The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
LR134328	Bacillus freudenreichii strain NCTC4823 genome assembly, chromosome: 1	4368765	2658	10921	4368765		Bacillus_virus(83.33%)	10	NA	NA
VEF46030.1|2658_5154_-	DNA gyrase subunit A	NA	G3M9Z5	Bacillus_virus	36.4	5.7e-111
VEF46031.1|5660_5903_-	DNA gyrase subunit B	NA	G3M9Z3	Bacillus_virus	61.4	8.1e-15
VEF46032.1|5848_6298_-	DNA gyrase subunit beta	NA	G3M9Z3	Bacillus_virus	57.4	2.6e-35
VEF46033.1|6254_6698_-	DNA gyrase subunit B	NA	G3M9Z3	Bacillus_virus	43.0	1.9e-09
VEF46034.1|6694_7588_-	DNA gyrase subunit B	NA	G3M9Z3	Bacillus_virus	43.2	5.6e-53
VEF46035.1|7629_7878_-	regulator of the extracellular matrix	NA	NA	NA	NA	NA
VEF46036.1|7889_8816_-	DNA replication and repair protein RecF	NA	NA	NA	NA	NA
VEF46037.1|8802_9006_-	recombination protein F	NA	NA	NA	NA	NA
VEF46038.1|9018_9234_-	S4 domain-containing protein YaaA	NA	NA	NA	NA	NA
VEF46039.1|9784_10921_-	DNA polymerase III subunit beta	NA	D0R7I4	Paenibacillus_phage	33.6	1.8e-16
>prophage 2
LR134328	Bacillus freudenreichii strain NCTC4823 genome assembly, chromosome: 1	4368765	1529344	1611992	4368765	transposase,tRNA,coat,protease	Paenibacillus_phage(26.67%)	77	NA	NA
VEF47426.1|1529344_1530334_-|protease	intracellular serine protease	protease	A0A127AWU5	Bacillus_phage	52.7	7.8e-80
VEF47427.1|1531035_1531752_-|transposase	transposase IS3/IS911	transposase	A0A0C5AEA5	Paenibacillus_phage	49.6	6.9e-54
VEF47428.1|1531910_1532606_-|transposase	transposase	transposase	A0A0C5AJ29	Paenibacillus_phage	38.1	4.9e-28
VEF47429.1|1532590_1532920_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEF47430.1|1533239_1533380_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEF47431.1|1533585_1534827_-	major facilitator superfamily protein	NA	A0A2H4UVM2	Bodo_saltans_virus	31.2	1.8e-09
VEF47432.1|1534961_1535474_+	C56 family peptidase	NA	NA	NA	NA	NA
VEF47433.1|1535573_1536029_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
VEF47434.1|1536039_1536858_+	glutamate racemase	NA	NA	NA	NA	NA
VEF47435.1|1537762_1538836_+	germination and sporulation lytic protein	NA	NA	NA	NA	NA
VEF47436.1|1539118_1539892_+	ribonuclease PH	NA	NA	NA	NA	NA
VEF47437.1|1539891_1540485_+	nucleoside-triphosphatase	NA	NA	NA	NA	NA
VEF47438.1|1540576_1542019_+	major facilitator superfamily transporter	NA	NA	NA	NA	NA
VEF47439.1|1542312_1542576_-	excalibur domain-containing protein	NA	NA	NA	NA	NA
VEF47440.1|1542943_1543591_+	putative fibronectin binding protein	NA	NA	NA	NA	NA
VEF47441.1|1543952_1544885_-	SPbeta phage DNA nuclease, lipoprotein	NA	A0A1P8CWK6	Bacillus_phage	60.4	2.2e-60
VEF47442.1|1545091_1546240_+	saccharopine dehydrogenase, NADP+, L-lysine forming; L-lysine dehydrogenase	NA	NA	NA	NA	NA
VEF47443.1|1546674_1547868_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
VEF47444.1|1547883_1549002_-	L-carnitine dehydratase/bile acid-inducible protein F	NA	NA	NA	NA	NA
VEF47445.1|1549201_1550338_+	TPR-like protein	NA	NA	NA	NA	NA
VEF47446.1|1550942_1552232_+	prolyl isomerase	NA	NA	NA	NA	NA
VEF47447.1|1552495_1553746_+|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	65.1	2.4e-150
VEF47448.1|1553964_1555632_+|protease	ATP-dependent protease LonB	protease	A0A076FMQ5	Aureococcus_anophage	32.3	2.4e-12
VEF47449.1|1555760_1558085_+|protease	class III heat-shock ATP-dependent Lon protease	protease	A0A0R6PGP8	Moraxella_phage	43.4	1.7e-178
VEF47450.1|1558081_1558666_+	small GTP-binding protein	NA	NA	NA	NA	NA
VEF47451.1|1559406_1559895_-	putative integral inner membrane protein	NA	NA	NA	NA	NA
VEF47452.1|1560233_1561586_+|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
VEF47453.1|1561599_1562430_+	uroporphyrin-III C-methyltransferase	NA	NA	NA	NA	NA
VEF47454.1|1562477_1563410_+	porphobilinogen deaminase	NA	NA	NA	NA	NA
VEF47455.1|1563406_1564210_+	Uroporphyrinogen III synthase HEM4	NA	NA	NA	NA	NA
VEF47456.1|1564212_1565187_+	delta-aminolevulinic acid dehydratase	NA	NA	NA	NA	NA
VEF47457.1|1565541_1566834_+	glutamate-1-semialdehyde-2,1-aminomutase	NA	NA	NA	NA	NA
VEF47458.1|1566853_1566958_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEF47459.1|1566996_1568211_+|transposase	transposase	transposase	A0A1S5SBP9	Streptococcus_phage	25.3	3.8e-28
VEF47460.1|1569203_1570337_+|coat	spore coat assembly protein SpoVID	coat	NA	NA	NA	NA
VEF47461.1|1570479_1571511_+|coat	spore coat protein YsxE	coat	NA	NA	NA	NA
VEF47462.1|1571525_1571717_-	Uncharacterized membrane protein yszA	NA	NA	NA	NA	NA
VEF47463.1|1572212_1574861_+|tRNA	valyl-tRNA synthetase	tRNA	A0A1V0S951	Catovirus	43.2	4.7e-164
VEF47464.1|1575023_1576358_+	folylpolyglutamate synthase	NA	NA	NA	NA	NA
VEF47465.1|1576430_1578137_+	GAF sensor-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	42.0	7.8e-19
VEF47466.1|1578323_1579064_+	prepilin peptidase	NA	NA	NA	NA	NA
VEF47467.1|1579419_1580448_+	stage II sporulation protein B	NA	NA	NA	NA	NA
VEF47468.1|1580618_1581185_+	Maf-like protein	NA	NA	NA	NA	NA
VEF47469.1|1581211_1581904_+	DNA repair protein RadC	NA	NA	NA	NA	NA
VEF47470.1|1582052_1583063_+	rod shape-determining protein MreB	NA	NA	NA	NA	NA
VEF47471.1|1583493_1584363_+	rod shape-determining protein MreC	NA	NA	NA	NA	NA
VEF47472.1|1584362_1584881_+	rod shape-determining protein MreD	NA	NA	NA	NA	NA
VEF47473.1|1585396_1586080_+	septum site-determining protein MinC	NA	NA	NA	NA	NA
VEF47474.1|1586072_1586879_+	septum site-determining protein MinD	NA	NA	NA	NA	NA
VEF47475.1|1587451_1588213_+	stage IV sporulation protein FA	NA	NA	NA	NA	NA
VEF47476.1|1588205_1589057_+	stage IV sporulation protein FB	NA	NA	NA	NA	NA
VEF47477.1|1589243_1589552_+	50S ribosomal protein L21	NA	NA	NA	NA	NA
VEF47478.1|1589564_1589903_+	putative ribosomal protein	NA	NA	NA	NA	NA
VEF47479.1|1589909_1590200_+	50S ribosomal protein L27	NA	NA	NA	NA	NA
VEF47480.1|1590334_1590877_+	signal transduction histidine kinase regulating citrate/malate metabolism	NA	NA	NA	NA	NA
VEF47481.1|1590898_1592191_+	GTPase	NA	NA	NA	NA	NA
VEF47482.1|1592217_1592673_+	ACT domain-containing protein PheB	NA	NA	NA	NA	NA
VEF47483.1|1592676_1592868_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEF47484.1|1593543_1594089_-	transcriptional repressor NadR	NA	NA	NA	NA	NA
VEF47485.1|1594247_1595339_+|coat	spore coat assembly protein SafA	coat	NA	NA	NA	NA
VEF47486.1|1595331_1596324_+	aminoglycoside phosphotransferase	NA	NA	NA	NA	NA
VEF47487.1|1596410_1597127_+	Probable transcriptional regulatory protein YebC	NA	NA	NA	NA	NA
VEF47488.1|1597305_1598241_-	regulatory protein MsrR	NA	NA	NA	NA	NA
VEF47489.1|1598746_1599292_+	sporulation-like protein BofC	NA	NA	NA	NA	NA
VEF47490.1|1599405_1600161_+	exodeoxyribonuclease III	NA	E3T4M6	Cafeteria_roenbergensis_virus	44.4	9.9e-59
VEF47491.1|1600373_1600595_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEF47492.1|1601461_1601590_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEF47493.1|1601606_1601993_+	sporulation-control protein Spo0M	NA	NA	NA	NA	NA
VEF47494.1|1602267_1602948_+|protease	Zn-dependent protease	protease	NA	NA	NA	NA
VEF47495.1|1603175_1604078_-	DMT family transport protein	NA	NA	NA	NA	NA
VEF47496.1|1604569_1606411_+	glucosamine/fructose-6-phosphate aminotransferase	NA	M1HQK2	Paramecium_bursaria_Chlorella_virus	39.8	9.7e-100
VEF47497.1|1606877_1607585_+	nucleotidyltransferase	NA	NA	NA	NA	NA
VEF47498.1|1608243_1609146_+	putative secreted protein	NA	NA	NA	NA	NA
VEF47499.1|1609388_1609865_+	cell wall hydrolase	NA	NA	NA	NA	NA
VEF47500.1|1609888_1610350_+|coat	spore coat protein GerQ	coat	NA	NA	NA	NA
VEF47501.1|1610421_1611138_-|transposase	transposase IS3/IS911	transposase	A0A0C5AEA5	Paenibacillus_phage	49.6	6.9e-54
VEF47502.1|1611296_1611992_-|transposase	transposase	transposase	A0A0C5AJ29	Paenibacillus_phage	38.1	4.9e-28
>prophage 4
LR134328	Bacillus freudenreichii strain NCTC4823 genome assembly, chromosome: 1	4368765	2321900	2381065	4368765	coat,transposase	Paenibacillus_phage(30.77%)	60	NA	NA
VEF48217.1|2321900_2322596_+|transposase	transposase	transposase	A0A0C5AJ29	Paenibacillus_phage	38.1	4.9e-28
VEF48218.1|2322754_2323471_+|transposase	transposase IS3/IS911	transposase	A0A0C5AEA5	Paenibacillus_phage	49.6	6.9e-54
VEF48219.1|2323537_2324509_-	Rhodanese domain-containing protein	NA	NA	NA	NA	NA
VEF48220.1|2325134_2325686_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEF48221.1|2326274_2327750_-	amidase	NA	NA	NA	NA	NA
VEF48222.1|2327868_2329113_-	fosmidomycin resistance protein	NA	NA	NA	NA	NA
VEF48223.1|2329109_2329457_-	Uncharacterized protein conserved in bacteria	NA	NA	NA	NA	NA
VEF48224.1|2329647_2329887_+	protein YkuS	NA	NA	NA	NA	NA
VEF48225.1|2329919_2330432_-	molybdopterin-guanine dinucleotide biosynthesis protein B	NA	NA	NA	NA	NA
VEF48226.1|2330401_2331691_-	molybdopterin molybdochelatase	NA	NA	NA	NA	NA
VEF48227.1|2331716_2332724_-	molybdenum cofactor biosynthesis protein A	NA	NA	NA	NA	NA
VEF48228.1|2332911_2333490_+	LemA family protein	NA	NA	NA	NA	NA
VEF48229.1|2333489_2334254_+	Domain of uncharacterised function (DUF477)	NA	NA	NA	NA	NA
VEF48230.1|2334940_2336857_-	von Willebrand factor A	NA	NA	NA	NA	NA
VEF48231.1|2336868_2337744_-	putative nitric-oxide reductase	NA	A0A0E3HR89	Synechococcus_phage	32.6	6.4e-09
VEF48232.1|2337836_2338379_-	repressor of ComK	NA	NA	NA	NA	NA
VEF48233.1|2338626_2340111_+	aldehyde dehydrogenase	NA	NA	NA	NA	NA
VEF48234.1|2340284_2340407_+	Sporulation inhibitor A	NA	NA	NA	NA	NA
VEF48235.1|2340521_2340776_-	Domain of uncharacterised function (DUF2935)	NA	NA	NA	NA	NA
VEF48236.1|2340839_2341328_-	Domain of uncharacterised function (DUF2935)	NA	A0A2I2L551	Orpheovirus	39.6	4.8e-22
VEF48237.1|2341577_2342846_-	2-oxoglutarate dehydrogenase, E2 subunit, dihydrolipoamide succinyltransferase	NA	NA	NA	NA	NA
VEF48238.1|2342885_2345729_-	2-oxoglutarate dehydrogenase E1	NA	NA	NA	NA	NA
VEF48239.1|2346123_2346591_+|coat	spore coat protein	coat	NA	NA	NA	NA
VEF48240.1|2346670_2347939_+	major facilitator superfamily protein	NA	NA	NA	NA	NA
VEF48241.1|2348190_2348358_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEF48242.1|2348296_2348920_-	thioredoxin	NA	NA	NA	NA	NA
VEF48243.1|2349037_2349223_-	small, acid-soluble spore protein H	NA	NA	NA	NA	NA
VEF48244.1|2349283_2350282_-	luciferase-like monooxygenase	NA	NA	NA	NA	NA
VEF48245.1|2350394_2351351_-	ABC transporter periplasmic protein	NA	NA	NA	NA	NA
VEF48246.1|2351371_2352133_-	ABC transporter ATP-binding protein	NA	Q9EMR9	Amsacta_moorei_entomopoxvirus	24.8	1.2e-16
VEF48247.1|2352129_2353080_-	iron-siderophore ABC transporter permease	NA	NA	NA	NA	NA
VEF48248.1|2353072_2354023_-	iron-siderophore ABC transporter permease	NA	A0A2H4IY97	uncultured_Caudovirales_phage	52.2	4.0e-89
VEF48249.1|2354191_2354920_-	ABC transporter substrate-binding protein EcsC	NA	NA	NA	NA	NA
VEF48250.1|2355042_2356965_-	cadmium-transporting ATPase	NA	E4ZFI9	Streptococcus_phage	41.5	1.7e-126
VEF48251.1|2357375_2359268_+	cadmium-transporting ATPase	NA	E4ZFI9	Streptococcus_phage	39.2	1.4e-114
VEF48252.1|2359406_2360732_-	magnesium transporter	NA	NA	NA	NA	NA
VEF48253.1|2361269_2361857_-	phosphoesterase PA-phosphatase-like protein	NA	NA	NA	NA	NA
VEF48254.1|2362024_2362720_+|transposase	transposase	transposase	A0A0C5AJ29	Paenibacillus_phage	38.1	4.9e-28
VEF48255.1|2362878_2363595_+|transposase	transposase IS3/IS911	transposase	A0A0C5AEA5	Paenibacillus_phage	49.6	6.9e-54
VEF48256.1|2363803_2363989_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEF48257.1|2364007_2367142_-	SMC domain-containing protein	NA	G3MAB6	Bacillus_virus	24.1	2.1e-09
VEF48258.1|2367138_2368284_-	putative exonuclease SbcD	NA	NA	NA	NA	NA
VEF48259.1|2368412_2368550_-	YvrJ protein family	NA	NA	NA	NA	NA
VEF48260.1|2368886_2369105_-	Protein of uncharacterised function (DUF2922)	NA	NA	NA	NA	NA
VEF48261.1|2369135_2369354_-	Protein of uncharacterised function (DUF1659)	NA	NA	NA	NA	NA
VEF48262.1|2369546_2369972_+	YneK	NA	NA	NA	NA	NA
VEF48263.1|2370448_2370844_+	crcB protein	NA	NA	NA	NA	NA
VEF48264.1|2370840_2371197_+	camphor resistance protein CrcB	NA	A0A2H4PQR0	Staphylococcus_phage	36.7	6.1e-11
VEF48265.1|2371165_2371684_-	GCN5-like N-acetyltransferase	NA	NA	NA	NA	NA
VEF48266.1|2371747_2372236_-	integral inner membrane protein	NA	NA	NA	NA	NA
VEF48267.1|2372478_2372652_+	Spo0A-P phosphatase	NA	NA	NA	NA	NA
VEF48268.1|2372854_2373076_-	UPF0154 protein	NA	NA	NA	NA	NA
VEF48269.1|2373152_2373590_-	SirA	NA	NA	NA	NA	NA
VEF48270.1|2373827_2375846_-	transketolase	NA	NA	NA	NA	NA
VEF48271.1|2375975_2376209_-	UPF0291 protein	NA	NA	NA	NA	NA
VEF48272.1|2376296_2376950_-	Resolvase domain-containing protein	NA	NA	NA	NA	NA
VEF48273.1|2376973_2377174_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEF48274.1|2377332_2377962_+	LexA repressor	NA	A0A1B2APZ1	Phage_Wrath	65.2	4.6e-17
VEF48275.1|2378024_2379113_-	stage II sporulation protein P	NA	NA	NA	NA	NA
VEF48276.1|2379802_2381065_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 5
LR134328	Bacillus freudenreichii strain NCTC4823 genome assembly, chromosome: 1	4368765	3629058	3669349	4368765	transposase,integrase,protease	Bacillus_phage(20.0%)	36	3633044:3633063	3669985:3670004
VEF49402.1|3629058_3630213_-|protease	serine protease	protease	W5SAB9	Pithovirus	30.2	7.3e-13
VEF49403.1|3630381_3631656_-	integral membrane sensor signal transduction histidine kinase	NA	A0A1V0SGX0	Hokovirus	29.3	1.2e-16
VEF49404.1|3631792_3632467_-	winged helix family two component transcriptional regulator	NA	W8CYM9	Bacillus_phage	36.8	1.2e-39
3633044:3633063	attL	GCTTTGCGACGAGCTGAACA	NA	NA	NA	NA
VEF49405.1|3633499_3634774_-	proton/sodium-glutamate symport protein	NA	NA	NA	NA	NA
VEF49406.1|3634933_3635776_-	two-component response regulator	NA	NA	NA	NA	NA
VEF49407.1|3635828_3637091_-	two-component sensor histidine kinase	NA	NA	NA	NA	NA
VEF49408.1|3637240_3638401_-	multidrug-efflux transporter	NA	NA	NA	NA	NA
VEF49409.1|3638572_3638725_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEF49410.1|3639232_3639748_-	group-specific protein	NA	NA	NA	NA	NA
VEF49411.1|3640162_3641488_-	C40 family peptidase	NA	A0A0A0RVE6	Bacillus_phage	48.3	4.9e-21
VEF49412.1|3641884_3642937_-	putative threonine aldolase	NA	NA	NA	NA	NA
VEF49413.1|3643083_3643584_-	Predicted integral membrane protein	NA	NA	NA	NA	NA
VEF49414.1|3643989_3644799_-|integrase	integrase catalytic subunit	integrase	A0A2I6AZV9	Macacine_betaherpesvirus	42.9	3.8e-40
VEF49415.1|3644816_3645383_-|transposase	transposase	transposase	NA	NA	NA	NA
VEF49416.1|3645757_3646075_-	YvgT	NA	NA	NA	NA	NA
VEF49417.1|3646038_3646356_-	YvgT	NA	NA	NA	NA	NA
VEF49418.1|3646491_3646779_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEF49419.1|3646758_3647835_-|transposase	transposase	transposase	M4I0N8	Staphylococcus_phage	23.2	9.0e-05
VEF49420.1|3647902_3648322_+	acetylornithine deacetylase or succinyl-diaminopimelate desuccinylase	NA	NA	NA	NA	NA
VEF49421.1|3648686_3650879_-	PAS/PAC sensor-containing diguanylate cyclase/phosphodiesterase	NA	NA	NA	NA	NA
VEF49422.1|3651454_3654793_-	LPXTG-motif cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
VEF49423.1|3655175_3656051_-	carboxylesterase NP	NA	A0A2K9KZN8	Tupanvirus	30.2	1.2e-07
VEF49424.1|3656085_3656394_-	acetoin dehydrogenase E2 subunit dihydrolipoyllysine-residue acetyltransferase	NA	NA	NA	NA	NA
VEF49425.1|3656684_3657221_-	Protein of uncharacterised function (DUF1572)	NA	NA	NA	NA	NA
VEF49426.1|3657643_3658453_-	threonine dehydratase	NA	NA	NA	NA	NA
VEF49427.1|3658449_3658674_-	threonine dehydratase	NA	NA	NA	NA	NA
VEF49428.1|3658786_3659620_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
VEF49429.1|3659874_3661137_-|transposase	transposase	transposase	NA	NA	NA	NA
VEF49430.1|3661752_3663381_-	class I heat-shock protein (chaperonin) GroEL	NA	A0A219YK78	uncultured_virus	56.7	2.4e-158
VEF49431.1|3663436_3663721_-	co-chaperonin GroES	NA	A0A221S3C8	uncultured_virus	54.8	2.0e-20
VEF49432.1|3664132_3664939_+	family 3 extracellular solute-binding protein	NA	NA	NA	NA	NA
VEF49433.1|3665143_3665947_+	family 3 extracellular solute-binding protein	NA	NA	NA	NA	NA
VEF49434.1|3665990_3666725_+	polar amino acid ABC transporter inner membrane subunit	NA	NA	NA	NA	NA
VEF49435.1|3666721_3667444_+	ABC transporter	NA	G9BWD6	Planktothrix_phage	39.1	6.8e-33
VEF49436.1|3667621_3668527_+	malonate efflux carrier	NA	NA	NA	NA	NA
VEF49437.1|3668605_3669349_+|protease	putative membrane protease	protease	NA	NA	NA	NA
3669985:3670004	attR	GCTTTGCGACGAGCTGAACA	NA	NA	NA	NA
