The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
LR134354	Bifidobacterium longum subsp. infantis strain NCTC11817 genome assembly, chromosome: 1	2832748	283017	340544	2832748	integrase,transposase,tRNA	Bacillus_phage(22.22%)	46	308968:308982	324093:324107
VEG39988.1|283017_283254_+|transposase	putative transposase	transposase	NA	NA	NA	NA
VEG39990.1|283301_283994_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEG39992.1|284019_284724_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	31.0	9.6e-24
VEG39994.1|284725_285496_-	ABC-2 type transporter	NA	NA	NA	NA	NA
VEG39998.1|285492_286419_-	ABC transporter	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	28.3	9.7e-16
VEG40001.1|286871_287576_+	LuxR family two component transcriptional regulator	NA	NA	NA	NA	NA
VEG40003.1|287587_288754_+	Signal transduction histidine kinase-like protein	NA	NA	NA	NA	NA
VEG40005.1|288887_290093_+	transporter, major facilitator family protein	NA	NA	NA	NA	NA
VEG40007.1|290688_291906_+	major facilitator superfamily protein	NA	NA	NA	NA	NA
VEG40009.1|292015_293365_+	alpha-L-fucosidase	NA	NA	NA	NA	NA
VEG40011.1|293692_293812_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEG40013.1|294077_294812_+	glycerol facilitator-aquaporin	NA	NA	NA	NA	NA
VEG40015.1|294895_297562_-	znta1	NA	E4ZFI9	Streptococcus_phage	25.4	2.1e-42
VEG40017.1|297672_297954_+	nrea	NA	NA	NA	NA	NA
VEG40019.1|298160_299585_+	protein	NA	NA	NA	NA	NA
VEG40021.1|299581_300211_+	protein	NA	NA	NA	NA	NA
VEG40023.1|300304_301153_+	spou3	NA	NA	NA	NA	NA
VEG40025.1|301587_302556_-	protein	NA	NA	NA	NA	NA
VEG40027.1|303087_303438_+|tRNA	glutamyl-tRNA(Gln) amidotransferase subunit C	tRNA	NA	NA	NA	NA
VEG40029.1|303441_304983_+|tRNA	aspartyl/glutamyl-tRNA amidotransferase subunit A	tRNA	NA	NA	NA	NA
VEG40031.1|305008_306508_+|tRNA	glutamyl-tRNA(gln) amidotransferase subunit B GatB	tRNA	NA	NA	NA	NA
VEG40033.1|306803_307868_+	riml1	NA	NA	NA	NA	NA
VEG40035.1|307878_308193_+	cytosolic protein	NA	NA	NA	NA	NA
VEG40037.1|308361_310233_+	histidine acid phosphatase	NA	A0A218MNG5	uncultured_virus	29.3	5.3e-21
308968:308982	attL	GCCGATTCCGGCAAT	NA	NA	NA	NA
VEG40039.1|310446_312060_+	monoamine oxidase	NA	NA	NA	NA	NA
VEG40041.1|312293_314330_+	transcription termination factor Rho	NA	NA	NA	NA	NA
VEG40043.1|314562_315681_-	periplasmic binding protein/LacI transcriptional regulator	NA	NA	NA	NA	NA
VEG40045.1|315843_317289_-	sugar (glycoside-Pentoside-Hexuronide) transporter	NA	NA	NA	NA	NA
VEG40047.1|317362_319183_-	glycoside hydrolase family 2, sugar binding	NA	NA	NA	NA	NA
VEG40049.1|319548_320034_-|transposase	truncated transposase	transposase	NA	NA	NA	NA
VEG40051.1|320057_321440_-|transposase	transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	26.2	9.1e-26
VEG40053.1|321550_323014_+|integrase	phage integrase family protein	integrase	NA	NA	NA	NA
VEG40055.1|323021_323303_+|transposase	truncated transposase	transposase	A0A1B1P773	Bacillus_phage	48.8	9.4e-15
VEG40057.1|323380_323770_+	chorismate mutase	NA	NA	NA	NA	NA
VEG40058.1|323891_325934_+	protein	NA	NA	NA	NA	NA
324093:324107	attR	GCCGATTCCGGCAAT	NA	NA	NA	NA
VEG40059.1|326291_329027_-|tRNA	valyl-tRNA synthetase	tRNA	A0A2K9KZB8	Tupanvirus	37.2	2.3e-158
VEG40060.1|329170_330697_-	ddpa3	NA	NA	NA	NA	NA
VEG40061.1|330757_331444_-	nth	NA	NA	NA	NA	NA
VEG40062.1|331502_332303_-	putative response regulator	NA	W8CYM9	Bacillus_phage	32.1	2.5e-12
VEG40063.1|332464_333169_-	protein	NA	NA	NA	NA	NA
VEG40065.1|333278_333857_-	membrane protein	NA	NA	NA	NA	NA
VEG40068.1|334030_334525_-	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	48.1	2.2e-30
VEG40070.1|334752_336993_-	dexa	NA	NA	NA	NA	NA
VEG40072.1|337235_339200_+	protein	NA	NA	NA	NA	NA
VEG40074.1|339468_340161_+	alpha/beta superfamily hydrolase	NA	NA	NA	NA	NA
VEG40076.1|340394_340544_+|transposase	ISXoo11 transposase	transposase	NA	NA	NA	NA
>prophage 2
LR134354	Bifidobacterium longum subsp. infantis strain NCTC11817 genome assembly, chromosome: 1	2832748	702938	762262	2832748	integrase,transposase,tRNA	Bacillus_phage(18.18%)	45	688664:688679	749227:749242
688664:688679	attL	GTTCCTGCCGTTGAGC	NA	NA	NA	NA
VEG40747.1|702938_703526_+|integrase	putative site-specific integrase-resolvase	integrase	F9VHY9	Thermus_phage	37.6	1.0e-23
VEG40751.1|703518_704823_+|transposase	transposase, IS605 OrfB family	transposase	A0A7P9	Microcystis_virus	36.3	8.0e-40
VEG40753.1|704960_706238_+	glutamate--cysteine ligase	NA	NA	NA	NA	NA
VEG40755.1|706343_706856_+	putative beta-glucosidase	NA	NA	NA	NA	NA
VEG40757.1|706903_707191_+	nucleotidyltransferase domain protein	NA	NA	NA	NA	NA
VEG40759.1|707177_707579_+	nucleotidyltransferase substrate-binding family protein	NA	NA	NA	NA	NA
VEG40761.1|707589_708795_+	beta-1,3-exoglucanase	NA	NA	NA	NA	NA
VEG40763.1|709322_710678_+|integrase	integrase catalytic subunit	integrase	A0A1B1P773	Bacillus_phage	36.3	7.2e-44
VEG40765.1|711431_712019_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
VEG40767.1|712235_714506_+	beta-glucosidase	NA	NA	NA	NA	NA
VEG40769.1|714765_716991_+	nucleoside-diphosphate-sugar epimerase and GAF domain-containing protein	NA	NA	NA	NA	NA
VEG40771.1|716987_717902_+	membrane protein	NA	NA	NA	NA	NA
VEG40773.1|717898_719776_+	membrane protein	NA	NA	NA	NA	NA
VEG40775.1|719772_721191_+	group 1 glycosyl transferase	NA	NA	NA	NA	NA
VEG40777.1|721192_722731_+	Predicted membrane protein	NA	NA	NA	NA	NA
VEG40779.1|722734_724546_+	membrane lipoprotein lipid attachment site	NA	NA	NA	NA	NA
VEG40781.1|724538_725363_+	VTC domain-containing protein	NA	NA	NA	NA	NA
VEG40783.1|725455_726121_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEG40785.1|726154_728323_+	diguanylate cyclase	NA	A0A2D0WBV8	Bordetella_phage	30.8	6.0e-08
VEG40787.1|728628_730587_+	ABC transporter	NA	W8CYL7	Bacillus_phage	28.5	1.1e-40
VEG40789.1|730583_732599_+	ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	31.6	1.2e-21
VEG40791.1|732778_733819_+	periplasmic binding protein/LacI transcriptional regulator	NA	NA	NA	NA	NA
VEG40793.1|733987_734926_+	Purine nucleosidase	NA	NA	NA	NA	NA
VEG40795.1|734965_736381_+	major facilitator superfamily protein	NA	NA	NA	NA	NA
VEG40797.1|736377_737628_+	sugar kinase	NA	NA	NA	NA	NA
VEG40799.1|737879_738890_+	lacr-type transcription regulator	NA	NA	NA	NA	NA
VEG40801.1|739138_739897_+	putative transcriptional regulator	NA	NA	NA	NA	NA
VEG40803.1|740037_740949_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEG40805.1|740945_741890_+	ROK family protein	NA	NA	NA	NA	NA
VEG40807.1|741949_742633_+	N-acetylmannosamine-6-phosphate 2-epimerase	NA	NA	NA	NA	NA
VEG40809.1|742690_744973_-	putative sialidase	NA	NA	NA	NA	NA
VEG40811.1|745304_746873_+	extracellular solute-binding protein, family 5	NA	NA	NA	NA	NA
VEG40813.1|747024_747981_+	binding-protein-dependent transport system inner membrane protein	NA	NA	NA	NA	NA
VEG40815.1|747982_750127_+	oligopeptide/dipeptide ABC transporter ATPase	NA	G9BWD6	Planktothrix_phage	34.9	1.0e-15
749227:749242	attR	GCTCAACGGCAGGAAC	NA	NA	NA	NA
VEG40817.1|750123_750978_+	ABC transporter	NA	G9BWD6	Planktothrix_phage	31.3	3.9e-19
VEG40819.1|751124_752093_+	dihydrodipicolinate synthetase	NA	NA	NA	NA	NA
VEG40821.1|752161_753373_-	maly2	NA	NA	NA	NA	NA
VEG40823.1|753889_757201_+|tRNA	isoleucyl-tRNA synthetase	tRNA	L7RFX8	Acanthamoeba_polyphaga_moumouvirus	32.3	2.3e-144
VEG40825.1|757649_758015_+	binding-protein-dependent transport system inner membrane protein	NA	NA	NA	NA	NA
VEG40827.1|758002_758929_+	ABC-type spermidine/putrescine transport system permease II-like protein	NA	NA	NA	NA	NA
VEG40829.1|758925_760044_+	spermidine/putrescine ABC transporter, ATP-binding protein PotA	NA	G3M9Y6	Bacillus_virus	39.7	2.8e-33
VEG40831.1|760114_760942_+	type I phosphodiesterase/nucleotide pyrophosphatase domain protein	NA	NA	NA	NA	NA
VEG40833.1|761059_761452_-|transposase	transposase	transposase	A0A0N9STL0	Staphylococcus_phage	33.6	3.4e-10
VEG40835.1|761573_762062_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
VEG40837.1|762130_762262_-|transposase	IS150 putative transposase	transposase	NA	NA	NA	NA
>prophage 3
LR134354	Bifidobacterium longum subsp. infantis strain NCTC11817 genome assembly, chromosome: 1	2832748	1163975	1186002	2832748	bacteriocin,integrase,transposase	Paenibacillus_phage(20.0%)	20	1158419:1158433	1174536:1174550
1158419:1158433	attL	CGTGCTGCTGCGGAA	NA	NA	NA	NA
VEG41480.1|1163975_1165163_+|transposase	transposase, mutator type	transposase	A0A0K2CZ57	Paenibacillus_phage	35.1	1.2e-55
VEG41482.1|1165428_1165575_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEG41484.1|1165603_1166503_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEG41486.1|1166936_1167128_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEG41488.1|1167130_1167898_+	filamentation induced by cAMP protein fic	NA	S4TP71	Salmonella_phage	28.0	7.3e-09
VEG41490.1|1168045_1169389_-|integrase	phage integrase family protein	integrase	NA	NA	NA	NA
VEG41492.1|1171303_1172257_+	Abi family protein	NA	A0A0S2MYH0	Enterococcus_phage	28.0	3.2e-22
VEG41493.1|1172112_1172421_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEG41495.1|1173624_1173873_+	protein	NA	NA	NA	NA	NA
VEG41497.1|1173985_1175248_-	major facilitator superfamily protein	NA	NA	NA	NA	NA
1174536:1174550	attR	TTCCGCAGCAGCACG	NA	NA	NA	NA
VEG41499.1|1175416_1175854_-|transposase	transposase	transposase	NA	NA	NA	NA
VEG41501.1|1176110_1176242_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEG41503.1|1176249_1176687_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEG41505.1|1176779_1177013_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEG41507.1|1177405_1177666_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEG41509.1|1177704_1178973_-|transposase	transposase	transposase	W5R8L2	Staphylococcus_phage	34.3	2.7e-32
VEG41511.1|1179557_1180208_-	ABC transporter	NA	A0A2R8FG22	Brazilian_cedratvirus	29.8	1.6e-12
VEG41513.1|1180210_1182166_-	Uncharacterized protein conserved in bacteria	NA	NA	NA	NA	NA
VEG41515.1|1183675_1184581_+|transposase	putative transposase	transposase	NA	NA	NA	NA
VEG41517.1|1185258_1186002_+|bacteriocin	bacteriocin ABC transporter, permease protein subunit	bacteriocin	NA	NA	NA	NA
>prophage 4
LR134354	Bifidobacterium longum subsp. infantis strain NCTC11817 genome assembly, chromosome: 1	2832748	1296429	1309226	2832748	capsid,terminase,tail	Bifidobacterium_phage(63.64%)	16	NA	NA
VEG41726.1|1296429_1297329_-	Uncharacterised protein	NA	A0A2H4P936	Arthrobacter_phage	32.2	2.1e-07
VEG41728.1|1297342_1298242_-	phage protein	NA	NA	NA	NA	NA
VEG41730.1|1298238_1301592_-|tail	phage tail tape measure protein, TP901 family	tail	I3NL90	Bifidobacterium_phage	48.3	2.0e-204
VEG41732.1|1301608_1301905_-|terminase	phage terminase protein large subunit-like protein	terminase	I3NL91	Bifidobacterium_phage	69.4	5.4e-37
VEG41734.1|1301976_1302471_-	DNAase primase	NA	I3NL92	Bifidobacterium_phage	69.3	8.7e-56
VEG41736.1|1302572_1302815_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEG41738.1|1302826_1303363_-	gp28	NA	I3NL93	Bifidobacterium_phage	87.5	1.8e-83
VEG41740.1|1303435_1303852_-	transcriptional regulator	NA	I3NL94	Bifidobacterium_phage	60.9	6.7e-41
VEG41742.1|1303848_1304247_-	Uncharacterised protein	NA	I3NL95	Bifidobacterium_phage	61.4	1.2e-34
VEG41744.1|1304239_1304665_-	phage associated protein	NA	I3NL96	Bifidobacterium_phage	86.4	8.3e-39
VEG41746.1|1304630_1305050_-	phage protein	NA	A0A2H4J276	uncultured_Caudovirales_phage	32.4	1.7e-07
VEG41748.1|1305071_1305182_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEG41750.1|1305195_1306083_-|capsid	phage major capsid protein, HK97	capsid	V5R986	Arthrobacter_phage	31.5	2.0e-26
VEG41752.1|1306111_1306780_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEG41754.1|1306852_1307845_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEG41756.1|1307792_1309226_-	phage protein	NA	A0A2D1GK98	Mycobacterium_phage	32.1	1.7e-51
>prophage 5
LR134354	Bifidobacterium longum subsp. infantis strain NCTC11817 genome assembly, chromosome: 1	2832748	1805813	1868939	2832748	terminase,holin,protease,integrase,transposase	Lactococcus_phage(20.0%)	55	1801405:1801423	1865744:1865762
1801405:1801423	attL	GGCATCGGCCAACGCCTCG	NA	NA	NA	NA
VEG42928.1|1805813_1806035_-|holin	phage holin-like protein	holin	A0A059NT58	Lactococcus_phage	48.3	7.4e-07
VEG42930.1|1806094_1807213_-	glycoside hydrolase family protein	NA	A0A2P0ZLG2	Lactobacillus_phage	34.1	2.2e-22
VEG42932.1|1807360_1807693_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEG42934.1|1807724_1808519_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEG42935.1|1808534_1808720_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEG42937.1|1808677_1809283_-|terminase	putative phage terminase	terminase	A0A1D8ETI8	Propionibacterium_phage	61.3	6.8e-18
VEG42939.1|1809242_1809629_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEG42941.1|1809731_1810064_-	HNH nuclease	NA	M1PFG7	Streptococcus_phage	54.7	9.1e-17
VEG42943.1|1810047_1810236_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEG42945.1|1810289_1810862_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEG42947.1|1810833_1811892_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEG42949.1|1812058_1813165_+|transposase	transposase	transposase	Q9MBM9	Staphylococcus_prophage	31.4	7.7e-36
VEG42951.1|1813510_1815022_+	ABC transporter ATP-binding protein	NA	A0A1B0RXA0	Streptococcus_phage	27.5	1.1e-19
VEG42953.1|1815187_1815706_+	N-acetyltransferase GCN5	NA	NA	NA	NA	NA
VEG42956.1|1816055_1816703_-	HAD phosphoserine phosphatase-like hydrolase, family IB	NA	NA	NA	NA	NA
VEG42958.1|1816991_1821374_+	putative cell surface protein	NA	NA	NA	NA	NA
VEG42960.1|1822289_1822706_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEG42962.1|1822831_1823098_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEG42964.1|1823126_1823972_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEG42966.1|1824000_1824375_+	PrgI family protein	NA	NA	NA	NA	NA
VEG42968.1|1824346_1826572_-	IstB domain-containing protein ATP-binding protein	NA	A0A059NT77	Lactococcus_phage	36.9	4.0e-31
VEG42970.1|1826674_1827229_-|integrase	prophage LambdaBa04, site-specific recombinase, phage integrase family	integrase	I3NLE2	Bifidobacterium_phage	42.6	6.0e-29
VEG42972.1|1827574_1828276_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
VEG42974.1|1828432_1829704_+	transporter, major facilitator family protein	NA	NA	NA	NA	NA
VEG42976.1|1830356_1831613_-	HipA-like C-terminal domain protein	NA	NA	NA	NA	NA
VEG42978.1|1831786_1832032_+	RelB antitoxin	NA	NA	NA	NA	NA
VEG42980.1|1832018_1832342_+	PemK-like protein	NA	NA	NA	NA	NA
VEG42982.1|1832558_1833173_-	cupin domain-containing protein	NA	NA	NA	NA	NA
VEG42984.1|1833266_1834136_-	methyltransferase domain protein	NA	NA	NA	NA	NA
VEG42986.1|1834232_1834739_+	membrane protein	NA	NA	NA	NA	NA
VEG42988.1|1835268_1836534_+	Fic/DOC family protein	NA	Q9AZ49	Lactococcus_phage	30.9	1.5e-46
VEG42990.1|1837006_1837312_+|transposase	putative transposase	transposase	NA	NA	NA	NA
VEG42992.1|1837397_1839641_-	putative excinuclease ABC, A subunit	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	32.5	2.9e-130
VEG42994.1|1839645_1841028_-	MATE efflux family protein	NA	NA	NA	NA	NA
VEG42996.1|1841052_1841166_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEG42998.1|1841415_1841658_+	TfoX, C-terminal domain-containing protein	NA	NA	NA	NA	NA
VEG43000.1|1841700_1842561_+	bacterial transcription activator, effector-binding domain protein	NA	NA	NA	NA	NA
VEG43002.1|1842741_1843842_-	GTP-dependent nucleic acid-binding protein EngD	NA	NA	NA	NA	NA
VEG43004.1|1843975_1844797_-	pyrroline-5-carboxylate reductase	NA	NA	NA	NA	NA
VEG43006.1|1844858_1846337_-	proline iminopeptidase	NA	NA	NA	NA	NA
VEG43008.1|1846436_1848824_+	two-component sensor kinase	NA	NA	NA	NA	NA
VEG43010.1|1848898_1849768_+	two-component response regulator	NA	NA	NA	NA	NA
VEG43012.1|1849803_1852659_-	putative transport protein	NA	NA	NA	NA	NA
VEG43014.1|1852687_1853602_-	ABC transporter	NA	G9BWD6	Planktothrix_phage	39.3	1.1e-30
VEG43016.1|1854081_1855398_-	O-acetylhomoserine aminocarboxypropyltransferase	NA	A0A0B5JD48	Pandoravirus	25.5	1.3e-13
VEG43018.1|1855873_1856746_+	pyridoxal/pyridoxine/pyridoxamine kinase	NA	NA	NA	NA	NA
VEG43020.1|1856981_1857485_+	endonuclease	NA	NA	NA	NA	NA
VEG43022.1|1857539_1859075_+	sms1	NA	NA	NA	NA	NA
VEG43024.1|1859071_1860772_+	SMF family protein	NA	NA	NA	NA	NA
VEG43026.1|1860828_1862694_+	succinate dehydrogenase or fumarate reductase, flavoprotein subunit	NA	NA	NA	NA	NA
VEG43028.1|1862789_1863755_+	frdb	NA	NA	NA	NA	NA
VEG43030.1|1863848_1864514_+	methyltransferase	NA	NA	NA	NA	NA
VEG43032.1|1864559_1865501_-	DNA uptake protein	NA	A0A1D8KU27	Synechococcus_phage	39.1	6.0e-21
VEG43034.1|1865611_1867048_-	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	33.9	1.3e-38
1865744:1865762	attR	GGCATCGGCCAACGCCTCG	NA	NA	NA	NA
VEG43036.1|1867559_1868939_-|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	48.7	4.8e-112
>prophage 6
LR134354	Bifidobacterium longum subsp. infantis strain NCTC11817 genome assembly, chromosome: 1	2832748	1974022	1985896	2832748	portal	Propionibacterium_phage(25.0%)	15	NA	NA
VEG43254.1|1974022_1975459_+	phage Terminase	NA	A0A1D8EU80	Propionibacterium_phage	45.7	5.8e-108
VEG43256.1|1975458_1976952_+|portal	phage portal protein	portal	A0A068F3B8	Mycobacterium_phage	33.9	3.8e-62
VEG43258.1|1976893_1978396_+	phage protein	NA	A0A1D8ETG0	Propionibacterium_phage	36.0	1.9e-29
VEG43260.1|1978376_1978568_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEG43262.1|1978654_1979119_+	phage helicase	NA	NA	NA	NA	NA
VEG43264.1|1979152_1980094_+	phage structural protein	NA	Q1A0S2	Mycobacterium_virus	56.7	7.6e-93
VEG43266.1|1980093_1980657_+	Head fiber protein	NA	I3NL98	Bifidobacterium_phage	49.5	5.2e-12
VEG43268.1|1980670_1981078_+	phage protein	NA	A0A1P8BKC7	Lactococcus_phage	29.6	4.0e-06
VEG43270.1|1981074_1981419_+	phage protein	NA	NA	NA	NA	NA
VEG43272.1|1981422_1981698_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEG43274.1|1981697_1982075_+	phage protein	NA	NA	NA	NA	NA
VEG43276.1|1982090_1982690_+	prophage LambdaSa03, structural protein	NA	M1PRW6	Streptococcus_phage	34.7	6.7e-18
VEG43278.1|1982849_1983215_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEG43280.1|1983214_1983661_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEG43282.1|1983685_1985896_+	phage tape measure protein	NA	A0A1P8BLF5	Lactococcus_phage	40.8	3.6e-69
>prophage 7
LR134354	Bifidobacterium longum subsp. infantis strain NCTC11817 genome assembly, chromosome: 1	2832748	2052216	2109951	2832748	integrase,transposase,tRNA	Bacillus_phage(23.08%)	51	2085172:2085197	2109952:2109977
VEG43409.1|2052216_2054826_-|tRNA	phenylalanine--tRNA ligase, beta subunit	tRNA	A0A1L3IZU3	BeAn_58058_virus	29.1	1.2e-05
VEG43411.1|2054833_2055889_-|tRNA	phenylalanyl-tRNA synthase alpha subunit	tRNA	A0A2K9L3A8	Tupanvirus	34.7	2.5e-28
VEG43413.1|2055954_2056833_-	rRNA methylase	NA	NA	NA	NA	NA
VEG43415.1|2056945_2057773_-	cobalt transport protein	NA	NA	NA	NA	NA
VEG43417.1|2057769_2059245_-	ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	32.8	5.9e-15
VEG43419.1|2059244_2059844_-	ABC-type cobalt transport system, permease protein	NA	NA	NA	NA	NA
VEG43421.1|2060144_2061512_-	peptidase dimerization domain-containing protein	NA	NA	NA	NA	NA
VEG43423.1|2061603_2062227_+	protein	NA	NA	NA	NA	NA
VEG43425.1|2062375_2063866_+	lpd1	NA	A0A2K5B2C5	Erysipelothrix_phage	28.4	7.0e-32
VEG43427.1|2063949_2064732_+	protein	NA	NA	NA	NA	NA
VEG43429.1|2065051_2066488_+	glutamine synthetase	NA	NA	NA	NA	NA
VEG43431.1|2066565_2066841_-	truncated beta-glucuronidase	NA	NA	NA	NA	NA
VEG43433.1|2066948_2068055_-	auxin efflux carrier family protein	NA	NA	NA	NA	NA
VEG43435.1|2068245_2068575_-	galactoside O-acetyltransferase	NA	NA	NA	NA	NA
VEG43437.1|2068601_2068769_-	galactoside O-acetyltransferase	NA	NA	NA	NA	NA
VEG43439.1|2068811_2069342_-	transcriptional regulator, PadR-like family	NA	NA	NA	NA	NA
VEG43441.1|2069604_2070312_-	HhH-GPD family protein	NA	NA	NA	NA	NA
VEG43443.1|2070557_2071916_-	Na+ driven multidrug efflux pump	NA	NA	NA	NA	NA
VEG43445.1|2071973_2074562_-	excinuclease ABC subunit A-like protein	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	33.8	1.1e-104
VEG43447.1|2074911_2076669_-	methyl-accepting chemotaxis protein	NA	NA	NA	NA	NA
VEG43449.1|2077243_2077651_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
VEG43451.1|2077695_2077992_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEG43453.1|2078413_2079679_-	beta-galactosidase	NA	A0A0B5JD41	Pandoravirus	30.9	2.7e-48
VEG43455.1|2079962_2081048_+	RnfABCDGE type electron transport complex subunit D	NA	NA	NA	NA	NA
VEG43457.1|2081104_2083009_+	sialic acidspecific 9-O-acetylesterase	NA	NA	NA	NA	NA
VEG43459.1|2083025_2083745_-	histidine kinase	NA	W8CYF6	Bacillus_phage	38.6	2.0e-40
VEG43461.1|2083815_2085171_+|integrase	integrase catalytic subunit	integrase	A0A1B1P773	Bacillus_phage	36.3	7.2e-44
2085172:2085197	attL	CCGTCCAAAAAAACATCCGCACCCCC	NA	NA	NA	NA
VEG43463.1|2085330_2086692_-	putative AAA+ superfamily ATPase	NA	NA	NA	NA	NA
VEG43465.1|2087110_2089420_-	putative ABC transporter permease	NA	NA	NA	NA	NA
VEG43467.1|2089429_2090131_-	ABC transporter	NA	G9BWD6	Planktothrix_phage	36.9	4.1e-35
VEG43469.1|2090103_2090727_-	transcriptional regulator, TetR family	NA	NA	NA	NA	NA
VEG43471.1|2091135_2092413_+|transposase	transposase IS116/IS110/IS902 family protein	transposase	NA	NA	NA	NA
VEG43473.1|2092620_2093664_-	alcohol dehydrogenase	NA	NA	NA	NA	NA
VEG43475.1|2093704_2093848_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
VEG43477.1|2093884_2093983_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
VEG43479.1|2094232_2094769_+	CrcB-like protein	NA	NA	NA	NA	NA
VEG43481.1|2094768_2095134_+	putative protein CrcB	NA	NA	NA	NA	NA
VEG43483.1|2095214_2095703_+	GtrA-like protein	NA	NA	NA	NA	NA
VEG43485.1|2095787_2096852_-	membrane protein	NA	NA	NA	NA	NA
VEG43487.1|2097122_2097596_-	transcriptional regulator	NA	NA	NA	NA	NA
VEG43489.1|2097805_2099005_-	Protein Translation Elongation Factor Tu (EF-TU)	NA	A0A2H4UVR3	Bodo_saltans_virus	24.0	1.9e-08
VEG43491.1|2099177_2101301_-	translation elongation factor G	NA	E4ZFJ7	Streptococcus_phage	26.7	2.3e-60
VEG43493.1|2101333_2101804_-	30S ribosomal protein S7	NA	NA	NA	NA	NA
VEG43495.1|2101809_2102181_-	30S ribosomal protein S12	NA	NA	NA	NA	NA
VEG43497.1|2102182_2103139_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEG43499.1|2103177_2103351_-|transposase	putative truncated transposase	transposase	NA	NA	NA	NA
VEG43501.1|2103541_2104420_+	Abi family protein	NA	NA	NA	NA	NA
VEG43503.1|2104650_2105916_-|transposase	transposase IS116/IS110/IS902 family protein	transposase	NA	NA	NA	NA
VEG43505.1|2106303_2106810_-	IstB domain-containing protein ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	40.7	1.1e-24
VEG43507.1|2107102_2108089_-|transposase	putative truncated transposase	transposase	NA	NA	NA	NA
VEG43509.1|2108595_2109951_+|integrase	integrase catalytic subunit	integrase	A0A1B1P773	Bacillus_phage	36.3	7.2e-44
2109952:2109977	attR	CCGTCCAAAAAAACATCCGCACCCCC	NA	NA	NA	NA
>prophage 8
LR134354	Bifidobacterium longum subsp. infantis strain NCTC11817 genome assembly, chromosome: 1	2832748	2248709	2381880	2832748	protease,head,transposase	Lactobacillus_phage(11.76%)	109	NA	NA
VEG43730.1|2248709_2251223_+|protease	transglutaminase-like cysteine protease	protease	NA	NA	NA	NA
VEG43732.1|2251296_2251485_+	putative phosphatase	NA	NA	NA	NA	NA
VEG43734.1|2251511_2252123_+	protein	NA	NA	NA	NA	NA
VEG43736.1|2252138_2252777_+|head	forkhead domain protein	head	NA	NA	NA	NA
VEG43738.1|2252935_2256973_-	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	26.8	5.3e-58
VEG43740.1|2257140_2260704_-	DNA-directed RNA polymerase subunit beta RpoB	NA	A0A1B1ISA9	uncultured_Mediterranean_phage	22.0	6.8e-33
VEG43742.1|2260940_2261663_-	protein	NA	NA	NA	NA	NA
VEG43744.1|2261727_2262684_-	putative A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
VEG43746.1|2262704_2263367_+	RNA methyltransferase	NA	NA	NA	NA	NA
VEG43748.1|2264017_2265382_-	protein	NA	NA	NA	NA	NA
VEG43750.1|2265517_2265790_-	ACT domain-containing protein	NA	NA	NA	NA	NA
VEG43752.1|2265958_2267869_-	glycosyl hydrolase family protein	NA	NA	NA	NA	NA
VEG43754.1|2267967_2269059_-	periplasmic-binding protein/LacI transcriptional regulator	NA	NA	NA	NA	NA
VEG43756.1|2269086_2269764_-	Drug resistance transporter, EmrB/QacA subfamily	NA	NA	NA	NA	NA
VEG43758.1|2269825_2270761_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
VEG43760.1|2270773_2271700_-	polysaccharide ABC transporter permease	NA	NA	NA	NA	NA
VEG43762.1|2271851_2273459_-	ABC transporter	NA	NA	NA	NA	NA
VEG43764.1|2274072_2275323_-	galactokinase GalK	NA	NA	NA	NA	NA
VEG43766.1|2275339_2276590_-	galactose-1-phosphate uridylyltransferase	NA	NA	NA	NA	NA
VEG43768.1|2276594_2277308_-	DeoR-type transcriptional regulator	NA	NA	NA	NA	NA
VEG43770.1|2277752_2278904_+	dihydroorotate oxidase	NA	NA	NA	NA	NA
VEG43772.1|2279071_2280454_-	putative oxidoreductase	NA	NA	NA	NA	NA
VEG43774.1|2280675_2282964_-	family 51 glycosyl transferase	NA	NA	NA	NA	NA
VEG43776.1|2283067_2283865_-	cyclic nucleotide-binding domain-containing protein	NA	NA	NA	NA	NA
VEG43778.1|2283861_2284947_-	lipoate protein ligase	NA	NA	NA	NA	NA
VEG43780.1|2285003_2286035_-	3-isopropylmalate dehydrogenase	NA	NA	NA	NA	NA
VEG43782.1|2286239_2288756_-	ptrb	NA	NA	NA	NA	NA
VEG43784.1|2288816_2290148_-	protein	NA	NA	NA	NA	NA
VEG43786.1|2290304_2290718_-	glycine cleavage system H protein	NA	NA	NA	NA	NA
VEG43788.1|2290743_2292036_-	npy1	NA	NA	NA	NA	NA
VEG43790.1|2292045_2292903_-	pepr1	NA	NA	NA	NA	NA
VEG43792.1|2293030_2293693_-	protein	NA	NA	NA	NA	NA
VEG43794.1|2293860_2294232_+	thioredoxin domain-containing protein	NA	A0A1J0GW78	Streptomyces_phage	38.6	1.9e-10
VEG43796.1|2294406_2295390_+	G5 domain-containing protein	NA	D6PSZ3	Lactobacillus_phage	48.2	2.6e-19
VEG43798.1|2295669_2296233_+	transcriptional regulator, XRE family	NA	NA	NA	NA	NA
VEG43800.1|2296210_2297566_+	HipA domain-containing protein	NA	NA	NA	NA	NA
VEG43802.1|2297589_2298996_-	sugar-binding domain-containing protein	NA	NA	NA	NA	NA
VEG43804.1|2299220_2300639_-	chain length determinant protein	NA	NA	NA	NA	NA
VEG43806.1|2301103_2302495_+	protein	NA	NA	NA	NA	NA
VEG43808.1|2303138_2303855_+	Abi family protein	NA	NA	NA	NA	NA
VEG43810.1|2304230_2305418_-|transposase	transposase	transposase	Q9MBM9	Staphylococcus_prophage	33.5	1.7e-33
VEG43812.1|2305460_2306603_+	proline symporter	NA	NA	NA	NA	NA
VEG43813.1|2306746_2307136_-	ABC transporter	NA	NA	NA	NA	NA
VEG43814.1|2307132_2307627_-	transcriptional regulator, XRE family	NA	NA	NA	NA	NA
VEG43815.1|2307690_2308227_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEG43816.1|2309760_2310624_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEG43817.1|2310728_2313533_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEG43819.1|2313766_2314180_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
VEG43821.1|2314305_2315244_+|transposase	putative truncated transposase	transposase	NA	NA	NA	NA
VEG43823.1|2315206_2315767_+|transposase	putative truncated transposase	transposase	NA	NA	NA	NA
VEG43825.1|2316034_2316514_+	IstB domain-containing protein ATP-binding protein	NA	NA	NA	NA	NA
VEG43827.1|2316926_2318192_+|transposase	transposase IS116/IS110/IS902 family protein	transposase	NA	NA	NA	NA
VEG43829.1|2318009_2318600_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
VEG43831.1|2318916_2320452_-	polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
VEG43833.1|2320463_2321159_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEG43835.1|2321429_2322506_+	family 2 glycosyl transferase	NA	A0A1V0SAH6	Catovirus	34.2	1.4e-13
VEG43837.1|2322449_2323511_-|transposase	transposase	transposase	A0A220NQR7	Corynebacterium_phage	34.5	5.0e-32
VEG43839.1|2324107_2324989_-	glycosyl transferase family protein	NA	NA	NA	NA	NA
VEG43841.1|2325013_2325946_-	capsular polysaccharide biosynthesis protein	NA	A0A0N7KVT5	Yellowstone_lake_phycodnavirus	26.3	2.0e-08
VEG43843.1|2325948_2326959_-	putative glycosyltransferase	NA	NA	NA	NA	NA
VEG43845.1|2326978_2328103_-	group 1 glycosyl transferase	NA	NA	NA	NA	NA
VEG43847.1|2328136_2329297_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEG43849.1|2329357_2330452_-	family 2 glycosyl transferase	NA	NA	NA	NA	NA
VEG43851.1|2330596_2331415_-	glycosyltransferase	NA	NA	NA	NA	NA
VEG43853.1|2331512_2331983_+|transposase	putative transposase	transposase	NA	NA	NA	NA
VEG43855.1|2332057_2332663_-	putative low molecular weight protein-tyrosine-phosphatase	NA	NA	NA	NA	NA
VEG43857.1|2332962_2334165_-|transposase	transposase IS116/IS110/IS902 family protein	transposase	NA	NA	NA	NA
VEG43860.1|2334518_2336237_+	galactosyl transferase CpsD	NA	NA	NA	NA	NA
VEG43862.1|2336686_2337121_+	protein	NA	NA	NA	NA	NA
VEG43864.1|2337678_2339142_-	putative transcriptional regulator	NA	NA	NA	NA	NA
VEG43866.1|2339477_2339780_-|transposase	putative transposase	transposase	NA	NA	NA	NA
VEG43868.1|2339870_2341088_+	protein	NA	NA	NA	NA	NA
VEG43870.1|2341891_2344348_+	metallophosphoesterase	NA	NA	NA	NA	NA
VEG43872.1|2344490_2346839_+	beta-galactosidase	NA	NA	NA	NA	NA
VEG43874.1|2347013_2348471_-	proteasome component	NA	NA	NA	NA	NA
VEG43876.1|2348470_2348674_-	ubiquitin-like protein Pup	NA	NA	NA	NA	NA
VEG43878.1|2348765_2349662_-	inositol monophosphatase	NA	NA	NA	NA	NA
VEG43880.1|2349673_2351341_-	proteasome component	NA	NA	NA	NA	NA
VEG43882.1|2351362_2352928_-	rpt1	NA	A0A1B2RW50	Lymphocystis_disease_virus	42.5	1.3e-31
VEG43884.1|2352988_2353687_-	membrane protein	NA	NA	NA	NA	NA
VEG43886.1|2353737_2354460_+	phosphoserine phosphatase	NA	NA	NA	NA	NA
VEG43888.1|2354499_2356812_+	primosome assembly protein PriA	NA	NA	NA	NA	NA
VEG43890.1|2356870_2357575_+	HAD hydrolase, family IA, variant 3 domain protein	NA	NA	NA	NA	NA
VEG43892.1|2357598_2358585_+	fmt	NA	NA	NA	NA	NA
VEG43894.1|2358677_2360447_-	dihydroxy-acid dehydratase	NA	NA	NA	NA	NA
VEG43896.1|2360742_2361027_+	rpoz	NA	NA	NA	NA	NA
VEG43898.1|2361304_2362525_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	56.8	2.2e-124
VEG43900.1|2362840_2364208_+	efflux ABC transporter permease	NA	NA	NA	NA	NA
VEG43901.1|2364204_2365428_+	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
VEG43903.1|2365440_2366076_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.3	6.6e-24
VEG43905.1|2366237_2366756_-	putative low molecular weight protein-tyrosine-phosphatase	NA	NA	NA	NA	NA
VEG43907.1|2366879_2367542_-	fola	NA	A0A0A8JB64	Ralstonia_phage	43.6	3.6e-20
VEG43909.1|2367547_2367652_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEG43911.1|2367651_2368524_-	thya	NA	A0A2R4A1R4	Microbacterium_phage	65.5	2.9e-102
VEG43913.1|2368651_2369065_+	OsmC-like protein	NA	NA	NA	NA	NA
VEG43915.1|2369126_2370164_-	universal stress family protein	NA	NA	NA	NA	NA
VEG43917.1|2370334_2371072_-	NLP/P60 protein	NA	D2KRB9	Lactobacillus_phage	35.5	8.6e-07
VEG43919.1|2371226_2371871_-	NLP/P60 protein	NA	NA	NA	NA	NA
VEG43921.1|2372185_2373142_-	surface antigen protein	NA	A0A1P8CMP9	Staphylococcus_phage	40.6	2.8e-10
VEG43923.1|2373241_2373466_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEG43925.1|2373534_2374677_+	serc	NA	NA	NA	NA	NA
VEG43927.1|2374801_2375062_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEG43929.1|2375068_2376253_-	histidine kinase sensor of two component system	NA	NA	NA	NA	NA
VEG43931.1|2376452_2377127_+	phosphate transport system regulatory protein PhoU	NA	NA	NA	NA	NA
VEG43933.1|2377485_2378226_-	phosphoglycerate mutase	NA	NA	NA	NA	NA
VEG43935.1|2378766_2379093_+	Resolvase helix-turn-helix domain-containing protein	NA	E5FFF9	Burkholderia_phage	40.2	6.4e-15
VEG43937.1|2379308_2379689_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEG43939.1|2379781_2380894_-	Cytochrome P450-like protein	NA	NA	NA	NA	NA
VEG43941.1|2380911_2381880_-|protease	putative ATP-dependent Clp protease ATP-binding subunit	protease	A0A1C3S747	Escherichia_phage	37.3	2.3e-31
>prophage 9
LR134354	Bifidobacterium longum subsp. infantis strain NCTC11817 genome assembly, chromosome: 1	2832748	2800563	2810340	2832748		Mycobacterium_phage(33.33%)	9	NA	NA
VEG44885.1|2800563_2801691_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.8	2.9e-22
VEG44888.1|2801811_2802039_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEG44891.1|2802049_2803225_-	wcaa2	NA	NA	NA	NA	NA
VEG44894.1|2803288_2804281_-	ribonucleoside-diphosphate reductase subunit beta NrdF	NA	R4TBI6	Mycobacterium_phage	77.6	2.7e-141
VEG44897.1|2804293_2804389_-	protein	NA	NA	NA	NA	NA
VEG44900.1|2804509_2806705_-	ribonucleoside-diphosphate reductase subunit alpha	NA	V9VI16	Lactococcus_phage	47.0	1.7e-183
VEG44903.1|2806820_2807273_-	nrdI protein	NA	R4JF54	Bacillus_phage	32.5	2.3e-10
VEG44906.1|2807269_2807536_-	glutaredoxin-like protein NrdH	NA	V5R9U9	Mycobacterium_phage	41.8	3.9e-10
VEG44909.1|2808129_2810340_+	protein kinase	NA	A0A2I2L395	Orpheovirus	26.1	3.1e-12
