The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
LR136958	Alteromonas sp. 76-1 genome assembly, chromosome: cAlt76	4731105	770671	780584	4731105		uncultured_Caudovirales_phage(16.67%)	7	NA	NA
VEL95712.1|770671_772291_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	39.2	5.4e-38
VEL95713.1|772542_774369_-	RNA polymerase RpoD-like sigma 70 subunit	NA	A0A2I7SAT0	Vibrio_phage	33.0	1.3e-35
VEL95714.1|774693_776475_-	DNA primase	NA	A0A1S5RF71	Helicobacter_phage	32.7	4.6e-46
VEL95715.1|776616_777063_-	hypothetical protein	NA	A0A292GL36	Xanthomonas_phage	41.1	1.1e-22
VEL95716.1|777402_777618_-	SSU ribosomal protein S21P	NA	NA	NA	NA	NA
VEL95717.1|778154_779168_+	O-sialoglycoprotein endopeptidase	NA	A0A0R6PI74	Moraxella_phage	56.6	6.9e-108
VEL95718.1|779237_780584_+	predicted AlkP superfamily pyrophosphatase or phosphodiesterase	NA	A0A0M3PB47	Turkeypox_virus	31.4	2.1e-43
>prophage 2
LR136958	Alteromonas sp. 76-1 genome assembly, chromosome: cAlt76	4731105	1017878	1026729	4731105		Streptococcus_phage(16.67%)	6	NA	NA
VEL95908.1|1017878_1019171_-	enolase	NA	A0A1X9I5Z8	Streptococcus_phage	59.5	9.4e-134
VEL95909.1|1019230_1020862_-	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	50.6	2.2e-148
VEL95910.1|1021040_1023647_-	DNA mismatch repair protein MutS	NA	A0A1V0SC35	Catovirus	22.4	2.7e-31
VEL95911.1|1023922_1024411_+	nicotinamide-nucleotide amidase	NA	B5TK85	Pseudomonas_phage	47.4	1.2e-28
VEL95912.1|1024673_1025714_+	recombination protein RecA	NA	A0A2D1GPX2	Mycobacterium_phage	64.1	1.8e-119
VEL95913.1|1025928_1026729_+	sodium transport system ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	32.1	1.5e-25
>prophage 3
LR136958	Alteromonas sp. 76-1 genome assembly, chromosome: cAlt76	4731105	2150810	2191571	4731105	protease,transposase,integrase	Synechococcus_phage(25.0%)	47	2175239:2175267	2186968:2186996
VEL96866.1|2150810_2152253_-|protease	predicted Zn-dependent protease	protease	NA	NA	NA	NA
VEL96867.1|2152559_2153636_+	putative permease	NA	NA	NA	NA	NA
VEL96868.1|2153771_2154242_-	peroxiredoxin Q/BCP	NA	NA	NA	NA	NA
VEL96869.1|2154219_2154783_-	glycine cleavage system transcriptional repressor	NA	NA	NA	NA	NA
VEL96870.1|2154963_2155848_+	dihydrodipicolinate synthase	NA	NA	NA	NA	NA
VEL96871.1|2155860_2156964_+	Beta-barrel assembly machine subunit BamC	NA	NA	NA	NA	NA
VEL96872.1|2156976_2157690_+	phosphoribosylaminoimidazole-succinocarboxamide synthase	NA	A0A0E3FGF0	Synechococcus_phage	37.0	3.1e-38
VEL96873.1|2157951_2158821_+	threonine/homoserine efflux transporter RhtA	NA	NA	NA	NA	NA
VEL96874.1|2159095_2159419_+	hypothetical protein	NA	NA	NA	NA	NA
VEL96875.1|2159648_2161859_-	iron complex outermembrane receptor protein	NA	NA	NA	NA	NA
VEL96876.1|2161848_2163189_-	ABC-2 type transport system permease protein	NA	NA	NA	NA	NA
VEL96877.1|2163185_2164631_-	ABC-2 type transport system permease protein	NA	NA	NA	NA	NA
VEL96878.1|2164627_2165347_-	ABC-2 type transport system ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	30.8	9.8e-16
VEL96879.1|2165637_2166807_+	glutathione S-transferase	NA	NA	NA	NA	NA
VEL96880.1|2167049_2167790_+	hypothetical protein	NA	NA	NA	NA	NA
VEL96881.1|2168212_2168794_-|transposase	transposase IS116/IS110/IS902 family protein	transposase	NA	NA	NA	NA
VEL96882.1|2168803_2169367_-|transposase	transposase	transposase	NA	NA	NA	NA
VEL96883.1|2169484_2170177_+	hypothetical protein	NA	NA	NA	NA	NA
VEL96884.1|2170286_2170892_+	hypothetical protein	NA	NA	NA	NA	NA
VEL96885.1|2171005_2171170_+	hypothetical protein	NA	NA	NA	NA	NA
VEL96886.1|2171281_2171473_+	hypothetical protein	NA	NA	NA	NA	NA
VEL96887.1|2171584_2172148_+	hypothetical protein	NA	NA	NA	NA	NA
VEL96888.1|2172273_2173554_+	hypothetical protein	NA	NA	NA	NA	NA
VEL96889.1|2173670_2173937_+	hypothetical protein	NA	NA	NA	NA	NA
VEL96890.1|2174416_2174734_-	hypothetical protein	NA	NA	NA	NA	NA
VEL96891.1|2174779_2175154_-	hypothetical protein	NA	NA	NA	NA	NA
2175239:2175267	attL	TGTTTTCGAATTATGCCTGTCATGTTTAG	NA	NA	NA	NA
VEL96892.1|2175652_2175940_+	hypothetical protein	NA	NA	NA	NA	NA
VEL96893.1|2176038_2177100_+	uncharacterized protein DUF4263	NA	NA	NA	NA	NA
VEL96894.1|2177508_2177697_+|integrase	integrase-like protein	integrase	NA	NA	NA	NA
VEL96895.1|2177758_2178808_+	uncharacterized protein DUF4365	NA	NA	NA	NA	NA
VEL96896.1|2178929_2179727_+	hypothetical protein	NA	NA	NA	NA	NA
VEL96897.1|2179716_2179812_+	hypothetical protein	NA	NA	NA	NA	NA
VEL96898.1|2179848_2180715_+	hypothetical protein	NA	NA	NA	NA	NA
VEL96899.1|2181357_2181849_+	hypothetical protein	NA	NA	NA	NA	NA
VEL96900.1|2181894_2182671_+	methyltransferase family protein	NA	NA	NA	NA	NA
VEL96901.1|2183112_2183574_+	hypothetical protein	NA	NA	NA	NA	NA
VEL96902.1|2183961_2184516_+	acetyltransferase (GNAT) family protein	NA	NA	NA	NA	NA
VEL96903.1|2184595_2184895_+	hypothetical protein	NA	NA	NA	NA	NA
VEL96904.1|2184967_2185285_+	hypothetical protein	NA	NA	NA	NA	NA
VEL96905.1|2185385_2185757_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
VEL96906.1|2185829_2186822_+	dihydroflavonol-4-reductase	NA	A0A218MKD6	uncultured_virus	26.5	1.8e-07
VEL96907.1|2187695_2188565_+	hypothetical protein	NA	NA	NA	NA	NA
2186968:2186996	attR	TGTTTTCGAATTATGCCTGTCATGTTTAG	NA	NA	NA	NA
VEL96908.1|2188674_2189214_+	hypothetical protein	NA	NA	NA	NA	NA
VEL96909.1|2189338_2189650_+	hypothetical protein	NA	NA	NA	NA	NA
VEL96910.1|2189779_2190283_+	hypothetical protein	NA	NA	NA	NA	NA
VEL96911.1|2190378_2190738_+|transposase	transposase	transposase	NA	NA	NA	NA
VEL96912.1|2190689_2191571_+|transposase	transposase InsO family protein	transposase	A0A0P0I4A4	Acinetobacter_phage	32.5	8.6e-38
>prophage 4
LR136958	Alteromonas sp. 76-1 genome assembly, chromosome: cAlt76	4731105	2221061	2264766	4731105	terminase,capsid,tRNA,protease,tail,holin,portal	uncultured_Caudovirales_phage(28.57%)	58	NA	NA
VEL96939.1|2221061_2223755_+	DNA translocase FtsK	NA	G1FGP1	Mycobacterium_phage	51.2	7.3e-88
VEL96940.1|2223760_2224516_+	outer membrane lipoprotein carrier protein	NA	NA	NA	NA	NA
VEL96941.1|2224526_2225885_+	recombination protein MgsA	NA	G3MBE0	Bacillus_virus	37.6	4.4e-73
VEL96942.1|2225998_2226274_+	camphor resistance protein CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	33.7	5.1e-05
VEL96943.1|2226284_2227577_+|tRNA	seryl-tRNA synthetase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	45.2	5.0e-95
VEL96944.1|2227772_2228591_-	hypothetical protein	NA	NA	NA	NA	NA
VEL96945.1|2228663_2229011_-|tRNA	tRNA 2-thiouridine synthesizing protein E	tRNA	NA	NA	NA	NA
VEL96946.1|2229066_2229450_-	sulfur transfer complex TusBCD TusB component (DsrH family)	NA	NA	NA	NA	NA
VEL96947.1|2229449_2229812_-|tRNA	tRNA 2-thiouridine synthesizing protein C	tRNA	NA	NA	NA	NA
VEL96948.1|2229811_2230201_-|tRNA	tRNA 2-thiouridine synthesizing protein D	tRNA	A0A2H4JA39	uncultured_Caudovirales_phage	33.3	3.0e-11
VEL96949.1|2230327_2230993_-|protease	modulator of FtsH protease	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	47.5	9.4e-37
VEL96950.1|2231484_2231865_+	hypothetical protein	NA	NA	NA	NA	NA
VEL96951.1|2232306_2233773_+	uncharacterized protein DUF3360	NA	NA	NA	NA	NA
VEL96952.1|2234698_2236798_+	5-histidylcysteine sulfoxide synthase/putative 4-mercaptohistidine N1-methyltranferase	NA	NA	NA	NA	NA
VEL96953.1|2236849_2238325_+	cystathionine beta-lyase	NA	NA	NA	NA	NA
VEL96954.1|2238572_2239298_+	hypothetical protein	NA	NA	NA	NA	NA
VEL96955.1|2239503_2240148_+	LuxR family two component transcriptional regulator	NA	NA	NA	NA	NA
VEL96956.1|2240154_2241972_+	excinuclease ABC subunit C	NA	NA	NA	NA	NA
VEL96957.1|2242086_2242665_+	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
VEL96958.1|2243305_2243659_-	hypothetical protein	NA	NA	NA	NA	NA
VEL96959.1|2243655_2244657_-	hypothetical protein	NA	K7PLZ2	Enterobacterial_phage	54.5	2.7e-96
VEL96960.1|2244659_2244869_-	uncharacterized protein DUF4224	NA	NA	NA	NA	NA
VEL96961.1|2244868_2245156_-	hypothetical protein	NA	NA	NA	NA	NA
VEL96962.1|2245157_2245847_-	uncharacterized protein DUF2786	NA	NA	NA	NA	NA
VEL96963.1|2245849_2246134_-	hypothetical protein	NA	NA	NA	NA	NA
VEL96964.1|2246133_2246331_-	hypothetical protein	NA	NA	NA	NA	NA
VEL96965.1|2246330_2246654_-	hypothetical protein	NA	G4W935	Tetrasphaera_phage	57.4	4.7e-26
VEL96966.1|2246650_2246992_-	hypothetical protein	NA	NA	NA	NA	NA
VEL96967.1|2246988_2247648_-	hypothetical protein	NA	NA	NA	NA	NA
VEL96968.1|2247647_2247854_-	helix-turn-helix protein	NA	NA	NA	NA	NA
VEL96969.1|2247856_2248036_-	hypothetical protein	NA	NA	NA	NA	NA
VEL96970.1|2248032_2248221_-	hypothetical protein	NA	NA	NA	NA	NA
VEL96971.1|2248237_2248444_-	hypothetical protein	NA	NA	NA	NA	NA
VEL96972.1|2248444_2249320_-	hypothetical protein	NA	A0A192Y8M4	Salmonella_phage	53.1	2.3e-35
VEL96973.1|2249637_2249901_+	hypothetical protein	NA	NA	NA	NA	NA
VEL96974.1|2249910_2250462_+	hypothetical protein	NA	NA	NA	NA	NA
VEL96975.1|2250443_2250755_+	hypothetical protein	NA	NA	NA	NA	NA
VEL96976.1|2250714_2251170_-	hypothetical protein	NA	NA	NA	NA	NA
VEL96977.1|2251273_2251528_+	hypothetical protein	NA	NA	NA	NA	NA
VEL96978.1|2251524_2251815_+	hypothetical protein	NA	NA	NA	NA	NA
VEL96979.1|2251825_2252272_+	hypothetical protein	NA	NA	NA	NA	NA
VEL96980.1|2252479_2252731_+	hypothetical protein	NA	NA	NA	NA	NA
VEL96981.1|2252845_2253349_+	hypothetical protein	NA	NA	NA	NA	NA
VEL96982.1|2253329_2254160_+	hypothetical protein	NA	NA	NA	NA	NA
VEL96983.1|2254122_2254806_+	hypothetical protein	NA	NA	NA	NA	NA
VEL96984.1|2254807_2255158_+	hypothetical protein	NA	NA	NA	NA	NA
VEL96985.1|2255252_2255786_+	peptidoglycan L-alanyl-D-glutamate endopeptidase CwlK	NA	A0A2I7QLV3	Vibrio_phage	44.5	3.9e-25
VEL96986.1|2255782_2256313_+	hypothetical protein	NA	NA	NA	NA	NA
VEL96987.1|2256368_2256653_+|holin	holin family protein (superfamily II)	holin	NA	NA	NA	NA
VEL96988.1|2256746_2257226_+	hypothetical protein	NA	NA	NA	NA	NA
VEL96989.1|2257188_2259234_+|terminase	phage terminase large subunit GpA-like protein	terminase	A0A2D1GMT1	Marinobacter_phage	44.7	1.5e-138
VEL96990.1|2259233_2259746_+	hypothetical protein	NA	A0A0K1Y6G7	Rhodobacter_phage	30.3	1.2e-07
VEL96991.1|2259749_2261333_+|portal	lambda family phage portal protein	portal	A0A2H4JBW2	uncultured_Caudovirales_phage	32.2	4.6e-66
VEL96992.1|2261307_2263203_+|capsid	HK97 family phage major capsid protein	capsid	Q6R4V3	Vibrio_virus	37.0	7.9e-105
VEL96993.1|2263273_2263528_+	hypothetical protein	NA	NA	NA	NA	NA
VEL96994.1|2263532_2263820_+	hypothetical protein	NA	NA	NA	NA	NA
VEL96995.1|2263816_2264368_+	hypothetical protein	NA	NA	NA	NA	NA
VEL96996.1|2264367_2264766_+|tail	minor tail protein U	tail	NA	NA	NA	NA
>prophage 5
LR136958	Alteromonas sp. 76-1 genome assembly, chromosome: cAlt76	4731105	4171317	4177287	4731105		Enterobacteria_phage(50.0%)	6	NA	NA
VEL98570.1|4171317_4172505_-	UDPglucose 6-dehydrogenase	NA	O41091	Paramecium_bursaria_Chlorella_virus	55.3	5.1e-110
VEL98571.1|4172804_4173884_-	6-dehydratase	NA	K7QJG5	Escherichia_phage	52.6	1.7e-96
VEL98572.1|4173902_4174763_-	dTDP-4-dehydrorhamnose reductase	NA	A0A140G5S3	Enterobacteria_phage	36.5	3.5e-36
VEL98573.1|4174772_4175318_-	5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.2	3.2e-51
VEL98574.1|4175392_4176274_-	glucose-1-phosphate thymidylyltransferase	NA	I7I009	Enterobacteria_phage	59.2	1.5e-98
VEL98575.1|4176369_4177287_-	FkbM family methyltransferase	NA	Q58M88	Prochlorococcus_phage	29.6	3.3e-08
