The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
LR134376	Aeromonas encheleia strain NCTC12917 genome assembly, chromosome: 1	4542521	2336597	2347713	4542521	tRNA	Hokovirus(16.67%)	8	NA	NA
VEG96612.1|2336597_2340542_-	virulence sensor protein BvgS	NA	A0A1V0SGX0	Hokovirus	36.3	2.4e-31
VEG96613.1|2340578_2340875_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	35.6	3.0e-11
VEG96614.1|2340878_2343266_-|tRNA	phenylalanyl-tRNA synthetase subunit beta	tRNA	A0A1L3IZU3	BeAn_58058_virus	25.0	1.4e-05
VEG96615.1|2343278_2344262_-|tRNA	phenylalanyl-tRNA synthetase subunit alpha	tRNA	A0A2H4UW22	Bodo_saltans_virus	38.2	6.9e-36
VEG96616.1|2344575_2344932_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
VEG96617.1|2344946_2345144_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
VEG96618.1|2345232_2345622_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	38.7	4.4e-10
VEG96619.1|2345784_2347713_-|tRNA	threonyl-tRNA synthetase	tRNA	A0A2K9L297	Tupanvirus	37.7	2.8e-126
>prophage 2
LR134376	Aeromonas encheleia strain NCTC12917 genome assembly, chromosome: 1	4542521	2820047	2905094	4542521	terminase,holin,head,plate,portal,tRNA,capsid,tail,integrase	Aeromonas_virus(51.35%)	110	2837378:2837398	2873088:2873108
VEG96999.1|2820047_2821424_-|tRNA	cysteinyl-tRNA synthetase	tRNA	H2EDD6	Moumouvirus	31.9	1.1e-44
VEG97000.1|2821627_2822125_+	peptidyl-prolyl cis-trans isomerase B	NA	NA	NA	NA	NA
VEG97001.1|2822114_2822750_+	HIT family protein	NA	NA	NA	NA	NA
VEG97002.1|2822784_2823513_+	UDP-2,3-diacylglucosamine hydrolase	NA	NA	NA	NA	NA
VEG97003.1|2823626_2823875_+	putative transglycosylase associated protein	NA	NA	NA	NA	NA
VEG97004.1|2823986_2824274_-	antibiotic biosynthesis monooxygenase family protein	NA	NA	NA	NA	NA
VEG97005.1|2824494_2824704_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEG97006.1|2825062_2825770_-	Bacterial Ig-like domain (group 2)	NA	NA	NA	NA	NA
VEG97007.1|2826911_2827124_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEG97008.1|2827214_2827460_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEG97009.1|2827495_2827654_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEG97010.1|2827831_2828194_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEG97011.1|2828221_2829277_-|integrase	phage integrase	integrase	A5X9F3	Aeromonas_virus	58.0	2.4e-111
VEG97012.1|2829330_2830494_+	modification methylase DdeI	NA	A0A0R6PG08	Moraxella_phage	56.0	7.5e-106
VEG97013.1|2830462_2832424_-	High temperature protein G	NA	NA	NA	NA	NA
VEG97014.1|2832451_2832889_-	phage repressor	NA	A0A1I9KG86	Aeromonas_phage	57.4	8.6e-39
VEG97015.1|2833268_2833457_+	phage transcriptional regulator, Cro-like protein	NA	F8TUK2	EBPR_podovirus	47.3	2.4e-06
VEG97016.1|2833477_2833735_+	regulator for prophage	NA	Q1I116	Pasteurella_virus	45.0	1.6e-08
VEG97017.1|2833739_2834261_+	phage protein	NA	A5X9F7	Aeromonas_virus	71.1	2.8e-60
VEG97018.1|2834274_2834727_+	Uncharacterised protein	NA	A5X9F8	Aeromonas_virus	82.4	3.0e-63
VEG97019.1|2834792_2834981_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEG97020.1|2834983_2835244_+	phage transcriptional protein	NA	NA	NA	NA	NA
VEG97021.1|2835240_2835696_+	Uncharacterised protein	NA	A5X9G2	Aeromonas_virus	56.5	1.3e-21
VEG97022.1|2835692_2835950_+	Uncharacterised protein	NA	A5X9G3	Aeromonas_virus	46.3	4.9e-10
VEG97023.1|2835946_2838214_+	phage protein	NA	A5X9G4	Aeromonas_virus	79.5	0.0e+00
2837378:2837398	attL	GTGTGGCGCGAGCTGCGCCGC	NA	NA	NA	NA
VEG97024.1|2838210_2838429_+	Uncharacterised protein	NA	A5X9G5	Aeromonas_virus	69.4	9.8e-20
VEG97025.1|2838807_2839980_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEG97026.1|2840357_2840963_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEG97027.1|2841489_2841741_-	phage transcriptional activator, Ogr/Delta	NA	A5X9H0	Aeromonas_virus	89.2	7.1e-38
VEG97028.1|2841799_2842816_-|capsid,portal	phage capsid portal protein	capsid,portal	A5X9H1	Aeromonas_virus	92.3	2.7e-184
VEG97029.1|2842812_2843778_-|terminase	phage terminase ATPase subunit	terminase	A5X9H3	Aeromonas_virus	96.6	1.2e-186
VEG97030.1|2843752_2844280_-|terminase	phage terminase ATPase subunit	terminase	A5X9H3	Aeromonas_virus	67.3	2.6e-58
VEG97031.1|2844456_2845299_+|capsid	phage capsid scaffolding protein	capsid	A5X9H4	Aeromonas_virus	71.6	8.3e-99
VEG97032.1|2845308_2846361_+|capsid	P2 family phage major capsid protein	capsid	A5X9H5	Aeromonas_virus	85.5	1.7e-170
VEG97033.1|2846364_2847093_+|terminase	phage small terminase subunit	terminase	A5X9H6	Aeromonas_virus	95.9	1.0e-132
VEG97034.1|2847207_2847669_+|head	phage head completion protein	head	A5X9H7	Aeromonas_virus	93.5	1.3e-69
VEG97035.1|2847665_2848145_+	phage protein	NA	A5X9H8	Aeromonas_virus	92.5	3.3e-52
VEG97036.1|2848185_2848872_+	phage protein	NA	A5X9H9	Aeromonas_virus	91.2	2.4e-112
VEG97037.1|2848876_2850001_+	phage protein	NA	A5X9I0	Aeromonas_virus	82.9	6.4e-179
VEG97038.1|2850004_2850460_+	phage protein	NA	A5X9I1	Aeromonas_virus	84.1	6.8e-71
VEG97039.1|2850463_2850673_+	phage protein	NA	A5X9I2	Aeromonas_virus	71.2	1.2e-19
VEG97040.1|2850698_2851010_+|holin	phage holin	holin	A5X9I3	Aeromonas_virus	58.4	3.5e-26
VEG97041.1|2851011_2851491_+	Uncharacterised protein	NA	A0A1I9KFD8	Aeromonas_phage	71.7	3.1e-66
VEG97042.1|2851487_2851919_+	phage protein	NA	NA	NA	NA	NA
VEG97043.1|2852042_2852306_+	phage protein	NA	A5X9I7	Aeromonas_virus	75.0	3.7e-29
VEG97044.1|2852500_2853961_+|tail	phage tail length determinator	tail	A5X9I9	Aeromonas_virus	91.0	6.5e-200
VEG97045.1|2853911_2854379_+|tail	phage tail length determinator	tail	A5X9I9	Aeromonas_virus	49.4	5.7e-33
VEG97046.1|2854378_2854702_+	phage protein	NA	A5X9J0	Aeromonas_virus	95.3	1.1e-51
VEG97047.1|2854698_2855886_+	phage protein	NA	A5X9J1	Aeromonas_virus	91.5	3.0e-203
VEG97048.1|2855878_2856466_+	phage protein	NA	A5X9J2	Aeromonas_virus	90.6	8.1e-101
VEG97049.1|2856462_2858574_+|tail	phage tail fiber-like protein	tail	A5X9J3	Aeromonas_virus	53.8	5.7e-189
VEG97050.1|2858589_2859012_+|tail	phage tail fibre assembly protein	tail	A5X9J5	Aeromonas_virus	48.9	2.0e-29
VEG97051.1|2859113_2859890_+	phage protein	NA	A5X9J6	Aeromonas_virus	82.2	8.5e-114
VEG97052.1|2859886_2860435_+	phage protein	NA	A5X9J7	Aeromonas_virus	89.0	1.2e-82
VEG97053.1|2860431_2860872_+	phage protein	NA	A5X9J8	Aeromonas_virus	94.3	1.5e-62
VEG97054.1|2860838_2862041_+	phage protein	NA	A5X9J8	Aeromonas_virus	90.8	4.0e-211
VEG97055.1|2862715_2863489_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEG97056.1|2863820_2864882_-|integrase	phage integrase	integrase	A5X9F3	Aeromonas_virus	58.4	7.0e-111
VEG97057.1|2864939_2865425_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEG97058.1|2865990_2866743_-	prophage transcriptional regulator	NA	A5X9F5	Aeromonas_virus	46.1	1.1e-54
VEG97059.1|2866897_2867311_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEG97060.1|2867344_2867860_+	phage protein	NA	A5X9F7	Aeromonas_virus	41.4	1.4e-24
VEG97061.1|2867871_2868129_+	putative phage transcriptional activator Ogr/Delta	NA	NA	NA	NA	NA
VEG97062.1|2868125_2868344_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEG97063.1|2868359_2868803_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEG97064.1|2868865_2869051_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEG97065.1|2869047_2869365_+	Uncharacterised protein	NA	A5X9G2	Aeromonas_virus	81.4	2.7e-42
VEG97066.1|2869361_2869583_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEG97067.1|2869582_2870020_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEG97068.1|2870016_2871597_+	DNA (cytosine-5-)-methyltransferase	NA	A0A1I9KFD6	Aeromonas_phage	78.2	1.7e-209
VEG97069.1|2871593_2873987_+	phage replication initiation protein A	NA	A5X9G4	Aeromonas_virus	35.0	3.9e-101
2873088:2873108	attR	GTGTGGCGCGAGCTGCGCCGC	NA	NA	NA	NA
VEG97070.1|2873976_2874315_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEG97071.1|2874836_2875175_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEG97072.1|2875189_2876467_-	protein UmuC	NA	F1C5A5	Cronobacter_phage	56.8	2.1e-130
VEG97073.1|2876463_2876886_-	peptidase S24-like domain-containing protein	NA	A0A1W6JNS2	Morganella_phage	50.4	1.7e-31
VEG97074.1|2877127_2877760_+	Uncharacterised protein	NA	M1PSB6	Streptococcus_phage	33.2	4.9e-27
VEG97075.1|2877763_2877904_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEG97076.1|2878230_2878863_+	P22AR C-terminal domain	NA	H6WRU8	Salmonella_phage	43.1	2.1e-30
VEG97077.1|2879052_2880093_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEG97078.1|2880798_2881842_-	Portal vertex-like protein	NA	A0A077K9Q8	Ralstonia_phage	59.8	4.6e-115
VEG97079.1|2881838_2883557_-|terminase	phage-related terminase	terminase	A0A1S6KZW3	Salmonella_phage	69.2	4.3e-235
VEG97080.1|2883757_2884579_+|capsid	phage capsid scaffolding protein	capsid	F1BUR1	Erwinia_phage	48.7	3.3e-60
VEG97081.1|2884590_2885643_+|capsid	phage-related capsid protein	capsid	E5G6M6	Salmonella_phage	55.6	2.7e-107
VEG97082.1|2885652_2886336_+|terminase	phage P2 small terminase subunit gpM-like protein	terminase	A4PE31	Ralstonia_virus	45.8	3.6e-44
VEG97083.1|2886442_2886913_+|capsid	phage P2 capsid completion gpL-like protein	capsid	E5E3S2	Burkholderia_phage	50.6	9.2e-31
VEG97084.1|2886912_2887116_+|tail	tail protein	tail	A0A2H4J946	uncultured_Caudovirales_phage	59.1	3.1e-15
VEG97085.1|2887118_2887349_+	phage protein	NA	A0A1S6L007	Salmonella_phage	38.0	3.2e-05
VEG97086.1|2887364_2887733_+	putative phage-related transmembrane protein	NA	NA	NA	NA	NA
VEG97087.1|2887735_2888077_+	Protein of uncharacterised function (DUF754)	NA	NA	NA	NA	NA
VEG97088.1|2888073_2888895_+	Gp28-like protein	NA	A0A2H4JGJ9	uncultured_Caudovirales_phage	51.1	5.9e-65
VEG97089.1|2888884_2889358_+	putative LysB-like protein	NA	E5FFH9	Burkholderia_phage	36.8	1.0e-08
VEG97090.1|2889468_2889939_+|tail	putative tail completion-like protein	tail	A0A077K8R3	Ralstonia_phage	50.4	7.6e-33
VEG97091.1|2889920_2890379_+|tail	phage P2 essential tail completion gpS-like protein	tail	A0A0M3UL83	Salmonella_phage	45.9	6.0e-27
VEG97092.1|2890628_2890955_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEG97093.1|2891935_2892583_+	phage regulatory protein, Rha family	NA	Q8H9L9	Vibrio_phage	63.9	6.3e-30
VEG97094.1|2892731_2893259_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEG97095.1|2893476_2893758_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEG97096.1|2894367_2894919_+|plate	phage baseplate assembly-like protein	plate	F1BUP5	Erwinia_phage	44.0	2.4e-22
VEG97097.1|2894915_2895275_+	putative phage-like protein	NA	A0A1S6KZZ4	Salmonella_phage	52.2	5.4e-23
VEG97098.1|2895271_2896171_+|plate	phage P2 baseplate assembly gpJ-like protein	plate	Q9ZXK8	Pseudomonas_virus	56.8	9.2e-88
VEG97099.1|2896167_2896800_+|tail	tail fiber protein	tail	A0A0F7LA36	Escherichia_phage	60.6	2.4e-66
VEG97100.1|2896799_2897951_+|tail	putative bacteriophage tail fiber protein	tail	A0A2I8TVA9	Erwinia_phage	49.5	2.3e-67
VEG97101.1|2897950_2898571_+|tail	putative tail fiber assembly protein	tail	H9C0Y3	Aeromonas_phage	39.8	8.2e-35
VEG97102.1|2898758_2899937_+	putative phage-like protein	NA	F1BUU3	Erwinia_phage	60.5	8.0e-132
VEG97103.1|2899946_2900465_+	protein FII	NA	E5G6P8	Salmonella_phage	55.8	1.7e-49
VEG97104.1|2900531_2900846_+|tail	phage P2 GpE-like tail protein	tail	A4PE51	Ralstonia_virus	46.0	2.2e-12
VEG97105.1|2900854_2900986_+	Phage P2 GpE	NA	NA	NA	NA	NA
VEG97106.1|2900982_2903430_+|tail	phage tail tape measure protein, TP901 family	tail	A0A2H4JGB2	uncultured_Caudovirales_phage	42.4	3.2e-143
VEG97107.1|2903442_2903934_+	Phage protein U	NA	Q9ZXJ9	Pseudomonas_virus	52.7	6.5e-35
VEG97108.1|2903933_2905094_+	Phage protein D	NA	A0A1S5NV58	Burkholderia_phage	55.4	4.8e-97
>prophage 3
LR134376	Aeromonas encheleia strain NCTC12917 genome assembly, chromosome: 1	4542521	3044295	3053636	4542521		Escherichia_phage(28.57%)	9	NA	NA
VEG97229.1|3044295_3045609_-	perosamine synthetase, Per protein	NA	H8ZJ36	Ostreococcus_tauri_virus	35.9	1.0e-50
VEG97230.1|3045752_3046832_-	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	23.8	3.6e-14
VEG97231.1|3046831_3047605_-	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
VEG97232.1|3047617_3048592_-	FMN reductase	NA	NA	NA	NA	NA
VEG97233.1|3048595_3049249_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	57.5	5.9e-52
VEG97234.1|3049205_3050084_-	glucose-1-phosphate thymidylyltransferase	NA	I7I009	Enterobacteria_phage	63.8	1.1e-104
VEG97235.1|3050214_3051102_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	34.1	1.2e-26
VEG97236.1|3051101_3052187_-	dTDP-glucose 4,6 dehydratase	NA	I7HTA3	Enterobacteria_phage	52.2	2.6e-97
VEG97237.1|3052952_3053636_+	transcriptional regulatory protein PhoP	NA	W8CYM9	Bacillus_phage	32.4	9.0e-27
>prophage 4
LR134376	Aeromonas encheleia strain NCTC12917 genome assembly, chromosome: 1	4542521	3840947	3850905	4542521		uncultured_Mediterranean_phage(25.0%)	10	NA	NA
VEG97938.1|3840947_3842804_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	32.6	1.1e-34
VEG97939.1|3843026_3844814_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	41.4	4.0e-74
VEG97940.1|3844903_3845347_-	GatB/YqeY domain-containing protein	NA	A0A292GL36	Xanthomonas_phage	48.6	1.5e-27
VEG97941.1|3845362_3845578_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
VEG97942.1|3845757_3846771_+	DNA-binding/iron metalloprotein/AP endonuclease	NA	A0A0R6PI74	Moraxella_phage	59.2	8.2e-109
VEG97943.1|3846857_3847841_-	RNA polymerase sigma factor RpoS	NA	F4YCU2	Synechococcus_phage	33.7	8.4e-34
VEG97944.1|3847887_3848934_-	lipoprotein NlpD	NA	A0A0A7NU10	Lactobacillus_phage	39.7	2.5e-12
VEG97945.1|3848943_3849525_-	DedA family membrane protein	NA	NA	NA	NA	NA
VEG97946.1|3849521_3850139_-	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	46.4	4.0e-34
VEG97947.1|3850143_3850905_-	stationary phase survival protein SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	53.0	3.6e-69
