The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_002516	Pseudomonas aeruginosa PAO1, complete genome	6264404	673190	705966	6264404		Pseudomonas_phage(48.48%)	39	NA	NA
NP_249302.1|673190_673961_-	HTH-type transcriptional regulator PrtR	NA	A0A1B0Z078	Pseudomonas_phage	59.1	1.4e-71
NP_249303.1|674418_674619_+	repressor PtrB	NA	W6ATC1	Enterobacter_phage	58.3	3.7e-05
NP_249304.1|674666_675026_+	hypothetical protein	NA	NA	NA	NA	NA
NP_249305.1|675389_675839_+	hypothetical protein	NA	B5TK61	Pseudomonas_phage	53.3	5.0e-26
NP_249306.1|675860_676376_+	hypothetical protein	NA	A0A2H4J881	uncultured_Caudovirales_phage	42.9	4.1e-32
NP_249307.1|676372_676930_+	hypothetical protein	NA	A0A2H4JG06	uncultured_Caudovirales_phage	71.1	4.6e-45
NP_249308.1|677082_677409_+	bacteriophage protein	NA	A0A2H4JA09	uncultured_Caudovirales_phage	60.2	2.4e-30
NP_249309.1|677405_678293_+	bacteriophage protein	NA	S4TNY7	Salmonella_phage	59.8	5.3e-88
NP_249310.1|678285_678819_+	bacteriophage protein	NA	Q9ZXK7	Pseudomonas_virus	64.6	3.0e-62
NP_249311.1|678820_680896_+	bacteriophage protein	NA	Q9ZXK6	Pseudomonas_virus	50.2	5.1e-198
NP_249312.1|680892_681351_+	hypothetical protein	NA	NA	NA	NA	NA
NP_249313.1|681393_682554_+	bacteriophage protein	NA	Q38068	Phage_PS17	83.2	2.0e-188
NP_249314.1|682566_683070_+	bacteriophage protein	NA	Q7M2A5	Pseudomonas_phage	73.5	8.0e-65
NP_249315.1|683084_683429_+	hypothetical protein	NA	NA	NA	NA	NA
NP_249316.1|683598_685836_+	hypothetical protein	NA	NA	NA	NA	NA
NP_249317.1|685845_686718_+	hypothetical protein	NA	A0A2H4J875	uncultured_Caudovirales_phage	51.4	2.5e-74
NP_249318.1|686692_686899_+	hypothetical protein	NA	A0A2H4J9Z9	uncultured_Caudovirales_phage	64.2	2.3e-18
NP_249319.1|686956_687946_+	hypothetical protein	NA	A0A2H4JBF6	uncultured_Caudovirales_phage	55.8	7.5e-107
NP_249320.1|687978_688608_+	hypothetical protein	NA	A0A125RNP1	Pseudomonas_phage	78.0	1.6e-86
NP_249321.1|688604_688967_+	hypothetical protein	NA	H2BDA0	Pseudomonas_phage	47.9	1.9e-15
NP_249322.1|688963_689221_+	hypothetical protein	NA	A0A125RNP3	Pseudomonas_phage	64.6	8.3e-18
NP_249324.1|689536_690031_+	hypothetical protein	NA	A0A286S1Q8	Klebsiella_phage	56.5	1.4e-45
NP_249325.1|690042_690390_+	hypothetical protein	NA	NA	NA	NA	NA
NP_249326.1|690419_690674_+	hypothetical protein	NA	A0A2H4PI34	Pseudomonas_phage	38.4	6.3e-10
NP_249327.1|690720_692556_+	hypothetical protein	NA	A0A0S2SYD9	Pseudomonas_phage	36.2	1.2e-28
NP_249328.1|692548_692890_+	hypothetical protein	NA	Q6UAW6	Klebsiella_phage	40.0	1.4e-17
NP_249329.1|692897_693593_+	bacteriophage protein	NA	A0A1B0VNE0	Pseudomonas_phage	49.8	9.7e-69
NP_249330.1|693595_694366_+	hypothetical protein	NA	A0A2D1GNP8	Pseudomonas_phage	55.6	4.2e-81
NP_249331.1|694420_695023_+	bacteriophage protein	NA	A0A1V0E8A0	Vibrio_phage	57.8	2.2e-53
NP_249332.1|695081_698696_+	bacteriophage protein	NA	A0A0S2SYC5	Pseudomonas_phage	54.7	0.0e+00
NP_249334.1|699743_700835_+	hypothetical protein	NA	A0A0S2SY45	Pseudomonas_phage	36.9	1.3e-46
NP_249335.1|700834_701170_+	hypothetical protein	NA	NA	NA	NA	NA
NP_249336.1|701150_701381_+	hypothetical protein	NA	A0A1W6JT87	Pseudomonas_phage	62.7	3.3e-18
NP_249337.1|701476_702529_+	hypothetical protein	NA	A0A0H5AXZ9	Pseudomonas_phage	52.2	4.6e-62
NP_249338.1|702528_702831_+	hypothetical protein	NA	A0A0H5B141	Pseudomonas_phage	71.0	4.4e-34
NP_249339.1|702827_703058_+	hypothetical protein	NA	C8ZKF3	Pseudomonas_phage	71.6	8.2e-25
NP_249340.1|703476_704082_+	anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	66.3	4.6e-75
NP_249341.1|704083_705133_+	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	57.8	1.8e-111
NP_249342.1|705129_705966_+	indole-3-glycerol phosphate synthase	NA	A0A0P0IR83	Acinetobacter_phage	56.9	2.1e-70
>prophage 2
NC_002516	Pseudomonas aeruginosa PAO1, complete genome	6264404	789359	796776	6264404	coat,integrase	Pseudomonas_phage(100.0%)	11	785311:785337	797721:797747
785311:785337	attL	TGGAGCGGGCGAAGGGAATCGAACCCT	NA	NA	NA	NA
NP_249409.1|789359_789650_+	hypothetical protein	NA	Q56VP7	Pseudomonas_phage	96.9	7.4e-55
NP_249410.1|789653_790031_+	hypothetical protein	NA	Q56VP6	Pseudomonas_phage	97.6	9.9e-60
NP_249411.1|790165_790600_+	helix destabilizing protein of bacteriophage Pf1	NA	Q56VP5	Pseudomonas_phage	86.1	5.1e-60
NP_249412.1|790616_790709_+	hypothetical protein	NA	Q56VP4	Pseudomonas_phage	100.0	7.3e-09
NP_249413.1|790721_790973_+	hypothetical protein	NA	NA	NA	NA	NA
NP_249414.1|790985_791234_+|coat	phage coat protein B	coat	Q56VP2	Pseudomonas_phage	92.7	2.0e-32
NP_249415.1|791369_792632_+|coat	phage coat protein A	coat	Q56VP1	Pseudomonas_phage	56.0	6.7e-52
NP_249416.1|792636_792993_+	hypothetical protein	NA	Q56VP0	Pseudomonas_phage	100.0	7.9e-59
NP_249417.1|792996_794271_+	hypothetical protein	NA	Q56VN9	Pseudomonas_phage	88.7	2.1e-202
NP_249418.1|794500_795793_+	hypothetical protein	NA	Q56VN8	Pseudomonas_phage	94.2	2.8e-247
NP_249419.1|795792_796776_+|integrase	bacteriophage integrase	integrase	Q56VN7	Pseudomonas_phage	52.6	4.7e-93
797721:797747	attR	TGGAGCGGGCGAAGGGAATCGAACCCT	NA	NA	NA	NA
>prophage 3
NC_002516	Pseudomonas aeruginosa PAO1, complete genome	6264404	2947802	2954696	6264404	tRNA	uncultured_Caudovirales_phage(83.33%)	9	NA	NA
NP_251294.1|2947802_2948471_+	hypothetical protein	NA	A0A2H4JFM9	uncultured_Caudovirales_phage	82.1	1.5e-90
NP_251295.1|2948581_2948977_+	sulfurtransferase TusD	NA	A0A2H4JA39	uncultured_Caudovirales_phage	72.1	2.7e-47
NP_251296.1|2948973_2949333_+	sulfur relay protein TusC	NA	A0A2H4J8C0	uncultured_Caudovirales_phage	61.7	1.4e-34
NP_251297.1|2949332_2949638_+	hypothetical protein	NA	NA	NA	NA	NA
NP_251298.1|2949634_2949970_+	hypothetical protein	NA	A0A2H4J8B6	uncultured_Caudovirales_phage	69.4	1.5e-38
NP_251299.1|2949966_2950950_+	hypothetical protein	NA	A0A2H4JBY5	uncultured_Caudovirales_phage	74.3	9.3e-142
NP_251300.1|2951037_2952012_+	hypothetical protein	NA	NA	NA	NA	NA
NP_251301.1|2952016_2953414_-	siroheme synthase	NA	NA	NA	NA	NA
NP_251302.1|2953415_2954696_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	45.4	8.2e-98
>prophage 4
NC_002516	Pseudomonas aeruginosa PAO1, complete genome	6264404	4051563	4060592	6264404		Bacillus_phage(33.33%)	8	NA	NA
NP_252307.1|4051563_4052604_-	recombinase A	NA	A0A0S2MVG1	Bacillus_phage	59.5	1.5e-113
NP_252308.1|4052737_4053244_-	hypothetical protein	NA	B5TK85	Pseudomonas_phage	76.0	8.1e-57
NP_252309.1|4053391_4054399_+	hypothetical protein	NA	NA	NA	NA	NA
NP_252310.1|4054524_4057092_+	DNA mismatch repair protein MutS	NA	A0A1V0SGG8	Hokovirus	22.1	3.2e-24
NP_252311.1|4057158_4057482_+	ferredoxin I	NA	NA	NA	NA	NA
NP_252312.1|4057908_4058913_-	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.3	7.0e-36
NP_252313.1|4059017_4059911_-	hypothetical protein	NA	A0A0S2SXL7	Bacillus_phage	34.3	3.0e-06
NP_252314.1|4059956_4060592_-	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	52.3	1.0e-40
