The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
LR134288	Streptococcus milleri strain NCTC11169 genome assembly, chromosome: 1	1856804	445073	453854	1856804		Streptococcus_phage(81.82%)	12	NA	NA
VEE11660.1|445073_445838_+	putative branched-chain amino acid transport protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.1	1.4e-15
VEE11662.1|445837_446548_+	branched-chain amino acid transport protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.2	8.2e-15
VEE11664.1|446694_447351_+	putative acetoin utilization protein AcuB	NA	M1NSC5	Streptococcus_phage	71.8	2.9e-83
VEE11666.1|447417_448281_-	YitT family protein	NA	M1Q1P6	Streptococcus_phage	57.5	1.1e-93
VEE11668.1|448435_449074_+	thymidylate kinase	NA	M1PSC7	Streptococcus_phage	65.2	1.2e-73
VEE11670.1|449070_449964_+	DNA polymerase III subunit delta'	NA	M1NSC1	Streptococcus_phage	56.5	5.8e-82
VEE11672.1|449998_450316_+	initiation-control protein	NA	M1PFV3	Streptococcus_phage	61.0	1.2e-29
VEE11674.1|450318_451185_+	tetrapyrrole methylase family protein	NA	M1PLC5	Streptococcus_phage	72.9	2.3e-112
VEE11676.1|451187_451694_+	methylated DNA-protein cysteine methyltransferase	NA	M1PFU9	Streptococcus_phage	64.6	1.5e-55
VEE11678.1|451713_452067_+	arsenate reductase	NA	M1PLC0	Streptococcus_phage	66.7	2.6e-38
VEE11680.1|452378_453002_+	putative endonuclease III	NA	NA	NA	NA	NA
VEE11682.1|453026_453854_-	putative exodeoxyribonuclease III	NA	M1PSC0	Streptococcus_phage	75.5	2.9e-120
>prophage 2
LR134288	Streptococcus milleri strain NCTC11169 genome assembly, chromosome: 1	1856804	623899	630971	1856804		Escherichia_phage(33.33%)	8	NA	NA
VEE11989.1|623899_624376_+	putative phosphohydrolase	NA	A0A0E3JJF3	Streptomyces_phage	35.6	5.5e-07
VEE11991.1|624525_625221_+	GufA-like protein, putative	NA	NA	NA	NA	NA
VEE11993.1|625421_626291_+	Glucose-1-phosphate thymidylyltransferase	NA	K7QKA7	Escherichia_phage	64.6	2.9e-102
VEE11995.1|626294_626888_+	dTDP-4-keto-6-deoxyglucose-3,5-epimerase	NA	H9NC63	Sphingomonas_phage	33.1	3.9e-10
VEE11997.1|626918_627965_+	dTDP-glucose 4,6-dehydratase	NA	A0A1D7XFE8	Escherichia_phage	40.9	2.3e-61
VEE11999.1|627998_629018_+	UDP-glucose 4-epimerase	NA	A0A2K9L1R4	Tupanvirus	49.1	1.3e-90
VEE12001.1|629324_629915_+	methyltransferase small domain superfamily protein	NA	NA	NA	NA	NA
VEE12003.1|630044_630971_+	putative glycosyl transferase	NA	V5USA4	Oenococcus_phage	46.4	3.3e-72
>prophage 3
LR134288	Streptococcus milleri strain NCTC11169 genome assembly, chromosome: 1	1856804	756760	766122	1856804	protease	Bacillus_phage(57.14%)	9	NA	NA
VEE12233.1|756760_757972_+	putative permease, chloride channel	NA	A0A1X9I5Z9	Streptococcus_phage	51.0	7.3e-96
VEE12235.1|758065_758905_+	thymidylate synthase	NA	U5J9N5	Bacillus_phage	55.4	4.4e-84
VEE12237.1|759089_759602_+	dihydrofolate reductase	NA	A0A1L7N103	Ralstonia_phage	36.0	5.5e-21
VEE12239.1|759602_759776_+	membrane associated protein	NA	NA	NA	NA	NA
VEE12241.1|759813_761046_+|protease	ATP-dependent Clp protease, ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	57.7	1.1e-131
VEE12243.1|761057_761645_+	putative ribosome biogenesis GTP-binding protein YsxC	NA	NA	NA	NA	NA
VEE12245.1|761767_762475_+	putative autolysin/N-acetylmuramidase	NA	Q9ZXE4	Bacillus_phage	42.3	3.3e-16
VEE12247.1|762647_764393_+	putative ATP-binding/permease protein	NA	W8CYL7	Bacillus_phage	30.2	8.4e-45
VEE12249.1|764373_766122_+	putative multidrug ABC transporter permease/ATPase	NA	W8CYL7	Bacillus_phage	30.4	7.6e-54
>prophage 4
LR134288	Streptococcus milleri strain NCTC11169 genome assembly, chromosome: 1	1856804	781843	789374	1856804		Streptococcus_phage(28.57%)	8	NA	NA
VEE12277.1|781843_782266_+	nucleoside diphosphate kinase	NA	D2E8E1	Anguillid_herpesvirus	46.0	1.3e-23
VEE12279.1|782417_783308_+	glmZ(sRNA)-inactivating NTPase	NA	A0A2D1GP35	Streptomyces_phage	33.6	8.5e-09
VEE12281.1|783304_784282_+	transporter	NA	A1IMD5	Streptococcus_phage	84.0	1.6e-157
VEE12283.1|784278_785190_+	cytoplasmic protein	NA	Q7AWZ3	Streptococcus_phage	70.3	2.6e-114
VEE12285.1|785470_785992_+	pyrimidine regulatory protein PyrR	NA	NA	NA	NA	NA
VEE12287.1|785996_787265_+	uracil permease	NA	Q9KX94	Enterobacteria_phage	35.1	2.2e-58
VEE12289.1|787323_788247_+	aspartate carbamoyltransferase catalytic subunit	NA	M1HGA5	Paramecium_bursaria_Chlorella_virus	31.7	6.0e-26
VEE12291.1|788285_789374_+	carbamoyl phosphate synthase small subunit	NA	R4TGJ8	Halovirus	36.7	3.2e-58
>prophage 5
LR134288	Streptococcus milleri strain NCTC11169 genome assembly, chromosome: 1	1856804	1109280	1118762	1856804	integrase	Liberibacter_phage(83.33%)	6	1108194:1108221	1113310:1113337
1108194:1108221	attL	ATTTTGATTTATCGCTCTGTTCTGCAAA	NA	NA	NA	NA
VEE12697.1|1109280_1110249_-|integrase	integrase/recombinase, phage integrase family protein	integrase	A0A2H4JAA2	uncultured_Caudovirales_phage	30.7	6.1e-37
VEE12698.1|1110304_1113220_-	type I site-specific deoxyribonuclease HsdR family protein	NA	A0A220A398	Liberibacter_phage	37.3	1.8e-188
VEE12699.1|1113223_1114297_-	type I restriction-modification system, specificity determinant	NA	A0A240FAT6	Liberibacter_phage	41.2	1.4e-29
1113310:1113337	attR	ATTTTGATTTATCGCTCTGTTCTGCAAA	NA	NA	NA	NA
VEE12700.1|1114296_1114875_-	type I restriction-modification system specificity determinant	NA	A0A240FAT6	Liberibacter_phage	35.4	1.2e-16
VEE12701.1|1114861_1116352_-	Type I restriction-modification system methylation subunit	NA	A0A220A2U5	Liberibacter_phage	53.4	1.1e-133
VEE12702.1|1116341_1118762_-	ADP-ribosylglycohydrolase	NA	A0A220A2U4	Liberibacter_phage	43.4	1.7e-112
>prophage 6
LR134288	Streptococcus milleri strain NCTC11169 genome assembly, chromosome: 1	1856804	1468488	1517831	1856804	tRNA,integrase,transposase	Streptococcus_phage(50.0%)	51	1462787:1462804	1509665:1509682
1462787:1462804	attL	TCTTCAAATTGTTGACGG	NA	NA	NA	NA
VEE13040.1|1468488_1469238_-|tRNA	tRNA pseudouridine synthase A	tRNA	NA	NA	NA	NA
VEE13041.1|1469348_1469834_+	MutT/nudix family protein	NA	NA	NA	NA	NA
VEE13042.1|1469865_1470999_-	chaperone protein DnaJ	NA	A0A1V0SBY2	Catovirus	26.4	8.2e-17
VEE13043.1|1471453_1473286_-	molecular chaperone DnaK	NA	A0A167RF67	Powai_lake_megavirus	46.8	4.6e-134
VEE13044.1|1473498_1474029_-	heat shock protein	NA	NA	NA	NA	NA
VEE13045.1|1474089_1475124_-	heat shock transcription repressor HrcA	NA	NA	NA	NA	NA
VEE13046.1|1475409_1475724_-	PadR family transcriptional regulator	NA	NA	NA	NA	NA
VEE13047.1|1475844_1476534_-	putative phosphoglycerate mutase	NA	NA	NA	NA	NA
VEE13048.1|1476670_1477366_-	putative phosphoglycerate mutase	NA	NA	NA	NA	NA
VEE13049.1|1477567_1478905_-	UPF0210 protein SSU05	NA	NA	NA	NA	NA
VEE13050.1|1478917_1479184_-	ACT domain-containing protein	NA	NA	NA	NA	NA
VEE13051.1|1479714_1480029_-	TfoX N-terminal domain family protein	NA	NA	NA	NA	NA
VEE13052.1|1480685_1483898_+	LPXTG cell wall surface protein, zinc carboxypeptidase family	NA	NA	NA	NA	NA
VEE13053.1|1484142_1484724_+	putative transcriptional regulator, TetR family	NA	NA	NA	NA	NA
VEE13054.1|1485493_1486048_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEE13055.1|1486072_1487902_-	Uncharacterised protein	NA	E4ZFJ9	Streptococcus_phage	28.4	3.1e-66
VEE13056.1|1487910_1490136_-	DNA or RNA helicases of superfamily II-like protein	NA	NA	NA	NA	NA
VEE13057.1|1490132_1492094_-	metyl transferase	NA	A0A2R3ZYF2	Campylobacter_phage	28.4	3.5e-23
VEE13058.1|1492742_1493228_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEE13059.1|1493371_1493692_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEE13060.1|1493691_1494777_+	FtsK/SpoIIIE family	NA	NA	NA	NA	NA
VEE13061.1|1494779_1495376_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEE13062.1|1495511_1496138_+	replication protein	NA	NA	NA	NA	NA
VEE13063.1|1496381_1497431_+|integrase	Phage integrase	integrase	E3W8I1	Leuconostoc_phage	28.5	3.2e-31
VEE13064.1|1498108_1498492_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEE13065.1|1498595_1498949_+	putative lipoprotein	NA	NA	NA	NA	NA
VEE13066.1|1499074_1499671_-	KAP family NTPases	NA	NA	NA	NA	NA
VEE13067.1|1499636_1499795_-	Protein of uncharacterised function (DUF3847)	NA	NA	NA	NA	NA
VEE13068.1|1499916_1500801_-	ketopantoate reductase PanE/ApbA superfamily protein	NA	NA	NA	NA	NA
VEE13069.1|1500963_1501218_-	Protein of uncharacterised function (DUF3847)	NA	NA	NA	NA	NA
VEE13070.1|1501366_1502170_-	Tetracenomycin polyketide synthesis O-methyltransferase tcmP	NA	NA	NA	NA	NA
VEE13071.1|1502219_1502717_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEE13072.1|1502772_1503711_-	Esterase	NA	NA	NA	NA	NA
VEE13073.1|1503749_1504517_-	putative hydrolase protein	NA	NA	NA	NA	NA
VEE13074.1|1504547_1504676_-	UbiE/COQ5 family methyltransferase	NA	NA	NA	NA	NA
VEE13075.1|1504677_1505166_-	UbiE/COQ5 family methyltransferase	NA	NA	NA	NA	NA
VEE13076.1|1505195_1505942_-	putative alpha/beta superfamily hydrolase	NA	NA	NA	NA	NA
VEE13077.1|1506059_1506815_-	KAP family NTPases	NA	NA	NA	NA	NA
VEE13078.1|1507516_1508212_+|transposase	putative transposase	transposase	A0A1S5SBP9	Streptococcus_phage	48.0	1.1e-51
VEE13079.1|1508300_1508825_+|transposase	putative transposase	transposase	A0A1S5SBP9	Streptococcus_phage	61.2	9.0e-51
VEE13080.1|1509014_1509815_-	cobalt transport ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	28.2	3.0e-13
1509665:1509682	attR	CCGTCAACAATTTGAAGA	NA	NA	NA	NA
VEE13081.1|1509801_1510638_-	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
VEE13082.1|1510613_1511408_-	ABC transporter permease	NA	NA	NA	NA	NA
VEE13083.1|1511404_1512007_-	signal transduction histidine kinase, LytS	NA	NA	NA	NA	NA
VEE13084.1|1512326_1512896_-	isomerase PA2770	NA	NA	NA	NA	NA
VEE13085.1|1513036_1513609_+|transposase	transposase	transposase	NA	NA	NA	NA
VEE13086.1|1513986_1514883_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEE13087.1|1515349_1515973_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEE13088.1|1516235_1516394_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEE13089.1|1516522_1517218_+|transposase	putative transposase	transposase	A0A1S5SBP9	Streptococcus_phage	48.0	1.1e-51
VEE13090.1|1517306_1517831_+|transposase	putative transposase	transposase	A0A1S5SBP9	Streptococcus_phage	61.2	9.0e-51
>prophage 7
LR134288	Streptococcus milleri strain NCTC11169 genome assembly, chromosome: 1	1856804	1833222	1842070	1856804		Streptococcus_phage(33.33%)	9	NA	NA
VEE13412.1|1833222_1834062_-	cobalt import ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	33.5	2.3e-16
VEE13413.1|1834046_1834925_-	cobalt import ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.0	2.3e-19
VEE13414.1|1834875_1835415_-	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
VEE13415.1|1835425_1836247_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
VEE13416.1|1836305_1837601_-	putative zinc-dependent peptidase	NA	A0A1E1EST3	Acanthamoeba_castellanii_mimivirus	27.7	9.1e-20
VEE13417.1|1837600_1838848_-	putative zinc-dependent peptidase	NA	A0A1X9I714	Streptococcus_phage	49.8	4.8e-111
VEE13418.1|1839023_1839401_+	Uncharacterized conserved protein	NA	A0A1X9I5V8	Streptococcus_phage	65.3	1.2e-20
VEE13419.1|1839402_1840500_+	DNA replication and repair protein	NA	NA	NA	NA	NA
VEE13420.1|1840588_1842070_-	inosine-5-monophosphate dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	41.3	9.5e-98
