The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
LR134331	Lactobacillus rhamnosus strain NCTC13764 genome assembly, chromosome: 1	2988387	838653	892687	2988387	head,transposase,tail,portal,tRNA,integrase,terminase	Lactobacillus_phage(86.67%)	65	818250:818309	881783:881858
818250:818309	attL	ATGGAGGATTAGCTCAGTTGGGAGAGCGTCTGCCTTACAAGCAGAGGGTCACAGGTTCGA	NA	NA	NA	NA
VEF59333.1|838653_839781_-|integrase	phage-related integrase	integrase	B4XYR4	Lactobacillus_phage	98.4	9.8e-212
VEF59335.1|839888_840152_-	Uncharacterised protein	NA	B4XYT0	Lactobacillus_phage	41.3	8.5e-10
VEF59337.1|840290_840512_+	Uncharacterised protein	NA	U5U783	Lactobacillus_phage	69.0	1.1e-21
VEF59339.1|840794_841904_-	Type I restriction-modification system, specificity subunit S	NA	NA	NA	NA	NA
VEF59341.1|841994_842213_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEF59343.1|842284_842932_-	phage-related Cro/CI family transcription regulator	NA	B4XYR6	Lactobacillus_phage	43.1	9.7e-39
VEF59345.1|843080_843347_+	Helix-turn-helix	NA	NA	NA	NA	NA
VEF59347.1|843343_843607_+	Putative antirepressor protein	NA	Q6J1W3	Lactobacillus_phage	89.3	2.0e-30
VEF59349.1|843708_844449_+	Phage antirepressor protein	NA	B4XYR8	Lactobacillus_phage	84.8	7.8e-109
VEF59351.1|844449_844710_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEF59353.1|844702_845008_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEF59355.1|845082_845439_+	Uncharacterized protein conserved in bacteria	NA	B4XYS0	Lactobacillus_phage	99.2	5.3e-63
VEF59357.1|845438_845531_+	Uncharacterised protein	NA	A0A0P0IZE0	Lactobacillus_phage	86.7	1.5e-09
VEF59359.1|845523_845727_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEF59361.1|845801_846116_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEF59363.1|846108_846945_+	Phage replication initiation protein	NA	A0A0P0ICZ8	Lactobacillus_phage	67.5	2.1e-110
VEF59365.1|846941_848204_+	Replicative DNA helicase	NA	A8YQM1	Lactobacillus_phage	97.6	3.9e-233
VEF59367.1|848205_848550_+	Uncharacterised protein	NA	U5U420	Lactobacillus_phage	88.6	1.4e-55
VEF59369.1|848562_848850_+	Uncharacterised protein	NA	U5U4M6	Lactobacillus_phage	93.7	7.8e-41
VEF59371.1|848836_849091_+	Uncharacterised protein	NA	A0A0P0IQP0	Lactobacillus_phage	95.2	1.2e-37
VEF59373.1|849087_849453_+	Putative prophage Lp2 protein 24	NA	A0A0P0HRU0	Lactobacillus_phage	100.0	1.8e-66
VEF59375.1|849465_849930_+	Prophage pi3 protein 39	NA	A0A0P0IXF6	Lactobacillus_phage	100.0	9.5e-20
VEF59377.1|849941_850127_+	phage protein	NA	Q6J1V0	Lactobacillus_phage	88.5	1.5e-24
VEF59379.1|850123_850630_+	phage protein	NA	Q8LTB6	Lactobacillus_phage	71.2	1.2e-57
VEF59381.1|850619_850796_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEF59383.1|850785_851103_+	Uncharacterised protein	NA	C1KFT5	Lactobacillus_virus	50.0	4.2e-19
VEF59385.1|851099_851309_+	Uncharacterised protein	NA	A8YQM9	Lactobacillus_phage	92.8	1.0e-29
VEF59387.1|851653_852082_+	phage transcriptional regulator, ArpU family	NA	NA	NA	NA	NA
VEF59389.1|852616_853282_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEF59391.1|853924_855142_+	Uncharacterized protein conserved in bacteria	NA	A8YQN3	Lactobacillus_phage	97.3	5.6e-237
VEF59393.1|855128_855659_+	HNH homing endonuclease	NA	U5U4N5	Lactobacillus_phage	96.6	2.0e-98
VEF59394.1|855662_855986_+	Phage-protein, ribonucleoside-diphosphate reductase	NA	A0A0N7IRA2	Lactobacillus_phage	88.5	2.3e-49
VEF59396.1|856188_856983_+|terminase	phage-related terminase small subunit	terminase	B4XYU4	Lactobacillus_phage	98.5	3.1e-148
VEF59398.1|857183_857639_+|terminase	phage-related terminase small subunit	terminase	B4XYP1	Lactobacillus_phage	99.3	1.0e-79
VEF59400.1|857660_859373_+|terminase	phage-related terminase large subunit	terminase	B4XYP2	Lactobacillus_phage	98.4	0.0e+00
VEF59402.1|859384_859576_+	Uncharacterised protein	NA	A0A2D1GPE7	Lactobacillus_phage	100.0	3.0e-28
VEF59404.1|859580_860834_+|portal	phage-related portal protein	portal	B4XYP4	Lactobacillus_phage	98.3	6.5e-233
VEF59406.1|860787_861417_+|head	phage-related prohead protein	head	B4XYP5	Lactobacillus_phage	100.0	3.3e-116
VEF59408.1|861458_862661_+|head	phage-related major head protein	head	B4XYP6	Lactobacillus_phage	96.2	1.2e-210
VEF59410.1|862678_862918_+	Bacterial Ig-like domain (group 2)	NA	A0A2D1GPN4	Lactobacillus_phage	96.2	2.1e-31
VEF59412.1|862928_863288_+	DNA packaging protein, phage associated	NA	U5U4K5	Lactobacillus_phage	96.6	3.6e-59
VEF59414.1|863277_863607_+|head,tail	Putative head-tail joining protein	head,tail	P94213	Lactobacillus_phage	98.2	6.8e-57
VEF59416.1|863606_863993_+	Phage protein	NA	B4XYP9	Lactobacillus_phage	98.4	5.0e-67
VEF59418.1|863992_864379_+|head,tail	phage-related head-to-tail joining protein	head,tail	U5U3W4	Lactobacillus_phage	97.7	1.4e-69
VEF59420.1|864412_865027_+|tail	phage-related major tail protein	tail	U5U3Z7	Lactobacillus_phage	97.1	1.4e-108
VEF59422.1|865129_865543_+	Uncharacterised protein	NA	A0A2D1GPL7	Lactobacillus_phage	100.0	6.4e-52
VEF59424.1|865665_870558_+|tail	Phage tail length tape-measure protein	tail	A0A2D1GPD5	Lactobacillus_phage	90.8	0.0e+00
VEF59426.1|870557_871271_+	Prophage Lp1 protein 51	NA	A0A1B2APY0	Phage_Wrath	40.0	2.6e-45
VEF59428.1|871272_872745_+	prophage protein	NA	A0A286QMQ0	Streptococcus_phage	25.4	4.6e-36
VEF59430.1|872744_875858_+	CotH protein	NA	NA	NA	NA	NA
VEF59432.1|875999_876293_+	phage protein	NA	B4XYQ7	Lactobacillus_phage	94.8	5.3e-45
VEF59434.1|876282_876696_+	Holin	NA	A0A0P0IDC6	Lactobacillus_phage	95.8	7.1e-43
VEF59436.1|876710_876983_+	Uncharacterised protein	NA	C1KFI4	Lactobacillus_virus	67.8	4.8e-32
VEF59438.1|876994_878179_+	Putative endolysin	NA	A0A0P0HRN9	Lactobacillus_phage	89.6	6.0e-204
VEF59440.1|878326_878683_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEF59442.1|879105_880122_+|transposase	IS30 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	33.4	2.4e-36
VEF59444.1|880151_880511_-	Unchracterized conserved protein	NA	NA	NA	NA	NA
VEF59446.1|882010_882664_-	Uncharacterised protein	NA	NA	NA	NA	NA
881783:881858	attR	ATGGAGGATTAGCTCAGTTGGGAGAGCGTCTGCCTTACAAGCAGAGGGTCACAGGTTCGAGCCCTGTATCCTCCAT	NA	NA	NA	NA
VEF59448.1|884556_886050_+	major facilitator superfamily permease	NA	NA	NA	NA	NA
VEF59450.1|886226_886697_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
VEF59452.1|886918_888133_+	major facilitator superfamily permease	NA	NA	NA	NA	NA
VEF59454.1|888145_888397_+	major facilitator superfamily permease	NA	NA	NA	NA	NA
VEF59456.1|888393_889119_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEF59458.1|889183_889855_-	phosphoesterase	NA	NA	NA	NA	NA
VEF59460.1|890275_892687_+|tRNA	leucyl-tRNA synthetase	tRNA	A0A2H4PQS0	Staphylococcus_phage	69.1	0.0e+00
>prophage 2
LR134331	Lactobacillus rhamnosus strain NCTC13764 genome assembly, chromosome: 1	2988387	1048242	1060813	2988387	head,tail,portal,protease,integrase,terminase	uncultured_Caudovirales_phage(28.57%)	18	1041758:1041771	1050464:1050477
1041758:1041771	attL	GGTTTATGCCGGTG	NA	NA	NA	NA
VEF59751.1|1048242_1049391_-|integrase	site-specific recombinase, prophage lsa1 integrase	integrase	A0A097BYJ7	Leuconostoc_phage	29.3	6.0e-31
VEF59753.1|1049498_1050158_-	Predicted transcriptional regulator	NA	NA	NA	NA	NA
VEF59755.1|1050326_1050596_+	Helix-turn-helix domain	NA	NA	NA	NA	NA
1050464:1050477	attR	GGTTTATGCCGGTG	NA	NA	NA	NA
VEF59757.1|1050663_1050885_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEF59759.1|1050877_1051012_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEF59761.1|1050995_1051187_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEF59763.1|1051231_1051507_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEF59765.1|1051503_1051692_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEF59767.1|1051675_1052503_+	prophage Lp3 protein 7-like protein	NA	Q854C1	Mycobacterium_phage	31.8	3.4e-12
VEF59769.1|1052495_1053920_+	prophage Lp3 protein 8, helicase-like protein	NA	A0A1W6JQD6	Staphylococcus_phage	37.6	1.1e-63
VEF59771.1|1054183_1054525_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEF59773.1|1055106_1055577_+|terminase	prophage Lp3 protein 14, terminase small subunit-like protein	terminase	NA	NA	NA	NA
VEF59775.1|1055573_1057277_+|terminase	Phage terminase-like protein	terminase	E9LUI0	Lactobacillus_phage	40.2	6.0e-120
VEF59777.1|1057242_1057422_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEF59779.1|1057426_1058611_+|portal	prophage Lp3 protein 17, portal protein-like protein	portal	A0A2H4JB06	uncultured_Caudovirales_phage	35.5	3.7e-60
VEF59781.1|1058597_1060142_+|head,protease	phage-related prohead protease	head,protease	A0A2H4J9X8	uncultured_Caudovirales_phage	31.0	3.8e-33
VEF59783.1|1060197_1060488_+	phage protein	NA	NA	NA	NA	NA
VEF59785.1|1060531_1060813_+|head,tail	phage head-tail adaptor	head,tail	I7AUE6	Enterococcus_phage	39.7	1.7e-08
