The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
LR134248	Escherichia coli strain NCTC10537 genome assembly, chromosome: 1	4603981	1077432	1090615	4603981	tRNA	Escherichia_phage(50.0%)	12	NA	NA
VED39576.1|1077432_1078194_+	stationary phase survival protein SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.0	3.4e-59
VED39577.1|1078187_1078814_+	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.7	5.7e-36
VED39578.1|1078953_1080093_+	lipoprotein NlpD	NA	D7RWE0	Brochothrix_phage	35.6	1.7e-06
VED39579.1|1080155_1081148_+	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
VED39580.1|1081241_1082606_-	inner membrane permease YgbN	NA	NA	NA	NA	NA
VED39581.1|1082694_1083471_-	hydroxypyruvate isomerase	NA	NA	NA	NA	NA
VED39582.1|1083475_1084114_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
VED39583.1|1084110_1085373_-|tRNA	paral putative tRNA synthase	tRNA	A0A077SLJ7	Escherichia_phage	61.4	4.9e-135
VED39584.1|1085369_1086278_-	oxidoreductase YgbJ	NA	A0A077SLF7	Escherichia_phage	76.5	5.1e-118
VED39585.1|1086473_1087241_+	DeoR family transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	2.5e-70
VED39586.1|1087291_1087948_-	serine/threonine-specific protein phosphatase 2	NA	A0A077SLQ6	Escherichia_phage	46.6	8.6e-51
VED39587.1|1088053_1090615_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	3.0e-30
>prophage 2
LR134248	Escherichia coli strain NCTC10537 genome assembly, chromosome: 1	4603981	1673970	1683412	4603981		Enterobacteria_phage(85.71%)	10	NA	NA
VED40115.1|1673970_1674897_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.8	1.3e-23
VED40116.1|1674901_1675633_+	ABC transporter permease	NA	NA	NA	NA	NA
VED40117.1|1675613_1675721_-	putative inner membrane protein	NA	NA	NA	NA	NA
VED40118.1|1675780_1676512_-	MerR family transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
VED40119.1|1676733_1678419_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
VED40120.1|1678415_1679135_+	two-component response-regulatory protein YehT	NA	NA	NA	NA	NA
VED40121.1|1679181_1679652_+	conserved protein, DUF1456 family	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
VED40122.1|1679692_1680154_-	lipoprotein yehR	NA	Q9EYF5	Enterobacteria_phage	99.3	3.2e-76
VED40123.1|1680278_1682279_-	zinc finger SWIM domain-containing protein	NA	Q9EYF6	Enterobacteria_phage	96.6	0.0e+00
VED40124.1|1682275_1683412_-	von Willebrand factor type A domain protein YehP	NA	Q9EYF7	Enterobacteria_phage	97.4	3.2e-162
>prophage 3
LR134248	Escherichia coli strain NCTC10537 genome assembly, chromosome: 1	4603981	1770538	1779395	4603981		Enterobacteria_phage(42.86%)	8	NA	NA
VED40195.1|1770538_1771933_+	colanic acid biosynthesis protein	NA	A0A291LBB9	Klebsiella_phage	33.5	1.3e-19
VED40196.1|1772107_1773001_+	UTP--glucose-1-phosphate uridylyltransferase subunit GalF	NA	A0A127AW70	Bacillus_phage	42.0	1.0e-46
VED40197.1|1773373_1774459_+	dTDP-D-glucose 4,6-dehydratase rmlB	NA	I7HTA3	Enterobacteria_phage	53.9	3.9e-101
VED40198.1|1774458_1775358_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	34.5	8.2e-28
VED40199.1|1775416_1776295_+	glucose-1-phosphate thymidylyltransferase	NA	I7I009	Enterobacteria_phage	64.1	8.7e-107
VED40200.1|1776299_1776845_+	dTDP-4-dehydrorhamnose 3,5-epimerase (RmlC)	NA	I7HJC4	Enterobacteria_phage	53.9	1.6e-47
VED40201.1|1776848_1778273_+	O-antigen flippase	NA	NA	NA	NA	NA
VED40202.1|1778282_1779395_+	dTDP-N-acetylviosamine synthesis protein VioA	NA	A0A0P0YLZ6	Yellowstone_lake_phycodnavirus	25.7	1.3e-14
>prophage 4
LR134248	Escherichia coli strain NCTC10537 genome assembly, chromosome: 1	4603981	2169685	2222445	4603981	protease,transposase,tail,integrase,lysis	Escherichia_phage(24.24%)	62	2177261:2177277	2208413:2208429
VED40584.1|2169685_2170507_-|protease	putative protease	protease	NA	NA	NA	NA
VED40585.1|2170782_2171091_-	acid shock protein	NA	NA	NA	NA	NA
VED40586.1|2171514_2172768_-	major facilitator superfamily protein	NA	NA	NA	NA	NA
VED40587.1|2172874_2173768_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
VED40588.1|2173902_2175123_+	protein Mlc (making large colonies protein)	NA	NA	NA	NA	NA
VED40589.1|2175247_2175943_+	dithiobiotin synthetase	NA	NA	NA	NA	NA
VED40590.1|2175895_2177152_-	voltage-gated ClC-type chloride channel	NA	NA	NA	NA	NA
2177261:2177277	attL	CTTTAAGAGATAAAAAA	NA	NA	NA	NA
VED40591.1|2177346_2177961_-	anaerobic dimethyl sulfoxide reductase maturation protein (twin-arginine leader-binding protein)	NA	A0A077SLS7	Escherichia_phage	36.3	8.7e-29
VED40592.1|2178003_2178858_-	putative dimethyl sulfoxide reductase, anchor subunit	NA	NA	NA	NA	NA
VED40593.1|2178859_2179477_-	anaerobic dimethyl sulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
VED40594.1|2179487_2181884_-	putative dimethyl sulfoxide reductase, olydopterin dinucleotide binding subunit	NA	A0A077SK27	Escherichia_phage	48.6	4.8e-208
VED40595.1|2181971_2184398_-	putative dimethyl sulfoxide reductase, oxidoreductase subunit	NA	A0A077SK27	Escherichia_phage	49.0	5.0e-213
VED40596.1|2184596_2184902_-	protein	NA	NA	NA	NA	NA
VED40597.1|2184973_2185720_+	lipoprotein	NA	NA	NA	NA	NA
VED40598.1|2185722_2186283_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
VED40599.1|2186317_2186659_-	protein	NA	NA	NA	NA	NA
VED40600.1|2186793_2187120_+	inner membrane protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
VED40601.1|2187325_2188540_+	starvation sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
VED40602.1|2188551_2189571_+	dehydrogenase	NA	E3SJ82	Synechococcus_phage	26.2	4.3e-17
VED40603.1|2190063_2190552_-|integrase	defective integrase; Qin prophage	integrase	Q859D2	Escherichia_coli_phage	59.6	2.0e-52
VED40604.1|2190910_2191039_-|integrase	defective integrase; Qin prophage	integrase	S4TSP2	Salmonella_phage	83.3	4.4e-12
VED40605.1|2191073_2191310_-	putative excisionase	NA	S4TND0	Salmonella_phage	50.7	6.1e-15
VED40606.1|2191397_2193869_-	putative exonuclease from phage origin	NA	A0A192Y6E0	Salmonella_phage	57.2	5.0e-59
VED40607.1|2193962_2194154_-	putative prophage protein	NA	NA	NA	NA	NA
VED40608.1|2194150_2194339_-	division inhibition protein	NA	NA	NA	NA	NA
VED40609.1|2194841_2195042_+	Uncharacterised protein	NA	NA	NA	NA	NA
VED40610.1|2195010_2195376_-	ybl81	NA	NA	NA	NA	NA
VED40611.1|2195387_2195540_-	ydfA	NA	M4QQ57	Salicola_phage	53.2	6.6e-07
VED40612.1|2195708_2196116_-	transcriptional repressor DicA	NA	I6PD69	Cronobacter_phage	51.9	7.2e-32
VED40613.1|2196196_2196424_+	DNA-binding transcriptional regulator DicC	NA	NA	NA	NA	NA
VED40614.1|2196407_2196929_+	YdfX	NA	NA	NA	NA	NA
VED40615.1|2196909_2197875_+	ybl78	NA	U5P0A0	Shigella_phage	60.2	5.0e-55
VED40616.1|2197915_2198338_+	putative prophage protein	NA	A0A0U2QQN3	Escherichia_phage	92.8	2.3e-65
VED40617.1|2198334_2198568_+	methyltransferase	NA	I6S1S6	Salmonella_phage	67.9	2.9e-17
VED40618.1|2198621_2199287_+	putative prophage protein	NA	NA	NA	NA	NA
VED40619.1|2200271_2200523_+	putative prophage protein	NA	NA	NA	NA	NA
VED40620.1|2200869_2201520_+	putative prophage protein	NA	Q8SBE5	Shigella_phage	70.3	2.6e-68
VED40621.1|2201537_2201915_+	putative antitermination protein Q-like protein; DLP12 prophage	NA	Q777W5	Enterobacteria_phage	82.5	1.8e-53
VED40622.1|2202070_2202595_-	lipoprotein	NA	A0A1W6JNX6	Morganella_phage	52.9	1.0e-46
VED40623.1|2202787_2202937_+	Uncharacterized conserved protein	NA	NA	NA	NA	NA
VED40624.1|2202964_2203831_-|transposase	IS3 element transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	2.3e-51
VED40625.1|2203827_2204127_-|transposase	transposase	transposase	NA	NA	NA	NA
VED40626.1|2204255_2205008_+	putative pathogenicity island protein	NA	NA	NA	NA	NA
VED40627.1|2205559_2206129_+	putative AraC-type regulatory protein encoded in prophage	NA	NA	NA	NA	NA
VED40628.1|2206319_2206535_+|lysis	lysis protein S from lambdoid prophage	lysis	A5LH82	Enterobacteria_phage	94.4	2.9e-32
VED40629.1|2206539_2207004_+	putative prophage protein	NA	Q08JA0	Stx2-converting_phage	62.5	8.0e-35
VED40630.1|2207039_2207300_-	Uncharacterised protein	NA	NA	NA	NA	NA
VED40631.1|2207413_2207947_+	prophage lysozyme (endolysin)	NA	K7PLY1	Enterobacteria_phage	93.8	1.4e-96
VED40632.1|2207943_2208441_+	Qin prophage protein	NA	NA	NA	NA	NA
2208413:2208429	attR	CTTTAAGAGATAAAAAA	NA	NA	NA	NA
VED40633.1|2209691_2209865_+	GnsA/GnsB family transcriptional regulator	NA	NA	NA	NA	NA
VED40634.1|2210160_2210367_+	DLP12 prophage; predicted protein	NA	A0A0K2FJ18	Enterobacteria_phage	79.4	3.4e-22
VED40635.1|2210520_2211387_-|transposase	IS3 element transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	2.3e-51
VED40636.1|2211383_2211683_-|transposase	transposase	transposase	NA	NA	NA	NA
VED40637.1|2211732_2213052_+|tail	putative tail component of prophage	tail	Q9EYE7	Enterobacteria_phage	96.3	5.8e-240
VED40638.1|2213118_2213718_+	membrane protein, Lom/All family	NA	A0A291AWV3	Escherichia_phage	96.0	4.5e-107
VED40639.1|2213782_2216161_+|tail	putative tail fiber protein	tail	A0A0E3M194	Enterobacteria_phage	55.8	3.4e-137
VED40640.1|2216160_2216442_+	putative prophage protein	NA	A0A1X7QHA1	Escherichia_phage	47.8	4.5e-17
VED40641.1|2216451_2217156_+	putative prophage protein	NA	A0A1X7QGH6	Escherichia_phage	62.3	5.4e-59
VED40642.1|2217687_2218278_-	putative DNA-invertase	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
VED40643.1|2218593_2218827_-	Qin prophage DNA-binding transcriptional regulator	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
VED40644.1|2219612_2220896_+	metabolite transport protein YdfJ	NA	NA	NA	NA	NA
VED40645.1|2220984_2222445_+	putative sugar dehydrogenase	NA	G8DCZ3	Micromonas_pusilla_virus	29.3	2.8e-41
>prophage 5
LR134248	Escherichia coli strain NCTC10537 genome assembly, chromosome: 1	4603981	2344693	2376969	4603981	transposase	Escherichia_phage(28.57%)	29	NA	NA
VED40760.1|2344693_2345842_-|transposase	transposase	transposase	A0A1W6JP07	Morganella_phage	97.1	1.2e-204
VED40761.1|2345909_2346197_+|transposase	transposase, C-ter fragment, truncated protein	transposase	A0A1S5RHE3	Helicobacter_phage	66.7	3.1e-29
VED40762.1|2346433_2347102_-	putative lipoprotein	NA	NA	NA	NA	NA
VED40763.1|2347404_2347998_-	tellurite resistance protein	NA	NA	NA	NA	NA
VED40764.1|2347994_2348987_-	potassium-tellurite ethidium and proflavin transporter	NA	NA	NA	NA	NA
VED40765.1|2349110_2350091_+	putative transferase	NA	NA	NA	NA	NA
VED40766.1|2350082_2350622_-	ribosomal-protein-serine acetyltransferase	NA	NA	NA	NA	NA
VED40767.1|2350684_2350909_-	protein	NA	NA	NA	NA	NA
VED40768.1|2351048_2352668_-	glucans biosynthesis protein D	NA	NA	NA	NA	NA
VED40769.1|2352928_2354272_-	putative cytoplasmic protein	NA	NA	NA	NA	NA
VED40770.1|2354488_2355412_+	transcriptional regulator	NA	NA	NA	NA	NA
VED40771.1|2355449_2357090_-	methyl-accepting chemotaxis protein III (ribose an galactose chemoreceptor protein)	NA	NA	NA	NA	NA
VED40772.1|2357713_2357884_-	Uncharacterised protein	NA	A0A0R6PKG1	Moraxella_phage	68.2	2.8e-06
VED40773.1|2358128_2358659_-	cytochrome b561	NA	A0A0U2QLA7	Escherichia_phage	44.9	3.1e-19
VED40774.1|2358757_2359135_-|transposase	IS1 transposase	transposase	Q71TF0	Escherichia_phage	100.0	1.3e-67
VED40775.1|2359179_2359455_-|transposase	IS1 transposase	transposase	NA	NA	NA	NA
VED40776.1|2359624_2360626_+	glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
VED40777.1|2360667_2362107_-	aldehyde dehydrogenase A	NA	NA	NA	NA	NA
VED40778.1|2362303_2363104_-	conserved SAM-binding protein, DUF218 family	NA	NA	NA	NA	NA
VED40779.1|2363375_2367278_-	ATP-dependent helicase HrpA	NA	A0A1V0SIV3	Klosneuvirus	29.4	8.4e-53
VED40780.1|2367478_2368084_+	FMN-dependent NADH-azoreductase	NA	NA	NA	NA	NA
VED40781.1|2368134_2369451_-	Putative enzyme YnbD	NA	NA	NA	NA	NA
VED40782.1|2369440_2371198_-	putative hydrolase	NA	NA	NA	NA	NA
VED40783.1|2371213_2372110_-	membrane associated CTP-phosphosubstrate transferase	NA	NA	NA	NA	NA
VED40784.1|2372109_2372715_-	phosphatidylglycerophosphate synthase	NA	NA	NA	NA	NA
VED40785.1|2372885_2375192_-	protein involved in detoxification of methylglyoxal	NA	NA	NA	NA	NA
VED40786.1|2375255_2375789_-	oxidoreductase, NAD(P)-binding	NA	NA	NA	NA	NA
VED40787.1|2375806_2376673_-|transposase	IS3 element transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	2.3e-51
VED40788.1|2376669_2376969_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 6
LR134248	Escherichia coli strain NCTC10537 genome assembly, chromosome: 1	4603981	2391171	2415938	4603981	integrase,lysis,tail,tRNA	Escherichia_phage(39.13%)	29	2398928:2398943	2421540:2421555
VED40800.1|2391171_2392305_+	outer membrane protein N (porin)	NA	Q1MVN1	Enterobacteria_phage	58.8	8.3e-118
VED40801.1|2392445_2392880_+	putative universal stress protein	NA	A0A1W6JNV4	Morganella_phage	52.8	1.8e-28
VED40802.1|2393840_2394074_+	Qin prophage DNA-binding transcriptional regulator	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
VED40803.1|2394390_2394981_+	putative DNA-invertase	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
VED40804.1|2395514_2395793_-	putative prophage protein	NA	A0A0E3JSQ1	Enterobacteria_phage	55.4	2.9e-24
VED40805.1|2395789_2398015_-|tail	Putative phage tail fiber protein	tail	A0A0E3M0V5	Enterobacteria_phage	72.3	3.6e-181
VED40806.1|2398113_2398878_-	Uncharacterised protein	NA	G8C7P6	Escherichia_phage	66.5	3.9e-87
2398928:2398943	attL	ATCGCAGCAATAAAAA	NA	NA	NA	NA
VED40807.1|2398982_2399414_-	ParB domain protein nuclease	NA	A0A0R6PD10	Moraxella_phage	58.7	3.3e-19
VED40808.1|2399551_2400976_-	Rac prophage; potassium transporter subunit	NA	NA	NA	NA	NA
VED40809.1|2401146_2401611_-|lysis	lysis protein	lysis	A0A0K2FJD0	Enterobacteria_phage	92.8	1.7e-69
VED40810.1|2401607_2402141_-	membrane-associated lysozyme; Qin prophage	NA	K7PLY1	Enterobacteria_phage	96.0	4.8e-100
VED40811.1|2402246_2402519_+	ybl58	NA	NA	NA	NA	NA
VED40812.1|2402484_2402829_-	putative prophage protein	NA	K7PGU6	Enterobacteria_phage	94.0	1.4e-36
VED40813.1|2403044_2403179_+	ydaG	NA	NA	NA	NA	NA
VED40815.1|2403189_2403345_+	Rac prophage; predicted protein	NA	M4QQ57	Salicola_phage	55.3	6.1e-08
VED40816.1|2403341_2403953_-	prophage CP-933R superinfection exclusion protein	NA	NA	NA	NA	NA
VED40818.1|2404271_2404493_+	FtsZ inhibitor protein	NA	A0A0U2RTC4	Escherichia_phage	98.6	2.0e-36
VED40820.1|2404492_2404663_+	Rac prophage; zinc-binding protein	NA	A0A0U2SHB5	Escherichia_phage	71.4	3.6e-17
VED40822.1|2404737_2405013_+	putative bacteriophage protein	NA	A0A0U2QW85	Escherichia_phage	96.7	1.4e-42
VED40824.1|2405114_2407715_+	exonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	63.6	7.9e-249
VED40826.1|2407707_2408517_+	recombination and repair protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	8.8e-106
VED40828.1|2408760_2408970_+	gydaC	NA	A0A0U2QL97	Escherichia_phage	98.4	6.1e-27
VED40829.1|2409048_2409264_+	excisionase	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
VED40831.1|2409265_2410501_+|integrase	phage integrase	integrase	A0A0U2JGI6	Escherichia_phage	98.5	1.6e-239
VED40833.1|2410552_2411488_+|tRNA	C32 tRNA thiolase	tRNA	A0A0U2S5Z2	Escherichia_phage	98.8	5.9e-146
VED40835.1|2411616_2412990_-	ATP-independent RNA helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
VED40836.1|2413019_2413193_-	Uncharacterised protein	NA	NA	NA	NA	NA
VED40838.1|2413467_2414451_-	zinc transport protein	NA	NA	NA	NA	NA
VED40840.1|2414705_2415938_+	putative signaling protein	NA	A0A127AWB9	Bacillus_phage	35.0	3.1e-17
2421540:2421555	attR	TTTTTATTGCTGCGAT	NA	NA	NA	NA
>prophage 7
LR134248	Escherichia coli strain NCTC10537 genome assembly, chromosome: 1	4603981	2861859	2927711	4603981	protease,portal,capsid,plate,tail,tRNA	Salmonella_phage(32.35%)	65	NA	NA
VED41686.1|2861859_2863152_-|tRNA	seryl-tRNA synthetase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.2	1.5e-94
VED41688.1|2863242_2864586_-	putative ATPase	NA	G3MBE0	Bacillus_virus	40.8	2.1e-80
VED41690.1|2864596_2865208_-	outer-membrane lipoprotein carrier protein	NA	NA	NA	NA	NA
VED41692.1|2865362_2869391_-	cell division protein FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	1.2e-86
VED41694.1|2869525_2870020_-	leucine-responsive transcriptional regulator	NA	NA	NA	NA	NA
VED41696.1|2870564_2871530_+	thioredoxin reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	8.5e-63
VED41698.1|2871652_2873419_+	ABC transporter ATP-binding protein/permease	NA	W8CYL7	Bacillus_phage	24.3	7.0e-23
VED41700.1|2873419_2875141_+	ABC transporter ATP-binding protein/permease	NA	W8CYL7	Bacillus_phage	25.2	2.9e-21
VED41702.1|2875182_2875887_+|tRNA	leucyl/phenylalanyl-tRNA-protein transferase	tRNA	NA	NA	NA	NA
VED41704.1|2876171_2876390_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
VED41706.1|2877427_2879704_-|protease	ATP-dependent Clp protease ATP-binding subunit	protease	A0A223W0B1	Agrobacterium_phage	42.5	2.5e-166
VED41708.1|2879734_2880055_-|protease	ATP-dependent Clp protease adaptor protein	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
VED41710.1|2880377_2880602_+	stationary phase/starvation inducible regulatory protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	2.3e-16
VED41712.1|2880674_2882621_-	macrolide export ATP-binding/permease protein	NA	G9BWD6	Planktothrix_phage	40.1	1.1e-37
VED41714.1|2882617_2883733_-	macrolide-specific efflux protein	NA	NA	NA	NA	NA
VED41716.1|2883847_2884840_+	virulence protein	NA	NA	NA	NA	NA
VED41718.1|2884836_2886495_-	nucleoside triphosphate hydrolase domain	NA	NA	NA	NA	NA
VED41720.1|2886919_2887615_+	aquaporin Z	NA	NA	NA	NA	NA
VED41722.1|2888109_2889009_+	transporter	NA	NA	NA	NA	NA
VED41724.1|2889152_2890805_+	hydroxylamine reductase	NA	NA	NA	NA	NA
VED41726.1|2890816_2891785_+	HCP oxidoreductase, NADH-dependent	NA	NA	NA	NA	NA
VED41728.1|2891917_2893636_+	pyruvate oxidase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	24.0	2.3e-31
VED41730.1|2893672_2894674_+	low specificity L-threonine aldolase	NA	NA	NA	NA	NA
VED41732.1|2894684_2896115_+	NAD(P)-binding Rossmann-fold domain	NA	NA	NA	NA	NA
VED41734.1|2896213_2897227_+	nucleotide di-P-sugar epimerase or dehydratase	NA	NA	NA	NA	NA
VED41736.1|2897223_2898054_-	putative N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0UZW5	Roseobacter_phage	30.0	5.7e-07
VED41738.1|2898050_2898374_-	conserved protein, UPF0145 family	NA	NA	NA	NA	NA
VED41740.1|2898499_2899015_+	lipoprotein	NA	NA	NA	NA	NA
VED41742.1|2899232_2899961_+	arginine transport system ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.7	6.0e-29
VED41744.1|2899978_2900710_+	arginine ABC transporter, substrate-binding protein	NA	NA	NA	NA	NA
VED41746.1|2900716_2901433_+	arginine transport system permease	NA	NA	NA	NA	NA
VED41748.1|2901432_2902101_+	arginine ABC transporter permease	NA	NA	NA	NA	NA
VED41750.1|2902391_2902502_+	arginine/ornithine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
VED41752.1|2902649_2902922_+	arginine/ornithine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
VED41754.1|2903316_2904444_-	23S rRNA (uracil-5-)-methyltransferase	NA	A0A1X9I6F4	Streptococcus_phage	27.0	6.0e-28
VED41756.1|2904484_2904973_-	inner membrane protein	NA	NA	NA	NA	NA
VED41758.1|2905032_2905878_-	putrescine ABC transporter membrane protein	NA	NA	NA	NA	NA
VED41760.1|2905874_2906828_-	putrescine ABC transporter membrane protein	NA	NA	NA	NA	NA
VED41762.1|2906837_2907971_-	putrescine ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.0	1.4e-29
VED41764.1|2908065_2909178_-	putrescine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
VED41766.1|2909528_2910005_-	TPR repeat-containing protein	NA	NA	NA	NA	NA
VED41768.1|2910092_2910995_-	ribosomal protein S6 modification protein	NA	I3ULC9	Synechococcus_phage	34.4	2.6e-37
VED41770.1|2911055_2911778_-	nitroreductase NfsA	NA	NA	NA	NA	NA
VED41772.1|2911761_2912049_-	inner membrane protein	NA	NA	NA	NA	NA
VED41774.1|2912208_2912466_+	glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	61.9	8.6e-23
VED41776.1|2912495_2912873_-	inner membrane protein YbjM	NA	NA	NA	NA	NA
VED41778.1|2913142_2914828_+	putative transport protein with two RCK domains	NA	NA	NA	NA	NA
VED41780.1|2915063_2915282_-	prophage P2 OGR-like protein	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
VED41782.1|2915372_2915741_-	regulator of late gene expression	NA	A0A1S6KZZ5	Salmonella_phage	94.6	1.4e-53
VED41784.1|2915737_2916013_-	ybl51	NA	M1T2R9	Escherichia_phage	92.5	2.1e-35
VED41786.1|2916043_2916583_+	ybl50	NA	A0A0F7LCR3	Escherichia_phage	62.5	1.5e-56
VED41788.1|2916582_2917185_+|tail	e14 prophage tail fiber assembly protein	tail	M1SV83	Escherichia_phage	89.5	2.3e-98
VED41790.1|2917156_2917594_-	ybl48	NA	A0A0F7LDZ0	Escherichia_phage	75.0	1.7e-55
VED41792.1|2917595_2919218_-	ybl47	NA	M1TAS6	Escherichia_phage	78.5	6.2e-151
VED41794.1|2919214_2919820_-|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	93.0	2.3e-111
VED41796.1|2919812_2920721_-|plate	Baseplate assembly protein GpJ	plate	A0A1S6KZY6	Salmonella_phage	91.1	4.1e-144
VED41798.1|2920707_2921067_-	GPW/gp25 family protein	NA	A0A1S6KZZ4	Salmonella_phage	85.7	8.0e-51
VED41800.1|2921063_2921642_-|plate	phage baseplate assembly protein V	plate	A0A1S6KZX7	Salmonella_phage	85.9	3.6e-93
VED41802.1|2921745_2922552_+	ybl42	NA	NA	NA	NA	NA
VED41804.1|2922493_2922940_-|tail	phage tail protein	tail	A0A1S6L001	Salmonella_phage	83.7	7.6e-59
VED41806.1|2922932_2923364_-|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	93.0	3.8e-71
VED41808.1|2923459_2923888_-	regulatory protein	NA	E5G6N2	Salmonella_phage	88.7	8.1e-58
VED41810.1|2924024_2924777_-|capsid	capsid scaffolding	capsid	A0A1S6KZW9	Salmonella_phage	94.7	3.1e-113
VED41812.1|2924919_2926686_+	Terminase, ATPase subunit	NA	A0A1S6KZW3	Salmonella_phage	99.1	0.0e+00
VED41814.1|2926685_2927711_+|capsid,portal	capsid portal protein	capsid,portal	A0A1S6KZW5	Salmonella_phage	86.7	7.6e-171
>prophage 8
LR134248	Escherichia coli strain NCTC10537 genome assembly, chromosome: 1	4603981	2930777	2938537	4603981	integrase	Salmonella_phage(83.33%)	13	2931521:2931535	2942259:2942273
VED41822.1|2930777_2931011_-	Prophage protein	NA	E5G6M1	Salmonella_phage	100.0	4.7e-36
VED41824.1|2931021_2931210_-	Uncharacterised protein	NA	E5G6M0	Salmonella_phage	96.8	1.6e-26
VED41826.1|2931362_2933777_-	putative replication protein for prophage	NA	E5G6L9	Salmonella_phage	96.3	0.0e+00
2931521:2931535	attL	GCTGTCGCTGATGGT	NA	NA	NA	NA
VED41828.1|2933773_2934631_-	site-specific DNA-methyltransferase	NA	E5G6L8	Salmonella_phage	92.6	5.4e-154
VED41830.1|2934627_2934855_-	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	98.7	3.5e-36
VED41832.1|2934854_2935088_-	Protein of uncharacterised function (DUF2732)	NA	E5G6L6	Salmonella_phage	97.4	1.1e-32
VED41833.1|2935155_2935497_-	Uncharacterised protein	NA	E5G6L5	Salmonella_phage	98.2	1.3e-55
VED41835.1|2935460_2935661_-	Protein of uncharacterised function (DUF2724)	NA	E5G6L4	Salmonella_phage	98.5	7.1e-33
VED41837.1|2935668_2936178_-	phage regulatory protein CII	NA	E5G6L3	Salmonella_phage	98.8	5.8e-87
VED41839.1|2936210_2936432_-	ybl30	NA	NA	NA	NA	NA
VED41841.1|2936557_2937127_+	repressor protein	NA	A0A1S6KZZ7	Salmonella_phage	43.4	3.8e-39
VED41843.1|2937142_2937334_+	Uncharacterised protein	NA	A0A0R6PIH8	Moraxella_phage	68.2	4.0e-09
VED41845.1|2937520_2938537_+|integrase	integrase	integrase	A0A218M4I3	Erwinia_phage	56.7	3.2e-105
2942259:2942273	attR	ACCATCAGCGACAGC	NA	NA	NA	NA
>prophage 9
LR134248	Escherichia coli strain NCTC10537 genome assembly, chromosome: 1	4603981	3017789	3031721	4603981	integrase,terminase,tail	Escherichia_phage(33.33%)	17	3019705:3019719	3031795:3031809
VED41989.1|3017789_3019079_+	adenosylmethionine-8-amino-7-oxononanoate aminotransferase	NA	A0A1V0SKB7	Klosneuvirus	27.1	3.4e-19
VED41991.1|3019137_3019614_+	putative phosphatidylethanolamine-binding protein	NA	NA	NA	NA	NA
3019705:3019719	attL	TTAGTATAAAAAAGC	NA	NA	NA	NA
VED41993.1|3020397_3021543_+	acyltransferase	NA	A0A2H4JA46	uncultured_Caudovirales_phage	29.9	1.6e-20
VED41995.1|3021580_3022483_-	Uncharacterised protein	NA	A0A2D2W3A0	Escherichia_phage	54.4	3.5e-87
VED41997.1|3023310_3024336_+	acyltransferase	NA	G9L6E5	Escherichia_phage	28.9	2.4e-15
VED41999.1|3024377_3024773_-|tail	putative tail fiber assembly protein (possibly partial)	tail	A0A0M4S6V4	Salmonella_phage	36.6	1.6e-12
VED42000.1|3024772_3025258_-	Uncharacterised protein	NA	NA	NA	NA	NA
VED42002.1|3025280_3026042_-	putative bacteriophage protein	NA	A0A0M4S6U1	Salmonella_phage	93.7	6.3e-138
VED42004.1|3026041_3027664_-	putative phage gp33 TerL	NA	A0A0M5M1R6	Salmonella_phage	95.4	0.0e+00
VED42006.1|3027666_3028218_-|terminase	terminase, small subunit	terminase	G0ZND3	Cronobacter_phage	69.8	7.2e-67
VED42008.1|3028237_3028786_+	Uncharacterised protein	NA	NA	NA	NA	NA
VED42010.1|3028735_3028861_-	Uncharacterised protein	NA	NA	NA	NA	NA
VED42012.1|3028915_3029095_+	Uncharacterised protein	NA	NA	NA	NA	NA
VED42014.1|3029613_3029898_+	Uncharacterised protein	NA	G9L657	Escherichia_phage	94.7	3.2e-47
VED42016.1|3029890_3030175_+	phage related protein	NA	A0A2D1GLL3	Escherichia_phage	100.0	1.8e-50
VED42018.1|3030247_3030415_+	Uncharacterised protein	NA	A0A0K2FJ46	Enterobacteria_phage	96.4	2.9e-27
VED42020.1|3030650_3031721_+|integrase	putative integrase	integrase	K7P6P6	Enterobacteria_phage	100.0	3.9e-202
3031795:3031809	attR	TTAGTATAAAAAAGC	NA	NA	NA	NA
>prophage 10
LR134248	Escherichia coli strain NCTC10537 genome assembly, chromosome: 1	4603981	3145234	3200539	4603981	protease,transposase,tRNA	Macacine_betaherpesvirus(16.67%)	59	NA	NA
VED42223.1|3145234_3145702_+|protease	metalloprotease	protease	NA	NA	NA	NA
VED42225.1|3145791_3146670_+	magnesium and cobalt efflux protein	NA	NA	NA	NA	NA
VED42227.1|3146694_3148233_+	apolipoprotein N-acyltransferase	NA	NA	NA	NA	NA
VED42228.1|3148359_3150237_-	outer membrane protein	NA	NA	NA	NA	NA
VED42230.1|3151769_3152510_+	glutamate/aspartate transport system permease	NA	NA	NA	NA	NA
VED42232.1|3152509_3153184_+	glutamate/aspartate ABC transporter, permease protein	NA	NA	NA	NA	NA
VED42234.1|3153183_3153570_+	glutamate/aspartate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.4	2.1e-09
VED42236.1|3153566_3154418_-	IS150 protein InsAB	NA	A0A2I6AZV9	Macacine_betaherpesvirus	100.0	7.8e-113
VED42238.1|3154414_3154936_-|transposase	transposase subunit	transposase	A0A2I6AZV8	Macacine_betaherpesvirus	100.0	2.7e-92
VED42240.1|3155100_3155355_+	glutamate/aspartate ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
VED42242.1|3155472_3156408_+	pyrimidine-specific ribonucleoside hydrolase (cytidine/uridine-specific hydrolase)	NA	NA	NA	NA	NA
VED42244.1|3156491_3158162_+	chaperone protein	NA	E5ESM6	Bathycoccus_sp._RCC1105_virus	32.7	8.0e-77
VED42246.1|3158221_3159361_-	Hsc56 co-chaperone of HscC	NA	NA	NA	NA	NA
VED42248.1|3159510_3159672_-	DnaJ-class chaperone	NA	NA	NA	NA	NA
VED42250.1|3159668_3160376_-	protein	NA	NA	NA	NA	NA
VED42252.1|3160539_3161052_+	Sel1 domain protein repeat-containing protein	NA	NA	NA	NA	NA
VED42254.1|3161124_3161517_+	Sel1 domain-containing protein	NA	NA	NA	NA	NA
VED42256.1|3161586_3162069_-	putative alpha helical protein	NA	NA	NA	NA	NA
VED42258.1|3162303_3164886_+|tRNA	leucyl-tRNA synthetase	tRNA	A0A2H4PQS0	Staphylococcus_phage	42.2	2.3e-184
VED42260.1|3164900_3165482_+	rare lipoprotein B	NA	NA	NA	NA	NA
VED42262.1|3165481_3166513_+	DNA polymerase III subunit delta	NA	NA	NA	NA	NA
VED42264.1|3166514_3167156_+	nicotinic acid mononucleotide adenylyltransferase	NA	NA	NA	NA	NA
VED42266.1|3167179_3167791_+	alpha-ribazole-5'-phosphate phosphatase	NA	NA	NA	NA	NA
VED42268.1|3168050_3168368_+	putative ACR	NA	NA	NA	NA	NA
VED42270.1|3168371_3168839_+	putative cytoplasmic protein YbeA	NA	NA	NA	NA	NA
VED42272.1|3168869_3170771_+	penicillin-binding protein 2	NA	NA	NA	NA	NA
VED42274.1|3170773_3171886_+	rod shape-determining protein RodA	NA	NA	NA	NA	NA
VED42276.1|3171896_3172985_+	rare lipoprotein A	NA	F5B3X9	Synechococcus_phage	53.2	3.6e-09
VED42278.1|3173124_3174336_+	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	47.4	1.2e-101
VED42280.1|3174445_3174709_+	protein YbeD	NA	NA	NA	NA	NA
VED42282.1|3174809_3175451_+	lipoate-protein ligase B	NA	NA	NA	NA	NA
VED42284.1|3175709_3176663_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
VED42286.1|3176871_3177837_+	lipoyl synthase LipA	NA	NA	NA	NA	NA
VED42288.1|3177937_3178141_-	Sec-independent protein translocase protein	NA	NA	NA	NA	NA
VED42290.1|3178269_3179058_-	amidase	NA	NA	NA	NA	NA
VED42292.1|3179150_3179534_+	protein CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	53.6	6.8e-24
VED42294.1|3179966_3180527_-	subunit of palmitoyl transferase for Lipid A	NA	NA	NA	NA	NA
VED42296.1|3181114_3182500_+	C4-dicarboxylate transporter DcuC	NA	NA	NA	NA	NA
VED42298.1|3182540_3183221_-	two-component response regulator	NA	NA	NA	NA	NA
VED42300.1|3183189_3184848_-	sensor kinase dpiB	NA	NA	NA	NA	NA
VED42302.1|3184980_3185256_+|transposase	IS1 transposase	transposase	NA	NA	NA	NA
VED42304.1|3185300_3185678_+|transposase	IS1 transposase	transposase	Q71TF0	Escherichia_phage	99.2	2.2e-67
VED42306.1|3185763_3186822_+	citrate lyase synthetase	NA	NA	NA	NA	NA
VED42308.1|3186836_3187133_+	citrate lyase acyl carrier protein (citrate lyase gamma chain)	NA	NA	NA	NA	NA
VED42310.1|3187129_3188038_+	citrate lyase subunit beta	NA	NA	NA	NA	NA
VED42312.1|3188048_3189581_+	citrate lyase subunit alpha	NA	NA	NA	NA	NA
VED42314.1|3189584_3190136_+	apo-citrate lyase phosphoribosyl-dephospho-CoA transferase	NA	NA	NA	NA	NA
VED42316.1|3190110_3190989_+	2-(5''-triphosphoribosyl)-3'-dephosphocoenzyme-A synthase	NA	NA	NA	NA	NA
VED42318.1|3191039_3192503_+	citrate carrier	NA	NA	NA	NA	NA
VED42320.1|3192616_3193423_+	ribonuclease I	NA	NA	NA	NA	NA
VED42322.1|3193652_3194063_+	regulator of nucleoside diphosphate kinase	NA	NA	NA	NA	NA
VED42324.1|3194200_3194290_+	Uncharacterised protein	NA	NA	NA	NA	NA
VED42326.1|3194293_3195532_-	oxidoreductase, Zn-dependent and NAD(P)-binding	NA	NA	NA	NA	NA
VED42328.1|3195752_3196181_+	universal stress protein UspG	NA	A0A1W6JNV4	Morganella_phage	39.2	1.1e-19
VED42330.1|3196301_3197897_-	alkyl hydroperoxide reductase	NA	G3MA85	Bacillus_virus	34.3	2.2e-44
VED42332.1|3198111_3198675_-	alkyl hydroperoxide reductase subunit C	NA	NA	NA	NA	NA
VED42335.1|3199046_3199808_+	disulfide isomerase/thiol-disulfide oxidase	NA	NA	NA	NA	NA
VED42337.1|3199841_3200117_+|transposase	IS1 transposase	transposase	NA	NA	NA	NA
VED42339.1|3200161_3200539_+|transposase	IS1 transposase	transposase	Q71TF0	Escherichia_phage	99.2	2.2e-67
>prophage 11
LR134248	Escherichia coli strain NCTC10537 genome assembly, chromosome: 1	4603981	3227623	3282743	4603981	protease,integrase,tail,transposase,lysis	Enterobacteria_phage(43.75%)	61	3258217:3258263	3282757:3282803
VED42386.1|3227623_3227764_-|transposase	transposase	transposase	NA	NA	NA	NA
VED42388.1|3227786_3228899_-|transposase	IS186, transposase	transposase	NA	NA	NA	NA
VED42390.1|3228975_3229128_-	Hok/gef cell toxic protein	NA	NA	NA	NA	NA
VED42392.1|3229403_3229679_+|transposase	IS1 transposase	transposase	NA	NA	NA	NA
VED42394.1|3229723_3230101_+|transposase	IS1 transposase	transposase	Q71TF0	Escherichia_phage	100.0	1.3e-67
VED42396.1|3230035_3230611_-	IS150 conserved protein InsB	NA	A0A1B1P773	Bacillus_phage	49.0	2.1e-40
VED42398.1|3230607_3231129_-|transposase	transposase subunit	transposase	A0A2I6AZV8	Macacine_betaherpesvirus	100.0	2.7e-92
VED42400.1|3231397_3232516_+	carboxylate-amine ligase	NA	NA	NA	NA	NA
VED42402.1|3232581_3232830_+	membrane protein YbdJ	NA	NA	NA	NA	NA
VED42404.1|3232894_3233263_+	putative cytoplasmic protein YjbR	NA	NA	NA	NA	NA
VED42406.1|3233356_3234010_+	oxygen-insensitive NAD(P)H nitroreductase	NA	NA	NA	NA	NA
VED42408.1|3234117_3235365_+	putative mechanosensitive ion channel protein	NA	NA	NA	NA	NA
VED42410.1|3235432_3236809_-	phenylalanine transporter	NA	NA	NA	NA	NA
VED42412.1|3236910_3240054_-	cation efflux system protein	NA	S5VTK5	Leptospira_phage	22.1	1.7e-59
VED42414.1|3240065_3241289_-	cation efflux system protein	NA	NA	NA	NA	NA
VED42416.1|3241304_3241637_-	cation efflux system protein	NA	NA	NA	NA	NA
VED42418.1|3241794_3243168_-	copper/silver efflux system outer membrane protein CusC	NA	NA	NA	NA	NA
VED42420.1|3243324_3244008_+	two-component system response regulator	NA	W8CYM9	Bacillus_phage	34.7	2.3e-30
VED42422.1|3243997_3245446_+	sensor kinase CusS	NA	NA	NA	NA	NA
VED42424.1|3246182_3247781_+	Rhs element Vgr protein	NA	A0A077K8Q4	Ralstonia_phage	25.9	5.0e-28
VED42426.1|3247743_3248190_+	Rhs core protein with extension	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	37.2	7.2e-17
VED42428.1|3248222_3248483_+	Uncharacterised protein	NA	NA	NA	NA	NA
VED42430.1|3248482_3248770_+	Uncharacterised protein	NA	NA	NA	NA	NA
VED42432.1|3249060_3249258_+	Uncharacterised protein	NA	NA	NA	NA	NA
VED42434.1|3249734_3250871_+	H repeat-associated protein	NA	NA	NA	NA	NA
VED42436.1|3251141_3251720_+	bacteriophage N4 adsorption protein B	NA	NA	NA	NA	NA
VED42438.1|3251765_3253379_+	bacteriophage N4 adsorption protein B	NA	NA	NA	NA	NA
VED42440.1|3253365_3256338_+	bacteriophage N4 receptor, outer membrane subunit	NA	NA	NA	NA	NA
VED42442.1|3256338_3257229_+	Uncharacterised protein	NA	NA	NA	NA	NA
VED42443.1|3257411_3258173_+	porin thermoregulatory protein	NA	NA	NA	NA	NA
3258217:3258263	attL	AATGGCGCGCCCTGCAGGATTCGAACCTGCGGCCCACGACTTAGAAG	NA	NA	NA	NA
VED42445.1|3258686_3259640_+|protease	outer membrane protease	protease	NA	NA	NA	NA
VED42447.1|3259888_3260638_-	DNA-binding transcriptional activator	NA	NA	NA	NA	NA
VED42449.1|3261617_3262322_-	putative prophage protein	NA	A0A1X7QGH6	Escherichia_phage	61.7	9.2e-59
VED42451.1|3262331_3262613_-	putative prophage protein	NA	A0A1X7QHA1	Escherichia_phage	50.0	4.1e-18
VED42453.1|3262609_3264955_-|tail	putative side tail fiber protein from prophage	tail	A0A0E3M0V5	Enterobacteria_phage	45.4	9.5e-92
VED42455.1|3265013_3267836_-	Host specificity protein J of prophage	NA	A0A291AWT4	Escherichia_phage	87.5	0.0e+00
VED42457.1|3267789_3268365_-	DNA packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.2	5.9e-88
VED42459.1|3269308_3269602_+	lambdoid prophage DLP12 Bor-like protein	NA	K7PL54	Enterobacteria_phage	91.8	2.0e-44
VED42461.1|3269633_3270095_-	Rz endopeptidase from lambdoid prophage DLP12	NA	A0A0K2FJD0	Enterobacteria_phage	98.0	2.7e-75
VED42463.1|3270091_3270589_-	phage lysozome	NA	M1FJA0	Enterobacteria_phage	97.6	1.1e-90
VED42465.1|3270588_3270804_-|lysis	phage lysis protein	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
VED42467.1|3271392_3271998_+	outer membrane porin protein, N-ter fragment	NA	Q1MVN1	Enterobacteria_phage	84.2	3.8e-93
VED42469.1|3272026_3272302_+|transposase	IS1 transposase	transposase	NA	NA	NA	NA
VED42471.1|3272346_3272724_+|transposase	IS1 transposase	transposase	Q71TF0	Escherichia_phage	100.0	1.3e-67
VED42473.1|3272781_3273252_+	outer membrane porin protein NmpC	NA	Q1MVN1	Enterobacteria_phage	77.8	1.1e-63
VED42475.1|3273441_3273825_-	lambdoid prophage DLP12 antitermination protein Q	NA	A0A088CD47	Shigella_phage	84.2	4.0e-56
VED42477.1|3273910_3274048_-	DLP12 prophage; small protein	NA	K7PHH3	Enterobacteria_phage	70.7	3.2e-08
VED42479.1|3274047_3274410_-	endodeoxyribonuclease RUS	NA	K7PM48	Enterobacteria_phage	97.4	7.3e-60
VED42481.1|3274406_3274697_-	DLP12 prophage	NA	K7PGZ6	Enterobacteria_phage	95.8	2.3e-48
VED42483.1|3274689_3274860_-	prophage protein NinE	NA	K7P7K0	Enterobacteria_phage	67.9	5.3e-13
VED42485.1|3274859_3275315_-	DLP12 prophage; DNA base-flipping protein	NA	I6PD71	Cronobacter_phage	66.9	4.1e-60
VED42488.1|3275529_3276327_-	DNA-binding transcriptional regulator; DLP12 prophage	NA	NA	NA	NA	NA
VED42491.1|3276336_3276888_-	kinase inhibitor	NA	NA	NA	NA	NA
VED42494.1|3277352_3278711_-	site-specific invertase; DLP12 prophage	NA	Q3HQV4	Burkholderia_phage	25.7	2.6e-17
VED42497.1|3279134_3279467_-	Multidrug transporter emrE	NA	NA	NA	NA	NA
VED42500.1|3279534_3279837_-	Ren protein from phage origin	NA	A0A0N6WES4	Escherichia_phage	95.7	1.1e-42
VED42503.1|3280188_3280446_+	DNA N-6-adenine-methyltransferase of bacteriophage	NA	E5AGF8	Erwinia_phage	66.2	4.9e-26
VED42506.1|3280522_3280738_+	ybl17	NA	A0A1I9LJM7	Stx_converting_phage	100.0	1.0e-32
VED42509.1|3280836_3281055_+	ybl16	NA	M1FQT7	Enterobacteria_phage	95.8	1.8e-34
VED42512.1|3281102_3281381_+	bacteriophage protein	NA	M1FPC8	Enterobacteria_phage	98.9	1.7e-48
VED42515.1|3281579_3282743_+|integrase	site-specific recombinase, phage integrase family protein	integrase	A0A088CD23	Shigella_phage	86.0	1.3e-198
3282757:3282803	attR	AATGGCGCGCCCTGCAGGATTCGAACCTGCGGCCCACGACTTAGAAG	NA	NA	NA	NA
>prophage 12
LR134248	Escherichia coli strain NCTC10537 genome assembly, chromosome: 1	4603981	3514177	3576692	4603981	transposase,holin	Streptococcus_phage(18.18%)	60	NA	NA
VED43101.1|3514177_3516211_-|holin	high-affinity choline transport protein (BCCT-family transporter)	holin	A0A2I7QNT1	Vibrio_phage	27.4	3.4e-21
VED43104.1|3516339_3516927_+	transcriptional regulator BetI	NA	NA	NA	NA	NA
VED43107.1|3516940_3518413_+	betaine aldehyde dehydrogenase	NA	NA	NA	NA	NA
VED43109.1|3518426_3520097_+|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.4	3.6e-61
VED43111.1|3520309_3520978_+	inner membrane protein	NA	NA	NA	NA	NA
VED43113.1|3521220_3521916_-	transporter	NA	NA	NA	NA	NA
VED43116.1|3521908_3523336_-	putative electron transport protein YkgF	NA	NA	NA	NA	NA
VED43119.1|3523346_3524066_-	hydroxyacid oxidoreductase (Fe-S centre)	NA	NA	NA	NA	NA
VED43122.1|3524592_3525447_-	transcriptional regulator YkgD	NA	NA	NA	NA	NA
VED43126.1|3525672_3526998_+	putative pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	47.4	1.2e-112
VED43128.1|3527354_3527948_+	inner membrane protein	NA	NA	NA	NA	NA
VED43131.1|3528538_3529390_+	Putatve transcriptional regulator ykgA	NA	NA	NA	NA	NA
VED43134.1|3529346_3529505_+	Uncharacterised protein	NA	NA	NA	NA	NA
VED43137.1|3529529_3533786_-	Ig domain-containing protein	NA	NA	NA	NA	NA
VED43138.1|3534900_3535002_+	small predicted membrane protein	NA	NA	NA	NA	NA
VED43141.1|3535362_3535629_+	50S ribosomal protein L31	NA	NA	NA	NA	NA
VED43144.1|3535628_3535769_+	50S ribosomal protein L36	NA	NA	NA	NA	NA
VED43147.1|3536853_3537396_+	putative fimbrial transcriptional regulator	NA	NA	NA	NA	NA
VED43150.1|3537421_3538057_+	fimbrillin	NA	NA	NA	NA	NA
VED43153.1|3538114_3538783_+	putative fimbrial protein	NA	NA	NA	NA	NA
VED43156.1|3538808_3541031_+	putative fimbrial outer membrane usher protein	NA	NA	NA	NA	NA
VED43159.1|3541047_3541335_+	putative fimbrial outer membrane usher protein	NA	NA	NA	NA	NA
VED43162.1|3541324_3542968_+	putative fimbrial protein	NA	NA	NA	NA	NA
VED43165.1|3542936_3543647_+	putative fimbrial protein	NA	NA	NA	NA	NA
VED43168.1|3544535_3545150_-	integral membrane protein	NA	NA	NA	NA	NA
VED43171.1|3545566_3546256_+	putative xanthine dehydrogenase, iron-sulfur binding subunit	NA	NA	NA	NA	NA
VED43174.1|3546252_3547209_+	putative xanthine dehydrogenase, FAD-binding subunit	NA	NA	NA	NA	NA
VED43177.1|3547205_3549404_+	putative xanthine dehydrogenase, molybdenum-binding subunit	NA	A0A0P0I429	Acinetobacter_phage	25.8	1.5e-38
VED43180.1|3549413_3550370_+	xanthine dehydrogenase accessory factor	NA	NA	NA	NA	NA
VED43183.1|3550348_3550759_+	transcriptional regulator	NA	NA	NA	NA	NA
VED43186.1|3551075_3552329_-	gamma-glutamyl phosphate reductase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	7.5e-96
VED43189.1|3552340_3553444_-	gamma-glutamyl kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
VED43192.1|3553731_3554769_+	outer membrane phosphoporin protein E	NA	Q1MVN1	Enterobacteria_phage	60.1	4.3e-113
VED43195.1|3554779_3555157_-|transposase	IS1 transposase	transposase	Q71TF0	Escherichia_phage	100.0	1.3e-67
VED43198.1|3555201_3555477_-|transposase	IS1 transposase	transposase	NA	NA	NA	NA
VED43201.1|3555602_3556004_-	sigma factor-binding protein crl (curlin genes transcriptional activator)	NA	NA	NA	NA	NA
VED43204.1|3556061_3557306_-	esterase	NA	NA	NA	NA	NA
VED43207.1|3557397_3557856_-	xanthine-guanine phosphoribosyltransferase	NA	NA	NA	NA	NA
VED43210.1|3558116_3559574_+	aminoacyl-histidine dipeptidase	NA	NA	NA	NA	NA
VED43213.1|3559630_3560131_-	peptide chain release factor H	NA	NA	NA	NA	NA
VED43216.1|3560099_3560366_-	ykfJ	NA	NA	NA	NA	NA
VED43219.1|3560599_3560974_-	putative acetyltransferase	NA	NA	NA	NA	NA
VED43222.1|3561061_3561460_-	toxin YafO	NA	NA	NA	NA	NA
VED43226.1|3561462_3561756_-	antitoxin of the YafO-YafN toxin-antitoxin system	NA	NA	NA	NA	NA
VED43229.1|3561807_3562863_-	DNA polymerase IV	NA	NA	NA	NA	NA
VED43232.1|3562933_3563569_-	lateral flagellar motor protein B (MotB-like)	NA	NA	NA	NA	NA
VED43235.1|3563663_3565403_+	flagellar system protein	NA	NA	NA	NA	NA
VED43238.1|3565618_3566116_-|transposase	RAYT REP element-mobilizing transposase; TnpA(REP)	transposase	NA	NA	NA	NA
VED43241.1|3566291_3567065_-	NlpC/P60 family protein	NA	A0A1V0DZX6	Clostridioides_phage	37.7	1.2e-19
VED43243.1|3567250_3567511_+	antitoxin of YafQ-DinJ toxin-antitoxin system	NA	NA	NA	NA	NA
VED43245.1|3567513_3567792_+	toxin of the YafQ-DinJ toxin-antitoxin system	NA	NA	NA	NA	NA
VED43248.1|3567947_3568688_+	membrane protein	NA	NA	NA	NA	NA
VED43250.1|3568658_3569426_-	amidotransferase	NA	NA	NA	NA	NA
VED43252.1|3569631_3570210_-	phosphoheptose isomerase	NA	A0A067XQR2	Caulobacter_phage	32.0	1.1e-14
VED43254.1|3570449_3572894_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
VED43257.1|3572936_3573383_-	inhibitor of vertebrate lysozyme precursor	NA	NA	NA	NA	NA
VED43259.1|3573563_3574334_+	putative carbon-nitrogen hydrolase	NA	NA	NA	NA	NA
VED43261.1|3574374_3575511_-	H repeat-associated protein	NA	NA	NA	NA	NA
VED43263.1|3575941_3576295_-	Uncharacterised protein	NA	NA	NA	NA	NA
VED43265.1|3576314_3576692_-|transposase	IS1 transposase	transposase	U5P0U6	Shigella_phage	100.0	1.3e-67
>prophage 13
LR134248	Escherichia coli strain NCTC10537 genome assembly, chromosome: 1	4603981	3896710	3984126	4603981	integrase,transposase,tRNA	Shigella_phage(28.57%)	88	3947421:3947436	3986756:3986771
VED43853.1|3896710_3897088_-|transposase	IS1 transposase	transposase	U5P0U6	Shigella_phage	100.0	1.3e-67
VED43855.1|3897132_3897408_-|transposase	IS1 transposase	transposase	NA	NA	NA	NA
VED43857.1|3897462_3898230_-|transposase	putative transposase YhgA-like protein	transposase	Q2A0A7	Sodalis_phage	51.7	2.2e-61
VED43859.1|3898708_3899941_+	multidrug resistance protein	NA	NA	NA	NA	NA
VED43861.1|3899981_3901262_+	inner membrane protein	NA	NA	NA	NA	NA
VED43863.1|3901377_3902529_+	2-hydroxyglutaryl-CoA dehydratase	NA	NA	NA	NA	NA
VED43865.1|3902538_3903306_+	ATPase, activator of (R)-hydroxyglutaryl-CoA dehydratase	NA	NA	NA	NA	NA
VED43867.1|3903302_3903560_+	Protein of uncharacterised function (DUF3343)	NA	NA	NA	NA	NA
VED43868.1|3903513_3904485_+	SdiA-regulated domain protein	NA	NA	NA	NA	NA
VED43870.1|3904552_3905731_+	major facilitator superfamily protein	NA	NA	NA	NA	NA
VED43872.1|3905743_3906298_-	RNA 2'-phosphotransferase-like protein	NA	A0A2R2ZGT8	Clostridioides_phage	45.6	2.7e-37
VED43874.1|3906547_3907231_+	putative transporter	NA	NA	NA	NA	NA
VED43876.1|3907227_3907689_+	putative transporter	NA	NA	NA	NA	NA
VED43878.1|3907701_3908874_+	isoaspartyl dipeptidase	NA	NA	NA	NA	NA
VED43880.1|3908938_3909850_+	DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
VED43882.1|3909842_3910235_-	DNA replication/recombination/repair protein	NA	NA	NA	NA	NA
VED43884.1|3910552_3910654_-	Uncharacterised protein	NA	NA	NA	NA	NA
VED43886.1|3910907_3911738_+	Protein of uncharacterised function (DUF2686)	NA	NA	NA	NA	NA
VED43889.1|3911878_3912604_-	uxu operon transcriptional regulator	NA	NA	NA	NA	NA
VED43891.1|3912650_3912845_+	Uncharacterised protein	NA	NA	NA	NA	NA
VED43893.1|3912866_3914327_-	D-mannonate oxidoreductase, NAD-binding	NA	H8ZJP8	Ostreococcus_tauri_virus	31.9	6.2e-49
VED43895.1|3914407_3915592_-	mannonate dehydratase	NA	NA	NA	NA	NA
VED43897.1|3915931_3917275_+	high-affinity gluconate transporter	NA	NA	NA	NA	NA
VED43899.1|3917517_3918420_-	FimH protein	NA	NA	NA	NA	NA
VED43901.1|3918439_3918943_-	P pilus assembly protein, pilin FimA	NA	NA	NA	NA	NA
VED43903.1|3918955_3919486_-	FimF protein	NA	NA	NA	NA	NA
VED43904.1|3919495_3922132_-	outer membrane usher protein FimD	NA	NA	NA	NA	NA
VED43905.1|3922198_3922924_-	type I fimbrial chaperone	NA	NA	NA	NA	NA
VED43907.1|3922960_3923458_-	type-1 fimbrial protein FimI	NA	NA	NA	NA	NA
VED43909.1|3923564_3924113_-	fimbrial protein	NA	NA	NA	NA	NA
VED43911.1|3924594_3925191_-	tyrosine recombinase	NA	A0A2L1IV36	Escherichia_phage	53.4	3.9e-50
VED43913.1|3925858_3926134_+|transposase	IS1 transposase	transposase	NA	NA	NA	NA
VED43915.1|3926178_3926556_+|transposase	IS1 transposase	transposase	U5P0U6	Shigella_phage	100.0	1.3e-67
VED43917.1|3926549_3927047_-	tyrosine recombinase	NA	A0A2L1IV36	Escherichia_phage	48.4	8.8e-40
VED43919.1|3928502_3929219_+	N-acetylneuraminic acid outer membrane porin	NA	NA	NA	NA	NA
VED43921.1|3929238_3930345_+	N-acetylneuraminic acid mutarotase	NA	NA	NA	NA	NA
VED43923.1|3930409_3931390_+	YjhS protein	NA	Q08JA2	Stx2-converting_phage	56.6	4.7e-101
VED43925.1|3931972_3932797_-	Putative phospholipase D	NA	NA	NA	NA	NA
VED43927.1|3933950_3934208_+	putative xanthine dehydrogenase, Fe-S subunit	NA	NA	NA	NA	NA
VED43929.1|3934219_3934765_+	putative acetyltransferase	NA	NA	NA	NA	NA
VED43931.1|3934820_3935567_+	methyltransferase	NA	NA	NA	NA	NA
VED43933.1|3936352_3937474_+	endoglucanase with Zn-dependent exopeptidase domain	NA	NA	NA	NA	NA
VED43935.1|3937470_3937749_+	PTS system IIB component	NA	NA	NA	NA	NA
VED43937.1|3937760_3939074_+	PTS system IIC component	NA	NA	NA	NA	NA
VED43939.1|3939086_3939893_+	nucleoside triphosphatase	NA	NA	NA	NA	NA
VED43941.1|3940023_3940455_+	PTS system IIA component	NA	NA	NA	NA	NA
VED43943.1|3940466_3941099_+	putative ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
VED43945.1|3941115_3941898_+	putative transcriptional repressor	NA	NA	NA	NA	NA
VED43947.1|3942087_3942363_+|transposase	IS1 transposase	transposase	NA	NA	NA	NA
VED43949.1|3942407_3942785_+|transposase	IS1 transposase	transposase	U5P0U6	Shigella_phage	100.0	1.3e-67
VED43951.1|3942867_3943125_-	Biofilm development protein YmgB/AriR	NA	NA	NA	NA	NA
VED43953.1|3943885_3944095_-|transposase	IS1 transposase	transposase	NA	NA	NA	NA
VED43955.1|3944874_3945396_+	RNA polymerase sigma factor	NA	NA	NA	NA	NA
VED43957.1|3945392_3946346_+	iron(III) dicitrate sensor protein	NA	NA	NA	NA	NA
VED43959.1|3946432_3948757_+	iron(III) dicitrate TonB-dependent receptor	NA	NA	NA	NA	NA
3947421:3947436	attL	TCAACAGCCTGCTGCA	NA	NA	NA	NA
VED43961.1|3948801_3949704_+	iron-dicitrate transporter substrate-binding subunit	NA	NA	NA	NA	NA
VED43963.1|3949700_3950699_+	iron(III) dicitrate transport system, permease protein	NA	NA	NA	NA	NA
VED43965.1|3950695_3951652_+	iron-dicitrate transporter subunit FecD	NA	A0A2H4IY97	uncultured_Caudovirales_phage	26.1	1.1e-17
VED43967.1|3951652_3952420_+	iron(III) dicitrate transport system, ATP-binding protein	NA	G3M9Y6	Bacillus_virus	24.8	6.4e-13
VED43969.1|3952976_3953234_-	KpLE2 phage-like element	NA	NA	NA	NA	NA
VED43971.1|3953555_3953969_-|transposase	transposase	transposase	Q716C2	Shigella_phage	97.4	1.0e-62
VED43973.1|3954167_3954470_+	IS600 ORF1-like protein	NA	NA	NA	NA	NA
VED43975.1|3954505_3955324_+|transposase	IS600 orfAB' transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.2	1.2e-65
VED43977.1|3955477_3957475_+	secondary glycine betaine transporter	NA	A0A2I7QNT1	Vibrio_phage	25.9	7.4e-21
VED43979.1|3957537_3957951_+	Predicted membrane protein (DUF2254)	NA	NA	NA	NA	NA
VED43981.1|3957885_3958539_-|transposase	putative transposase subunit	transposase	Q716C2	Shigella_phage	99.5	1.1e-130
VED43983.1|3958780_3959053_-	IS911 protein	NA	Q716C1	Shigella_phage	97.7	1.0e-37
VED43985.1|3959273_3959624_+	yjhD	NA	NA	NA	NA	NA
VED43987.1|3959676_3959802_-	small predicted membrane protein	NA	NA	NA	NA	NA
VED43989.1|3959844_3960963_-	KpLE2 phage-like element; predicted oxidoreductase	NA	NA	NA	NA	NA
VED43991.1|3960974_3962192_-	KpLE2 phage-like element transporter	NA	NA	NA	NA	NA
VED43993.1|3962818_3964147_+|transposase	transposase insG	transposase	NA	NA	NA	NA
VED43995.1|3965458_3965818_+	putative sulfatase	NA	NA	NA	NA	NA
VED43997.1|3965775_3966207_+	Putative membrane-associated, metal-dependent hydrolase	NA	NA	NA	NA	NA
VED43999.1|3966330_3966573_+	putative sulfatase	NA	NA	NA	NA	NA
VED44001.1|3966972_3968163_-|integrase	phage integrase family site specific recombinase	integrase	B7SYF8	Stenotrophomonas_phage	40.1	9.4e-72
VED44003.1|3968703_3969723_+	oxidoreductase	NA	A0A0G2Y405	Acanthamoeba_polyphaga_mimivirus	30.7	1.4e-44
VED44005.1|3969726_3970290_-	D-gluconate kinase	NA	NA	NA	NA	NA
VED44007.1|3970506_3971538_+	L-idonate 5-dehydrogenase	NA	NA	NA	NA	NA
VED44009.1|3971561_3972326_+	gluconate 5-dehydrogenase	NA	NA	NA	NA	NA
VED44011.1|3972388_3973708_+	Gnt-II system L-idonate transporter	NA	NA	NA	NA	NA
VED44013.1|3973774_3974773_+	L-idonate regulatory protein	NA	NA	NA	NA	NA
VED44015.1|3974850_3976353_+	ATPase	NA	A0A248XCZ8	Klebsiella_phage	44.2	4.6e-84
VED44017.1|3976513_3977596_-	putative permease	NA	NA	NA	NA	NA
VED44019.1|3977595_3978696_-	putative permease	NA	NA	NA	NA	NA
VED44021.1|3978962_3980474_+	cytosol aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	38.0	6.0e-47
VED44023.1|3980827_3981271_+	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
VED44025.1|3981270_3984126_+|tRNA	valyl-tRNA synthetase	tRNA	A0A1V0SK04	Klosneuvirus	36.7	1.3e-140
3986756:3986771	attR	TCAACAGCCTGCTGCA	NA	NA	NA	NA
