NA	NA	NA
NP_858228.1|81805_82105_-	ISSfl4 ORF3	NA	NA	NA	NA	NA
NP_858230.2|82114_82504_-	hypothetical protein	NA	NA	NA	NA	NA
NP_858229.2|82465_82654_+	IS91 ORF2	NA	NA	NA	NA	NA
NP_858231.1|82690_83080_-	ISSfl1 ORF2	NA	A0A1V0SLQ8	Klosneuvirus	37.8	7.7e-07
NP_858232.1|83085_83625_-	ISSfl1 ORF1	NA	A0A0N9SHJ4	Paenibacillus_phage	47.7	1.9e-19
NP_858233.1|83644_84118_-	hypothetical protein	NA	NA	NA	NA	NA
NP_858234.1|84368_85565_+	ISSfl2 ORF	NA	NA	NA	NA	NA
NP_858235.1|85559_85979_-	hypothetical protein	NA	NA	NA	NA	NA
NP_858238.1|87009_87915_-|transposase	insertion element IS2 transposase InsD	transposase	Q9ZXG3	Shigella_phage	99.0	3.7e-177
NP_858239.1|87872_88283_-	insertion sequence 2 OrfA protein	NA	Q76S41	Shigella_phage	99.2	4.1e-59
NP_858240.1|88352_89171_-	IS600 ORF2	NA	A0A0P0I4A4	Acinetobacter_phage	44.9	2.9e-64
NP_858241.1|89206_89509_-	IS600 ORF1	NA	Q716C1	Shigella_phage	31.3	1.1e-05
NP_858242.1|90029_90515_-	hypothetical protein	NA	NA	NA	NA	NA
NP_858243.2|90502_90787_-	hypothetical protein	NA	NA	NA	NA	NA
NP_858244.1|91688_91853_+	hypothetical protein	NA	NA	NA	NA	NA
NP_858245.1|92106_93708_-	ISSfl4 ORF3	NA	A0A0P0ZBS5	Stx2-converting_phage	61.3	4.6e-146
NP_858246.1|93704_94055_-	ISSfl4 ORF2	NA	A0A0P0ZDM8	Stx2-converting_phage	67.5	1.8e-26
NP_858247.1|94051_94726_-	ISSfl4 ORF1	NA	A0A0P0ZCV4	Stx2-converting_phage	29.3	4.9e-09
NP_858248.1|95294_96749_+	OspC3	NA	NA	NA	NA	NA
NP_858249.1|97086_97389_+	IS600 ORF1	NA	Q716C1	Shigella_phage	31.3	5.0e-06
NP_858250.1|97416_98151_+	IS600 ORF2	NA	A0A0P0I4A4	Acinetobacter_phage	47.3	3.3e-59
NP_858251.1|98572_98995_+	IS150 ORF B	NA	A0A2I6AZV9	Macacine_betaherpesvirus	44.1	1.3e-23
NP_858252.2|99454_100231_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 3
NC_004851	Shigella flexneri 2a str. 301 plasmid pCP301, complete sequence	221618	164526	178801	221618	transposase	Stx2-converting_phage(50.0%)	23	NA	NA
NP_858331.2|164526_165210_+	methylase	NA	A0A2I7RE86	Vibrio_phage	36.9	2.3e-30
NP_858332.1|165210_165432_+	hypothetical protein	NA	NA	NA	NA	NA
NP_858333.2|165428_165629_+	hypothetical protein	NA	NA	NA	NA	NA
NP_858334.1|165662_165878_+	hypothetical protein	NA	NA	NA	NA	NA
NP_858335.1|165922_166693_+	hypothetical protein	NA	NA	NA	NA	NA
NP_858336.1|167031_167685_-|transposase	transposase	transposase	NA	NA	NA	NA
NP_858337.1|167759_169361_-	ISSfl4 ORF3	NA	A0A0P0ZEB3	Stx2-converting_phage	61.2	3.2e-147
NP_858338.1|169357_169708_-	ISSfl4 ORF2	NA	A0A0P0ZDM8	Stx2-converting_phage	67.5	1.8e-26
NP_858339.1|169704_170379_-	ISSfl4 ORF1	NA	A0A0P0ZCV4	Stx2-converting_phage	29.3	4.9e-09
NP_858340.1|170326_171064_-	IS2 ORF2	NA	Q9ZXG3	Shigella_phage	97.0	1.8e-113
NP_858341.2|171134_171500_-	insertion sequence 2 OrfA protein	NA	Q76S41	Shigella_phage	100.0	9.6e-60
NP_858342.1|171971_172610_-	hypothetical protein	NA	NA	NA	NA	NA
NP_858343.1|172966_173239_-	iso-IS1 ORF1	NA	A0A0U2RK18	Escherichia_phage	71.6	5.9e-30
NP_858344.1|173437_174112_+	ISSfl4 ORF1	NA	A0A0P0ZCV4	Stx2-converting_phage	30.8	2.0e-10
NP_858345.1|174108_174456_+	ISSfl4 ORF2	NA	A0A0P0ZDM8	Stx2-converting_phage	73.8	9.2e-44
NP_858346.1|174475_176077_+	ISSfl4 ORF3	NA	A0A0P0ZBS5	Stx2-converting_phage	61.8	2.2e-148
NP_858347.1|176265_176499_+	IS100 ORF2	NA	A0A2L1IVB6	Escherichia_phage	83.1	6.2e-28
NP_858348.1|176550_176841_-	hypothetical protein	NA	NA	NA	NA	NA
NP_858349.1|176809_177061_-	hypothetical protein	NA	NA	NA	NA	NA
NP_858350.1|177512_177797_+	hypothetical protein	NA	NA	NA	NA	NA
NP_858351.1|177796_178072_+	hypothetical protein	NA	NA	NA	NA	NA
NP_858352.1|178124_178304_+	hypothetical protein	NA	NA	NA	NA	NA
NP_858353.1|178297_178801_-	IS1 ORF2	NA	U5P0U6	Shigella_phage	92.5	2.2e-83
