The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_000913	Escherichia coli str. K-12 substr. MG1655, complete genome	4641652	12162	25207	4641652	transposase,tRNA	Escherichia_phage(25.0%)	13	NA	NA
NP_414555.1|12162_14079_+	chaperone protein DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	51.1	6.9e-149
NP_414556.1|14167_15298_+	chaperone protein DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	37.1	1.4e-27
NP_414557.1|15444_16557_+|transposase	IS186/IS421 transposase	transposase	NA	NA	NA	NA
NP_414559.1|16750_16960_-	regulatory protein MokC	NA	A0A0P0ZAX5	Stx2-converting_phage	73.9	8.0e-19
YP_025292.1|16750_16903_-	protein HokC	NA	A0A0U2QV81	Escherichia_phage	78.0	1.6e-13
NP_414560.1|17488_18655_+	Na(+):H(+) antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	50.5	3.4e-90
NP_414561.1|18714_19620_+	DNA-binding transcriptional activator NhaR	NA	NA	NA	NA	NA
NP_414562.1|19810_20314_-	IS1 protein InsB	NA	U5P0U6	Shigella_phage	100.0	7.4e-95
NP_414563.1|20232_20508_-	IS1 protein InsA	NA	Q71TE9	Escherichia_phage	98.9	2.0e-46
NP_414564.1|20814_21078_-	30S ribosomal subunit protein S20	NA	NA	NA	NA	NA
NP_414565.1|21180_21399_+	DUF2575 domain-containing protein YaaY	NA	NA	NA	NA	NA
NP_414566.1|21406_22348_+	bifunctional riboflavin kinase/FMN adenylyltransferase	NA	NA	NA	NA	NA
NP_414567.1|22390_25207_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A2K9L260	Tupanvirus	26.1	2.7e-77
>prophage 2
NC_000913	Escherichia coli str. K-12 substr. MG1655, complete genome	4641652	247636	297096	4641652	transposase,integrase	Escherichia_phage(37.5%)	50	262898:262957	297206:297265
NP_414763.1|247636_248134_+|transposase	REP-associated tyrosine transposase	transposase	NA	NA	NA	NA
NP_414766.1|250897_251953_+	DNA polymerase IV	NA	NA	NA	NA	NA
NP_414767.1|252004_252298_+	antitoxin YafN	NA	NA	NA	NA	NA
NP_414768.1|252300_252699_+	ribosome-dependent mRNA interferase toxin YafO	NA	NA	NA	NA	NA
NP_414769.1|252708_253161_+	putative acyltransferase with acyl-CoA N-acyltransferase domain	NA	NA	NA	NA	NA
NP_414772.1|254258_255716_-	peptidase D	NA	NA	NA	NA	NA
NP_414773.1|255976_256435_+	xanthine-guanine phsophoribosyltransferase	NA	NA	NA	NA	NA
NP_414774.1|256526_257771_+	fermentation-respiration switch protein	NA	NA	NA	NA	NA
YP_009518739.1|257922_258426_-|transposase	IS1 transposase B	transposase	U5P0U6	Shigella_phage	100.0	7.4e-95
YP_009518740.1|258344_258620_-	IS1 repressor TnpA	NA	Q71TE9	Escherichia_phage	98.9	2.0e-46
NP_414776.1|259044_260100_-	outer membrane porin PhoE	NA	Q1MVN1	Enterobacteria_phage	61.1	9.1e-119
NP_414777.1|260387_261491_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
NP_414778.1|261502_262756_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	9.8e-96
262898:262957	attL	CGCATTCGTAATGCGAAGGTCGTAGGTTCGACTCCTATTATCGGCACCATTAAAATCAAA	NA	NA	NA	NA
NP_414779.1|263327_263669_-	CP4-6 prophage; toxin of the YkfI-YafW toxin-antitoxin system	NA	NA	NA	NA	NA
NP_414780.1|263689_264007_-	antitoxin of the YkfI-YafW toxin-antitoxin pair	NA	NA	NA	NA	NA
YP_588435.1|264025_264247_-	DUF987 domain-containing protein YkfH	NA	NA	NA	NA	NA
NP_414781.1|264255_264732_-	CP4-6 prophage; RadC-like JAB domain-containing protein YkfG	NA	NA	NA	NA	NA
NP_414782.1|264747_265206_-	CP4-6 prophage; protein YafX	NA	A9J566	Pseudomonas_phage	32.8	2.0e-14
NP_414783.1|265303_265543_-	CP4-6 prophage; protein YkfF	NA	NA	NA	NA	NA
NP_414784.1|265619_266087_-	CP4-6 prophage; protein YkfB	NA	NA	NA	NA	NA
NP_414785.4|266109_266553_-	CP4-6 prophage; inner membrane lipoprotein YafY	NA	NA	NA	NA	NA
NP_414786.4|267183_268005_-	CP4-6 prophage; conserved protein YafZ	NA	A0A2C9CX26	Yersinia_phage	39.4	7.2e-47
NP_414787.4|268096_268960_-	CP4-6 prophage; putative GTP-binding protein YkfA	NA	NA	NA	NA	NA
NP_414788.1|269288_270182_-	putative transcriptional regulator PerR	NA	NA	NA	NA	NA
NP_414790.1|270602_271754_+|transposase	IS30 transposase	transposase	W5R8L2	Staphylococcus_phage	35.9	8.9e-43
YP_009518741.1|272846_273992_+	CP4-6 prophage; PF00078 domain-containing protein YkfC	NA	A0A0U4J920	Pseudomonas_phage	34.2	6.8e-35
NP_414793.1|274100_275117_-|transposase	CP4-6 prophage; IS5 transposase and trans-activator	transposase	Q38213	Escherichia_phage	100.0	4.4e-187
NP_414794.4|275324_276728_+	S-methyl-L-methionine transporter	NA	NA	NA	NA	NA
NP_414795.1|276714_277647_+	homocysteine S-methyltransferase	NA	NA	NA	NA	NA
NP_414796.2|277755_278802_-	CP4-6 prophage; ABC transporter ATP-binding protein AfuC	NA	G3M9Y6	Bacillus_virus	37.7	1.5e-33
NP_414798.1|279177_279681_-	IS1 protein InsB	NA	Q71TF0	Escherichia_phage	99.4	9.7e-95
NP_414799.1|279599_279875_-	IS1 protein InsA	NA	Q71TE9	Escherichia_phage	100.0	3.1e-47
YP_009518742.1|280384_280735_-	orphan antitoxin YagB	NA	NA	NA	NA	NA
NP_414801.1|280828_281983_-|integrase	CP4-6 prophage; integrase core domain-containing protein YagA	integrase	NA	NA	NA	NA
NP_414802.2|282277_283186_+	CP4-6 prophage; putative 2-keto-3-deoxygluconate aldolase	NA	NA	NA	NA	NA
NP_414803.1|283200_285168_+	CP4-6 prophage; D-xylonate dehydratase	NA	NA	NA	NA	NA
NP_414804.1|285394_286777_+	putative D-xylonate transporter YagG	NA	NA	NA	NA	NA
NP_414805.1|286788_288399_+	CP4-6 prophage; putative xylosidase/arabinosidase	NA	NA	NA	NA	NA
NP_414806.1|288403_289162_-	CP4-6 prophage; DNA-binding transcriptional repressor XynR	NA	NA	NA	NA	NA
NP_414807.1|289300_290305_-	CP4-6 prophage; ornithine carbamoyltransferase ArgF	NA	NA	NA	NA	NA
YP_009518743.1|290509_290638_+	CP4-6 prophage; protein YkgS	NA	NA	NA	NA	NA
NP_414808.1|290648_291152_-	IS1 protein InsB	NA	Q71TF0	Escherichia_phage	99.4	9.7e-95
NP_414809.1|291070_291346_-	IS1 protein InsA	NA	Q71TE9	Escherichia_phage	100.0	3.1e-47
YP_009518744.1|291499_292231_+	CP4-6 prophage; protein YagJ	NA	NA	NA	NA	NA
NP_414811.1|292321_292948_-	CP4-6 prophage; uncharacterized protein YagK	NA	NA	NA	NA	NA
NP_414812.1|293219_293918_-	CP4-6 prophage; resolvase-like catalytic domain-containing protein YagL	NA	NA	NA	NA	NA
NP_414813.1|293944_294799_-	CP4-6 prophage; protein YagM	NA	NA	NA	NA	NA
YP_009518745.1|294917_295142_-	protein YkgV	NA	NA	NA	NA	NA
NP_414814.1|295138_295579_-	CP4-6 prophage; protein YagN	NA	NA	NA	NA	NA
NP_414815.1|295695_297096_-|integrase	CP4-6 prophage; putative phage integrase	integrase	A0A221SAN4	Ralstonia_phage	28.4	9.5e-07
297206:297265	attR	CGCATTCGTAATGCGAAGGTCGTAGGTTCGACTCCTATTATCGGCACCATTAAAATCAAA	NA	NA	NA	NA
>prophage 3
NC_000913	Escherichia coli str. K-12 substr. MG1655, complete genome	4641652	519138	582097	4641652	protease,integrase,tail,lysis,tRNA,transposase,holin	Enterobacteria_phage(44.44%)	64	564755:564801	586057:586103
NP_415027.1|519138_519765_-|protease	multifunctional acyl-CoA thioesterase I and protease I and lysophospholipase L1	protease	NA	NA	NA	NA
NP_415028.1|519732_520419_+	putative ABC transporter ATP-binding protein YbbA	NA	G9BWD6	Planktothrix_phage	35.6	2.9e-33
NP_415029.1|520415_522830_+	putative ABC transporter membrane subunit YbbP	NA	NA	NA	NA	NA
NP_415030.1|523260_527541_+	protein RhsD	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	32.1	1.7e-22
NP_415031.1|527580_527949_+	PF15631 family protein YbbC	NA	NA	NA	NA	NA
YP_009518753.1|529644_530016_-	putative DNA-binding transcriptional regulator YlbG	NA	A0A077SLK2	Escherichia_phage	75.4	3.1e-50
NP_415036.1|530131_531226_-|tRNA	tRNA 2-selenouridine synthase	tRNA	NA	NA	NA	NA
NP_415037.1|531294_532221_-	DNA-binding transcriptional activator AllS	NA	NA	NA	NA	NA
NP_415038.1|532450_532933_+	ureidoglycolate lyase	NA	NA	NA	NA	NA
NP_415039.1|533010_533826_+	DNA-binding transcriptional repressor AllR	NA	NA	NA	NA	NA
NP_415040.1|533915_535697_+	glyoxylate carboligase	NA	E4WLQ6	Ostreococcus_tauri_virus	27.0	3.5e-38
NP_415041.1|535709_536486_+	hydroxypyruvate isomerase	NA	NA	NA	NA	NA
NP_415042.1|536585_537464_+	tartronate semialdehyde reductase 2	NA	NA	NA	NA	NA
NP_415044.4|537632_539087_+	putative allantoin transporter	NA	NA	NA	NA	NA
NP_415045.1|539146_540508_+	allantoinase	NA	NA	NA	NA	NA
NP_415046.4|540564_541866_+	putative purine transporter	NA	NA	NA	NA	NA
NP_415047.1|541887_543033_+	glycerate 2-kinase 2	NA	W6LM47	Streptococcus_phage	41.6	9.1e-48
NP_415048.1|543260_544046_-	(S)-ureidoglycine aminohydrolase	NA	NA	NA	NA	NA
NP_415049.1|544056_545292_-	allantoate amidohydrolase	NA	NA	NA	NA	NA
NP_415050.1|545313_546363_-	ureidoglycolate dehydrogenase	NA	NA	NA	NA	NA
NP_415051.1|546679_548347_+	putative acyl-CoA synthetase FdrA	NA	NA	NA	NA	NA
YP_009029994.1|548356_549616_+	DUF1116 domain-containing protein YlbE	NA	NA	NA	NA	NA
NP_415053.1|549626_550442_+	DUF2877 domain-containing protein YlbF	NA	NA	NA	NA	NA
NP_415054.1|550438_551332_+	putative carbamate kinase	NA	NA	NA	NA	NA
NP_415055.1|551526_552594_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
NP_415056.1|552590_553100_-	N(5)-carboxyaminoimidazole ribonucleotide mutase	NA	NA	NA	NA	NA
NP_415057.1|553217_553940_-	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
NP_415058.1|553942_554437_-	peptidyl-prolyl cis-trans isomerase B	NA	NA	NA	NA	NA
NP_415059.1|554610_555996_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.5	6.7e-45
NP_415060.1|556031_556553_-	conserved inner membrane protein YbcI	NA	NA	NA	NA	NA
NP_415061.2|556660_556873_-	putative RNA-binding protein YbcJ	NA	NA	NA	NA	NA
NP_415062.1|556874_557741_-	bifunctional 5,10-methylene-tetrahydrofolate dehydrogenase/ 5,10-methylene-tetrahydrofolate cyclohydrolase	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
NP_415063.4|558211_558754_+	putative fimbrial protein SfmA	NA	NA	NA	NA	NA
NP_415064.1|558973_559666_+	putative fimbrial chaperone SfmC	NA	NA	NA	NA	NA
NP_415065.1|559696_562300_+	putative fimbrial usher protein SfmD	NA	NA	NA	NA	NA
NP_415066.2|562335_563319_+	putative fimbrial adhesin protein SfmH	NA	NA	NA	NA	NA
NP_415067.1|563329_563845_+	putative fimbrial protein SfmF	NA	NA	NA	NA	NA
NP_415068.1|563847_564480_-	putative LuxR family transcriptional regulator FimZ	NA	NA	NA	NA	NA
564755:564801	attL	CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
NP_415069.1|564814_565978_-|integrase	DLP12 prophage; putative integrase	integrase	A0A088CD23	Shigella_phage	86.6	8.9e-200
NP_415072.2|566841_567141_+	DLP12 prophage; IS3 element protein InsE	NA	NA	NA	NA	NA
NP_415073.1|567137_568004_+	DLP12 prophage; IS3 element protein InsF	NA	A0A0P0I4A4	Acinetobacter_phage	40.6	2.3e-51
NP_415075.1|568314_568647_+|holin	multidrug/betaine/choline efflux transporter EmrE	holin	NA	NA	NA	NA
YP_009518754.1|568694_568844_+	protein YlcJ	NA	NA	NA	NA	NA
NP_415076.1|568901_570428_+	DLP12 prophage; putative recombinase	NA	Q3HQV4	Burkholderia_phage	27.8	7.9e-31
NP_415077.1|570892_571444_+	DLP12 prophage; periplasmic protein YbcL	NA	NA	NA	NA	NA
NP_415078.1|571453_572251_+	DLP12 prophage; putative DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
YP_001165308.1|572367_572469_+	DLP12 prophage; uncharacterized protein YlcH	NA	NA	NA	NA	NA
NP_415079.1|572465_572921_+	DLP12 prophage; DNA base-flipping protein	NA	I6PD71	Cronobacter_phage	66.9	4.1e-60
NP_415080.1|572920_573091_+	DLP12 prophage; NinE family prophage protein	NA	K7P7K0	Enterobacteria_phage	69.8	2.4e-13
NP_415081.1|573083_573374_+	DLP12 prophage; putative nuclease YbcO	NA	K7PGZ6	Enterobacteria_phage	93.8	3.3e-47
NP_415082.1|573370_573733_+	DLP12 prophage; crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.5	4.3e-60
YP_588439.1|573729_573870_+	DLP12 prophage; uncharacterized protein YlcG	NA	K7PHH3	Enterobacteria_phage	69.8	1.1e-08
NP_415083.1|573955_574339_+	DLP12 prophage; putative antitermination protein	NA	A0A088CD47	Shigella_phage	83.3	4.4e-55
NP_415084.1|574736_575753_-|transposase	DLP12 prophage; IS5 transposase and trans-activator	transposase	Q38213	Escherichia_phage	100.0	4.4e-187
NP_415086.1|577397_577613_+|lysis	DLP12 prophage; putative phage lysis protein	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
NP_415087.1|577612_578110_+	DLP12 prophage; lysozyme	NA	M1FJA0	Enterobacteria_phage	98.2	1.1e-90
NP_415088.1|578106_578568_+	DLP12 prophage; putative prophage endopeptidase RzpD	NA	A0A0K2FJD0	Enterobacteria_phage	97.4	3.9e-74
YP_588440.1|578326_578509_+|lysis	DLP12 prophage; putative prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	78.3	1.4e-16
NP_415089.1|578599_578893_-	DLP12 prophage; prophage lipoprotein BorD	NA	A0A2R2X2B2	Escherichia_phage	97.9	5.7e-47
NP_415090.2|579183_579594_-	DLP12 prophage; protein YbcV	NA	C6ZCX4	Enterobacteria_phage	98.5	1.2e-71
NP_415091.1|579879_580086_+	DLP12 prophage; protein YbcW	NA	A0A0K2FJ18	Enterobacteria_phage	100.0	5.8e-30
YP_001165309.1|580250_580445_-	DLP12 prophage; DUF3950 domain-containing protein YlcI	NA	A0A0K2FIR8	Escherichia_phage	100.0	8.7e-28
NP_415092.1|580833_581379_+	DLP12 prophage; putative DNA-packaging protein NohD	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	4.0e-94
YP_009518755.1|581533_582097_+|tail	DLP12 prophage; putative tail fiber assembly protein TfaD	tail	K7PMH7	Enterobacteria_phage	93.1	3.1e-73
586057:586103	attR	CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
>prophage 4
NC_000913	Escherichia coli str. K-12 substr. MG1655, complete genome	4641652	1199678	1212003	4641652	tail,lysis,terminase,integrase	Shigella_phage(40.0%)	19	1198640:1198653	1216671:1216684
1198640:1198653	attL	ATTCATCTTATTTT	NA	NA	NA	NA
NP_415658.1|1199678_1200806_-|integrase	e14 prophage; putative integrase	integrase	O21925	Phage_21	61.5	7.2e-122
NP_415659.1|1200786_1201032_-	e14 prophage; putative excisionase	NA	NA	NA	NA	NA
YP_009518763.1|1201068_1201380_-	e14 prophage; protein YmfH	NA	NA	NA	NA	NA
NP_415661.2|1201496_1201838_+	e14 prophage; protein YmfI	NA	NA	NA	NA	NA
NP_415662.2|1201775_1202084_-	e14 prophage; protein YmfJ	NA	I6PDF6	Cronobacter_phage	80.0	3.8e-09
NP_415663.1|1202258_1202933_-	e14 prophage; putative repressor protein YmfK	NA	U5P0T5	Shigella_phage	100.0	1.2e-132
NP_415664.2|1203023_1203224_+	e14 prophage; putative DNA-binding transcriptional regulator YmfT	NA	U5P445	Shigella_phage	98.5	1.9e-30
NP_415665.2|1203267_1203825_+	e14 prophage; uncharacterized protein YmfL	NA	S5FXP0	Shigella_phage	95.7	7.4e-96
NP_415666.1|1203821_1204160_+	e14 prophage; protein YmfM	NA	U5P0J9	Shigella_phage	96.4	2.3e-55
YP_009518764.1|1204169_1205537_+|terminase	e14 prophage; chimeric replication protein/phage terminase YmfN	terminase	A0A1C9IIA1	Salmonella_phage	99.2	5.1e-223
NP_415668.1|1205548_1205731_+	e14 prophage; protein YmfR	NA	S5FXQ9	Shigella_phage	100.0	1.7e-25
YP_009518765.1|1205730_1206204_+	e14 prophage; putative protein BeeE	NA	A0A1B5FP95	Escherichia_phage	100.0	3.6e-75
NP_415671.1|1206912_1207497_+	e14 prophage; conserved protein YmfQ	NA	O22003	Shigella_phage	98.5	2.0e-112
NP_415672.1|1207500_1208130_+	e14 prophage; protein StfP	NA	M1FN94	Enterobacteria_phage	95.4	1.1e-52
NP_415673.1|1208131_1208545_+|tail	e14 prophage; putative tail fiber assembly protein TfaP	tail	A0A0F7LDZ0	Escherichia_phage	53.6	7.1e-27
NP_415674.1|1208516_1209119_-|tail	e14 prophage; putative tail fiber assembly protein TfaE	tail	M1SV83	Escherichia_phage	83.5	9.2e-92
NP_415676.1|1209684_1210239_+	e14 prophage; site-specific DNA recombinase	NA	A0A1S6L009	Salmonella_phage	88.3	2.8e-87
NP_415677.1|1210345_1211179_+	e14 prophage; 5-methylcytosine-specific restriction enzyme McrA	NA	NA	NA	NA	NA
NP_415678.1|1211679_1212003_-|lysis	anti-adaptor protein IraM, inhibitor of sigma(S) proteolysis	lysis	Q8HAJ1	Enterobacteria_phage	65.4	3.0e-41
1216671:1216684	attR	ATTCATCTTATTTT	NA	NA	NA	NA
>prophage 5
NC_000913	Escherichia coli str. K-12 substr. MG1655, complete genome	4641652	1406562	1436893	4641652	tail,tRNA,transposase,integrase	Escherichia_phage(46.67%)	36	1397222:1397240	1427597:1427615
1397222:1397240	attL	GCTTATTCGCACCTTCCCT	NA	NA	NA	NA
NP_415857.2|1406562_1407795_-	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
NP_415858.1|1408049_1409033_+	Zn(2(+)):H(+) symporter	NA	NA	NA	NA	NA
YP_009518775.1|1409307_1409481_+	protein YnaL	NA	NA	NA	NA	NA
NP_415859.1|1409510_1410884_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
NP_415860.1|1411012_1411948_-|tRNA	tRNA cytosine(32) 2-sulfurtransferase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.8	5.9e-146
NP_415861.1|1411999_1413235_-|integrase	Rac prophage; putative integrase	integrase	A0A0U2JGI6	Escherichia_phage	98.8	5.5e-240
NP_415862.4|1413236_1413452_-	Rac prophage; excisionase	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
NP_415863.1|1413530_1413740_-	Rac prophage; double-strand break reduction protein	NA	A0A0U2QL97	Escherichia_phage	98.4	6.1e-27
NP_415864.1|1413732_1413927_-	Rac prophage; endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	96.9	5.8e-32
NP_415865.1|1413983_1414793_-	Rac prophage; recombinase, DNA renaturation	NA	A0A1P8DTF2	Proteus_phage	71.5	8.8e-106
NP_415866.1|1414785_1417386_-	Rac prophage; exonuclease VIII, ds DNA exonuclease, 5' --> 3' specific	NA	A0A0U2I1R6	Escherichia_phage	63.5	5.1e-248
NP_415867.1|1417487_1417763_-	Rac prophage; protein RacC	NA	A0A0U2QW85	Escherichia_phage	96.7	1.4e-42
YP_588451.1|1417837_1418008_-	Rac prophage; zinc-binding protein	NA	A0A0U2SHB5	Escherichia_phage	71.4	3.6e-17
NP_415869.2|1418007_1418229_-	Rac prophage; inhibitor of FtsZ, killing protein	NA	A0A0U2RTC4	Escherichia_phage	97.3	4.9e-35
NP_415870.4|1418670_1419159_+	Rac prophage; phage superinfection exclusion protein	NA	NA	NA	NA	NA
NP_415872.2|1419155_1419311_-	Rac prophage; DUF1391 domain-containing protein YdaF	NA	M4QQ57	Salicola_phage	55.3	6.1e-08
NP_415873.2|1419321_1419456_-	Rac prophage; uncharacterized protein YdaG	NA	NA	NA	NA	NA
NP_415874.1|1419764_1420241_-	Rac prophage; DNA-binding transcriptional repressor RacR	NA	A0A2D1GNH0	Pseudomonas_phage	53.4	2.2e-11
NP_415875.1|1420364_1420661_+	Rac prophage; toxin YdaS	NA	A0A0R6PH31	Moraxella_phage	44.9	9.6e-10
NP_415876.1|1420683_1421106_+	Rac prophage; protein YdaT	NA	A0A0U2RXZ9	Escherichia_phage	95.0	1.5e-69
NP_415877.1|1421118_1421976_+	Rac prophage; DUF1376 domain-containing protein YdaU	NA	A0A0U2RT81	Escherichia_phage	84.5	8.3e-70
NP_415878.1|1421982_1422729_+	Rac prophage; putative ATP-binding protein YdaV	NA	V5UQI5	Shigella_phage	78.9	3.8e-111
YP_009518776.1|1422751_1423312_+	Rac prophage; putative uncharacterized protein YdaW	NA	A0A0U2SAW4	Escherichia_phage	88.1	1.9e-67
YP_588452.1|1423399_1423585_+	Rac prophage; putative lipoprotein	NA	K7PHU6	Enterobacteria_phage	98.2	2.8e-15
NP_415881.1|1423781_1425239_+	Rac prophage; K(+) transporter TrkG	NA	NA	NA	NA	NA
NP_415883.1|1425376_1425640_+	Rac prophage; ParB-like nuclease domain-containing protein YnaK	NA	A0A0R6PD10	Moraxella_phage	56.1	6.3e-21
YP_009518777.1|1425620_1425980_+	Rac prophage; putative uncharacterized protein YdaY	NA	NA	NA	NA	NA
YP_009518778.1|1426453_1427482_+|tail	Rac prophage; putative prophage tail length tape measure domain-containing protein YnaA	tail	G8C7Q6	Escherichia_phage	35.2	7.2e-20
NP_415888.1|1427745_1428726_-|transposase	Rac prophage; IS5 transposase and trans-activator	transposase	A0A077SK28	Escherichia_phage	99.1	8.9e-185
1427597:1427615	attR	AGGGAAGGTGCGAATAAGC	NA	NA	NA	NA
NP_415890.2|1429048_1432411_+	Rac prophage; putative membrane protein	NA	X2KTY7	Enterobacteria_phage	36.4	8.1e-12
NP_415891.1|1432410_1432986_+|tail	Rac prophage; putative tail fiber assembly protein TfaR	tail	K7PMH7	Enterobacteria_phage	94.8	2.5e-102
NP_415892.1|1433083_1433674_-	Rac prophage; putative site-specific recombinase	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
NP_415893.2|1433990_1434224_-	Rac prophage; uncharacterized protein YnaE	NA	A0A192Y6D5	Salmonella_phage	87.0	5.4e-32
YP_009518779.1|1434292_1434406_-	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
NP_415894.4|1435184_1435619_-	nucleotide binding filament protein	NA	A0A1W6JNV4	Morganella_phage	52.8	1.8e-28
NP_415895.1|1435759_1436893_-	outer membrane porin N	NA	Q1MVN1	Enterobacteria_phage	58.5	1.1e-117
>prophage 6
NC_000913	Escherichia coli str. K-12 substr. MG1655, complete genome	4641652	1629452	1648663	4641652	tail,lysis	Enterobacteria_phage(40.91%)	36	NA	NA
NP_416060.1|1629452_1630913_-	putative oxidoreductase YdfI	NA	H8ZJP8	Ostreococcus_tauri_virus	29.6	4.3e-42
YP_009518786.1|1631001_1632285_-	putative transporter YdfJ	NA	NA	NA	NA	NA
YP_009518787.1|1632889_1633003_+	Qin prophage; protein YnfT	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
NP_416062.2|1633071_1633305_+	Qin prophage; cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
NP_416063.1|1633621_1634212_+	Qin prophage; putative site-specific recombinase	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
NP_416064.1|1634309_1634885_-|tail	Qin prophage; putative tail fiber assembly protein TfaQ	tail	K7PMH7	Enterobacteria_phage	95.3	6.5e-103
NP_416065.1|1634884_1635847_-|tail	Qin prophage; putative side tail fiber assembly protein	tail	K7PHC9	Enterobacteria_phage	70.9	4.1e-41
YP_009518788.1|1635797_1636367_-	Qin prophage; putative prophage DNA-packaging protein NohA	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	1.5e-91
YP_588454.1|1636755_1636989_+	Qin prophage; protein YnfO	NA	A0A0K2FIR8	Escherichia_phage	84.1	2.5e-21
NP_416067.2|1637046_1637457_+	Qin prophage; protein YdfO	NA	C6ZCX4	Enterobacteria_phage	79.4	2.5e-56
NP_416068.2|1637608_1637782_-	Qin prophage; protein GnsB	NA	NA	NA	NA	NA
NP_416069.2|1637953_1638109_-	Qin prophage; protein YnfN	NA	NA	NA	NA	NA
YP_009518789.1|1638187_1638253_-	Qin prophage; protein YnfR	NA	NA	NA	NA	NA
YP_009518790.1|1638255_1638444_-	Qin prophage; protein YnfQ	NA	NA	NA	NA	NA
NP_416070.1|1638454_1638667_-	Qin prophage; cold shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
NP_416071.1|1639029_1639527_-	Qin prophage; DUF2514 domain-containing protein RzpQ	NA	A0A291LBG9	Klebsiella_phage	29.5	2.9e-06
YP_002791241.1|1639079_1639334_-	Qin prophage; putative lipoprotein RzoQ	NA	NA	NA	NA	NA
NP_416072.1|1639523_1640057_-	Qin prophage; putative lysozyme	NA	K7PLY1	Enterobacteria_phage	93.2	6.4e-97
NP_416073.1|1640053_1640365_-	Qin prophage; protein YdfR	NA	K7PGU6	Enterobacteria_phage	64.6	2.0e-26
NP_416074.4|1640369_1640585_-|lysis	Qin prophage; putative S lysis protein	lysis	A5LH82	Enterobacteria_phage	94.4	1.1e-31
NP_416075.1|1641338_1641554_-	Qin prophage; cold shock-like protein CspB	NA	A0A1W6JNX5	Morganella_phage	76.5	3.4e-25
NP_416076.1|1641854_1642067_+	Qin prophage; cold shock protein CspF	NA	NA	NA	NA	NA
YP_009518791.1|1642121_1642211_+	Qin prophage; protein YnfS	NA	NA	NA	NA	NA
NP_416077.4|1642488_1643241_-	Qin prophage; putative antitermination protein Q	NA	A0A192Y5X6	Salmonella_phage	92.8	7.1e-134
NP_416078.4|1643254_1644304_-	Qin prophage; protein YdfU	NA	A0A291AWV9	Escherichia_phage	57.3	5.7e-113
NP_416079.1|1644650_1644902_-	Qin prophage; protein Rem	NA	NA	NA	NA	NA
NP_416080.1|1645118_1645274_-	Qin prophage; toxic protein HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
NP_416081.1|1645345_1645633_-	Qin prophage; mRNA interferase toxin RelE	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	66.0	1.4e-29
NP_416082.1|1645632_1645872_-	Qin prophage; antitoxin/DNA-binding transcriptional repressor RelB	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	54.4	1.6e-18
NP_416083.1|1645896_1646202_+	Qin prophage; protein YdfV	NA	NA	NA	NA	NA
NP_416084.1|1646404_1646737_+	Qin prophage; protein FlxA	NA	NA	NA	NA	NA
YP_009518792.1|1647173_1647323_-	Qin prophage; uncharacterized protein YdfW	NA	NA	NA	NA	NA
YP_009518793.1|1647345_1647636_-	Qin prophage; uncharacterized protein YdfX	NA	NA	NA	NA	NA
NP_416087.1|1647619_1647850_-	Qin prophage; DNA-binding transcriptional regulator for DicB	NA	NA	NA	NA	NA
NP_416088.1|1647933_1648341_+	DNA-binding transcriptional dual regulator DicA	NA	K7PM82	Enterobacteria_phage	54.7	4.4e-13
NP_416089.1|1648507_1648663_+	Qin prophage; DUF1391 domain-containing protein YdfA	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
>prophage 7
NC_000913	Escherichia coli str. K-12 substr. MG1655, complete genome	4641652	2107225	2115896	4641652		Escherichia_phage(28.57%)	8	NA	NA
NP_416540.1|2107225_2108329_-	UDP-galactopyranose mutase	NA	E4ZFQ1	Streptococcus_phage	59.5	1.0e-133
NP_416541.1|2108336_2109584_-	polyisoprenol-linked O-antigen repeat unit flippase	NA	NA	NA	NA	NA
NP_416542.1|2109580_2110138_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	57.5	7.8e-53
NP_416543.1|2110137_2111019_-	dTDP-glucose pyrophosphorylase	NA	I7I009	Enterobacteria_phage	63.8	1.9e-106
NP_416544.1|2111076_2111976_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	35.2	1.5e-29
NP_416545.1|2111975_2113061_-	dTDP-glucose 4,6-dehydratase 1	NA	I7HTA3	Enterobacteria_phage	53.9	5.2e-101
NP_416546.1|2113433_2114327_-	UTP:glucose-1-phosphate uridylyltransferase, low activity	NA	A0A127AW70	Bacillus_phage	42.0	1.0e-46
NP_416547.1|2114501_2115896_-	putative colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	31.9	4.9e-19
>prophage 8
NC_000913	Escherichia coli str. K-12 substr. MG1655, complete genome	4641652	2207966	2217407	4641652		Enterobacteria_phage(85.71%)	10	NA	NA
NP_416625.1|2207966_2209103_+	VWA domain-containing protein YehP	NA	Q9EYF7	Enterobacteria_phage	97.7	1.9e-162
YP_009518800.1|2209099_2210944_+	SWIM zinc finger domains-containing protein YehQ	NA	Q9EYF6	Enterobacteria_phage	95.9	0.0e+00
NP_416627.2|2211224_2211686_+	DUF1307 domain-containing lipoprotein YehR	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
NP_416628.1|2211725_2212196_-	conserved protein YehS	NA	Q9EYF4	Enterobacteria_phage	100.0	5.2e-82
NP_416629.4|2212242_2212962_-	DNA-binding transcriptional activator BtsR	NA	NA	NA	NA	NA
NP_416630.1|2212958_2214644_-	high-affinity pyruvate receptor	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
NP_416631.1|2214865_2215597_+	DNA-binding transcriptional activator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
YP_588460.1|2215656_2215764_+	UPF0387 family protein YohO	NA	NA	NA	NA	NA
NP_416632.1|2215744_2216476_-	glycine betaine ABC transporter membrane subunit YehW	NA	NA	NA	NA	NA
NP_416633.1|2216480_2217407_-	glycine betaine ABC transporter ATP binding subunit YehX	NA	G3M9Y6	Bacillus_virus	30.8	2.8e-23
>prophage 9
NC_000913	Escherichia coli str. K-12 substr. MG1655, complete genome	4641652	2465300	2476510	4641652	tail,integrase	Enterobacteria_phage(43.75%)	16	2463275:2463291	2480185:2480201
2463275:2463291	attL	TATTGGTATCGACAACC	NA	NA	NA	NA
NP_416849.1|2465300_2466233_+	inner membrane protein YfdC	NA	E7DYY8	Enterobacteria_phage	99.0	2.5e-165
NP_416850.1|2466544_2467702_+|integrase	CPS-53 (KpLE1) prophage; prophage CPS-53 integrase	integrase	A5VW56	Enterobacteria_phage	100.0	5.7e-223
NP_416851.1|2467854_2468217_+	CPS-53 (KpLE1) prophage; putative bactoprenol-linked glucose translocase	NA	U5P0S6	Shigella_phage	88.3	1.0e-53
NP_416852.1|2468213_2469134_+	CPS-53 (KpLE1) prophage; bactoprenol glucosyl transferase	NA	M1FQW5	Enterobacteria_phage	89.9	4.2e-160
NP_416853.1|2469130_2470462_+	CPS-53 (KpLE1) prophage; serotype specific glucosyl transferase	NA	U5P0I5	Shigella_phage	36.7	6.8e-63
NP_416855.1|2471076_2471517_-|tail	CPS-53 (KpLE1) prophage; putative tail fiber assembly protein YfdK	tail	A0A0F7LDZ0	Escherichia_phage	70.1	9.5e-54
YP_009518803.1|2472111_2472387_-	CPS-53 (KpLE1) prophage; putative methyltransferase	NA	Q8SBE9	Shigella_phage	100.0	2.6e-49
NP_416858.1|2472386_2472881_-	CPS-53 (KpLE1) prophage; protein YzyA	NA	A0A0P0ZCF0	Stx2-converting_phage	98.1	1.2e-86
YP_009518804.1|2472877_2473246_-	CPS-53 (KpLE1) prophage; putative defective phage replication protein O	NA	U5P0A0	Shigella_phage	99.2	1.3e-69
NP_416860.4|2473603_2473966_+	CPS-53 (KpLE1) prophage; protein YfdP	NA	Q8SBF8	Shigella_phage	99.2	1.9e-60
NP_416861.1|2474031_2474856_+	CPS-53 (KpLE1) prophage; protein YfdQ	NA	K7PJQ6	Enterobacteria_phage	99.3	7.8e-150
NP_416862.2|2474983_2475520_+	CPS-53 (KpLE1) prophage; 5'-deoxynucleotidase	NA	K7PKJ9	Enterobacteria_phage	98.9	3.7e-100
NP_416863.1|2475510_2475873_+	CPS-53 (KpLE1) prophage; protein YfdS	NA	K7PH61	Enterobacteria_phage	99.1	2.0e-65
NP_416864.1|2475872_2476178_+	CPS-53 (KpLE1) prophage; protein YfdT	NA	U5P0J0	Shigella_phage	96.0	2.2e-49
YP_009518805.1|2476093_2476234_+	CPS-53 (KpLE1) prophage; putative uncharacterized protein YpdJ	NA	S5FM74	Shigella_phage	91.3	9.1e-19
YP_588463.1|2476309_2476510_+	CPS-53 (KpLE1) prophage; prophage CPS-53 recombination directionality factor and response regulator inhibitor	NA	K7P7V0	Enterobacteria_phage	100.0	2.4e-33
2480185:2480201	attR	TATTGGTATCGACAACC	NA	NA	NA	NA
>prophage 10
NC_000913	Escherichia coli str. K-12 substr. MG1655, complete genome	4641652	2857092	2864231	4641652		Escherichia_phage(83.33%)	6	NA	NA
NP_417213.1|2857092_2859654_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	3.0e-30
NP_417214.1|2859759_2860416_+	phosphoprotein phosphatase 2	NA	A0A222YWF0	Escherichia_phage	46.3	4.7e-49
NP_417215.2|2860466_2861234_-	putative DeoR-type DNA-binding transcriptional regulator YgbI	NA	A0A077SK06	Escherichia_phage	56.3	7.4e-70
NP_417216.1|2861429_2862338_+	putative L-threonate dehydrogenase	NA	A0A077SLF7	Escherichia_phage	76.5	4.3e-117
NP_417217.1|2862334_2863501_+	putative 3-oxo-tetronate kinase YgbK	NA	A0A077SLJ7	Escherichia_phage	60.6	1.1e-120
NP_417218.1|2863592_2864231_+	putative 3-oxo-tetronate 4-phosphate decarboxylase YgbL	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
