The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
LR134236	Escherichia coli strain NCTC9008 genome assembly, chromosome: 1	4757340	1040214	1053402	4757340	tRNA	Escherichia_phage(50.0%)	13	NA	NA
VED01135.1|1040214_1040976_+	stationary phase survival protein SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.0	3.4e-59
VED01136.1|1040969_1041596_+	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.7	5.7e-36
VED01137.1|1041735_1042875_+	lipoprotein NlpD	NA	D7RWE0	Brochothrix_phage	35.6	1.7e-06
VED01138.1|1042937_1043036_+	RNA polymerase sigma factor RpoS	NA	NA	NA	NA	NA
VED01139.1|1043101_1043935_+	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	5.1e-32
VED01140.1|1044028_1045393_-	inner membrane permease YgbN	NA	NA	NA	NA	NA
VED01141.1|1045481_1046258_-	hydroxypyruvate isomerase	NA	NA	NA	NA	NA
VED01142.1|1046262_1046901_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
VED01143.1|1046897_1048160_-|tRNA	paral putative tRNA synthase	tRNA	A0A077SLJ7	Escherichia_phage	61.4	1.7e-135
VED01144.1|1048156_1049065_-	oxidoreductase YgbJ	NA	A0A077SLF7	Escherichia_phage	76.5	5.1e-118
VED01145.1|1049260_1050028_+	DeoR family transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	2.5e-70
VED01146.1|1050078_1050735_-	serine/threonine-specific protein phosphatase 2	NA	A0A077SLQ6	Escherichia_phage	47.0	6.6e-51
VED01147.1|1050840_1053402_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	3.0e-30
>prophage 2
LR134236	Escherichia coli strain NCTC9008 genome assembly, chromosome: 1	4757340	1185192	1287806	4757340	protease,tRNA,integrase,transposase	Escherichia_phage(34.21%)	93	1198853:1198874	1275010:1275031
VED01273.1|1185192_1185696_+|tRNA	tRNA-specific adenosine deaminase	tRNA	NA	NA	NA	NA
VED01274.1|1185692_1187249_-	putative lytic transglycosylase	NA	NA	NA	NA	NA
VED01275.1|1187506_1191394_+	Phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	58.6	5.0e-130
VED01276.1|1191996_1193379_+	sensor-like histidine kinase YfhK	NA	W8CYF6	Bacillus_phage	24.9	2.9e-16
VED01277.1|1193543_1194257_+	putative lipoprotein	NA	NA	NA	NA	NA
VED01278.1|1194246_1195581_+	two component system DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	37.3	3.9e-10
VED01279.1|1195641_1195980_+	nitrogen regulatory protein P-II 1	NA	NA	NA	NA	NA
VED01280.1|1196024_1197215_-	flavohemoprotein	NA	NA	NA	NA	NA
VED01281.1|1197542_1198796_+	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	52.7	7.8e-101
1198853:1198874	attL	CGCCTTATCCGGCCTACAAAAC	NA	NA	NA	NA
VED01282.1|1198993_1200187_-	NAGC-like transcriptional regulator	NA	NA	NA	NA	NA
VED01283.1|1200379_1203586_+	TPR repeat-containing protein	NA	NA	NA	NA	NA
VED01284.1|1203682_1204666_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
VED01285.1|1204688_1206200_+	putative ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.3	3.3e-13
VED01286.1|1206224_1207223_+	ABC transporter permease	NA	NA	NA	NA	NA
VED01287.1|1207288_1208350_+	putative zinc-binding dehydrogenase	NA	NA	NA	NA	NA
VED01288.1|1208361_1209234_+	putative aldose 1-epimerase	NA	NA	NA	NA	NA
VED01289.1|1209281_1209704_-	inner membrane protein	NA	NA	NA	NA	NA
VED01290.1|1209800_1211003_-	3-phenylpropionate dioxygenase ferredoxin--NAD(+) reductase component	NA	NA	NA	NA	NA
VED01291.1|1211012_1211825_-	2,3-dihydroxy-2,3-dihydro-phenylpropionate dehydrogenase	NA	NA	NA	NA	NA
VED01292.1|1211821_1212142_-	3-phenylpropionate dioxygenase ferredoxin subunit	NA	NA	NA	NA	NA
VED01293.1|1212141_1212660_-	3-phenylpropionate dioxygenase beta subunit	NA	NA	NA	NA	NA
VED01294.1|1212656_1214018_-	3-phenylpropionate dioxygenase alpha subunit	NA	NA	NA	NA	NA
VED01295.1|1214153_1215044_+	Hca operon transcriptional activator	NA	NA	NA	NA	NA
VED01296.1|1215203_1216343_+	putative 3-phenylpropionate permease	NA	NA	NA	NA	NA
VED01297.1|1216334_1217615_-	stationary phase inducible protein CsiE	NA	NA	NA	NA	NA
VED01298.1|1217805_1218660_-	peptidase	NA	NA	NA	NA	NA
VED01299.1|1218804_1219608_-	inositol-1-monophosphatase	NA	NA	NA	NA	NA
VED01300.1|1219726_1220467_+	putative RNA methyltransferase	NA	NA	NA	NA	NA
VED01301.1|1220736_1221225_+	FeS cluster assembly transcription factor IscR	NA	NA	NA	NA	NA
VED01302.1|1221465_1222680_+	cysteine desulfurase	NA	A0A1X7C038	Faustovirus	31.8	8.8e-33
VED01303.1|1222707_1223094_+	NifU-like protein	NA	A0A218MKD1	uncultured_virus	78.9	1.4e-53
VED01304.1|1223110_1223434_+	iron-sulfur cluster assembly protein	NA	A0A2H4N7N5	Lake_Baikal_phage	48.6	5.4e-22
VED01305.1|1223529_1224045_+	co-chaperone HscB	NA	NA	NA	NA	NA
VED01306.1|1224061_1225912_+	chaperone protein HscA	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	41.6	5.5e-103
VED01307.1|1225913_1226249_+	ferredoxin	NA	NA	NA	NA	NA
VED01308.1|1226260_1226461_+	FeS assembly protein IscX	NA	NA	NA	NA	NA
VED01309.1|1226518_1227802_+	peptidase B (aminopeptidase B)	NA	Q6GYZ8	Mycoplasma_phage	37.8	3.8e-34
VED01310.1|1229537_1230383_-	3-mercaptopyruvate sulfurtransferase	NA	NA	NA	NA	NA
VED01311.1|1230589_1235551_+|protease	putative protease inhibitor	protease	NA	NA	NA	NA
VED01312.1|1235590_1237864_+	penicillin-binding protein 1C	NA	NA	NA	NA	NA
VED01313.1|1238012_1238444_+	nucleoside diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	37.9	3.7e-18
VED01314.1|1238593_1239748_+	radical SAM protein	NA	NA	NA	NA	NA
VED01315.1|1240032_1241046_+	putative regulatory protein	NA	NA	NA	NA	NA
VED01316.1|1242301_1243576_+|tRNA	histidyl-tRNA synthetase	tRNA	NA	NA	NA	NA
VED01317.1|1243593_1244214_+	conserved protein, UPF0070 family	NA	NA	NA	NA	NA
VED01318.1|1244224_1245403_+	putative dehydrogenase	NA	NA	NA	NA	NA
VED01319.1|1245520_1246993_+	GTP-binding protein EngA	NA	NA	NA	NA	NA
VED01320.1|1247061_1247277_+	protein	NA	NA	NA	NA	NA
VED01321.1|1247273_1248644_-	exodeoxyribonuclease 7 large subunit	NA	A0A2H4UVM9	Bodo_saltans_virus	35.3	5.2e-42
VED01322.1|1248805_1250272_+	inosine 5'-monophosphate dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	39.1	2.3e-88
VED01323.1|1250340_1251918_+	bifunctional GMP synthase/glutamine amidotransferase protein	NA	NA	NA	NA	NA
VED01324.1|1252225_1253416_+|integrase	phage integrase site specific recombinase	integrase	G9L697	Escherichia_phage	53.2	7.4e-117
VED01325.1|1253539_1254169_+	Uncharacterised protein	NA	NA	NA	NA	NA
VED01326.1|1254746_1255718_-	Uncharacterised protein	NA	NA	NA	NA	NA
VED01327.1|1255780_1256284_-|transposase	IS1 transposase	transposase	U5P0U6	Shigella_phage	99.4	9.7e-95
VED01328.1|1256625_1257951_-	putative pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	47.8	6.5e-114
VED01329.1|1258254_1258758_+|transposase	IS1 transposase	transposase	U5P0U6	Shigella_phage	99.4	9.7e-95
VED01330.1|1258858_1259140_-	Uncharacterised protein	NA	NA	NA	NA	NA
VED01331.1|1259389_1259740_+|transposase	transposase IS3/IS911 family protein	transposase	U5P4I9	Shigella_phage	92.5	4.3e-33
VED01332.1|1259626_1260472_-|transposase	IS621, transposase	transposase	A0A1S7J231	Thermus_phage	29.3	1.6e-17
VED01333.1|1260842_1261082_+|transposase	transposase	transposase	A0A077K814	Ralstonia_phage	61.6	2.8e-15
VED01334.1|1261306_1262458_-	2-alkenal reductase	NA	A0A1B1IT49	uncultured_Mediterranean_phage	30.3	7.5e-26
VED01335.1|1262482_1263361_-	Peptidase M48, Ste24p precursor	NA	NA	NA	NA	NA
VED01336.1|1263338_1263836_-	Predicted membrane protein	NA	NA	NA	NA	NA
VED01337.1|1263838_1265548_-	Sodium/hydrogen exchanger precursor	NA	NA	NA	NA	NA
VED01338.1|1265551_1265992_-	Thioredoxin	NA	A0A1J0GW78	Streptomyces_phage	37.2	5.8e-11
VED01339.1|1265981_1267127_-	Uncharacterised protein	NA	NA	NA	NA	NA
VED01340.1|1267150_1267363_-	Uncharacterised protein	NA	NA	NA	NA	NA
VED01341.1|1267362_1270212_-	chaperone ATPase	NA	K4FB40	Cronobacter_phage	41.2	5.3e-129
VED01342.1|1270317_1270887_-	molecular chaperone	NA	NA	NA	NA	NA
VED01343.1|1270921_1271203_-	Putative excisionase	NA	NA	NA	NA	NA
VED01344.1|1271333_1271651_-|transposase	IS1 transposase	transposase	Q71TF0	Escherichia_phage	100.0	5.4e-51
VED01345.1|1271695_1271971_-|transposase	IS1 transposase	transposase	A0A2L1IV22	Escherichia_phage	98.6	6.6e-37
VED01346.1|1272044_1272317_+	IS1 InsA protein	NA	A0A0U2RK18	Escherichia_phage	96.4	2.0e-41
VED01347.1|1272343_1272739_+|transposase	IS1, transposase orfB	transposase	A0A0U2RK18	Escherichia_phage	95.4	3.8e-70
VED01348.1|1272880_1273156_+|transposase	IS1 transposase	transposase	Q71TE9	Escherichia_phage	100.0	3.1e-47
VED01349.1|1273200_1273578_+|transposase	IS1 transposase	transposase	Q71TF0	Escherichia_phage	99.2	4.9e-67
VED01350.1|1273579_1273942_+	ferric transporter subunit	NA	NA	NA	NA	NA
VED01351.1|1273953_1275000_+	Fe(3+) ions import ATP-binding protein fbpC	NA	G3M9Y6	Bacillus_virus	37.7	1.5e-33
VED01352.1|1275108_1276041_-	homocysteine S-methyltransferase	NA	NA	NA	NA	NA
1275010:1275031	attR	GTTTTGTAGGCCGGATAAGGCG	NA	NA	NA	NA
VED01353.1|1276027_1277455_-	amino acid permease	NA	NA	NA	NA	NA
VED01354.1|1277507_1277597_-	Uncharacterised protein	NA	NA	NA	NA	NA
VED01355.1|1277674_1278655_+|transposase	IS5 transposase and trans-activator	transposase	Q38213	Escherichia_phage	99.4	6.1e-186
VED01356.1|1278882_1279200_+	HsdR family type I site-specific deoxyribonuclease	NA	NA	NA	NA	NA
VED01357.1|1279149_1279524_-|transposase	putative transposase	transposase	Q716C2	Shigella_phage	94.3	5.4e-66
VED01358.1|1279486_1279846_-	putative prophage protein	NA	A0A077SLM1	Escherichia_phage	98.9	5.0e-45
VED01359.1|1279873_1280053_-	Uncharacterised protein	NA	Q71TH5	Escherichia_phage	96.6	3.5e-23
VED01360.1|1280057_1280438_-	toxin of P1 addiction system	NA	A0A077SK56	Escherichia_phage	100.0	1.1e-63
VED01361.1|1280437_1280659_-	antitoxin of P1 addiction system	NA	A0A222YXU1	Escherichia_phage	100.0	6.7e-32
VED01362.1|1280841_1282398_+	type I restriction-modification system, M subunit	NA	A0A2H4PQP4	Staphylococcus_phage	43.1	1.7e-105
VED01363.1|1282394_1283657_+	type I restriction-modification enzyme S subunit	NA	NA	NA	NA	NA
VED01364.1|1283778_1286895_+	type I restriction-modification enzyme R subunit	NA	NA	NA	NA	NA
VED01365.1|1287302_1287806_+|transposase	IS1 transposase	transposase	Q71TF0	Escherichia_phage	98.8	2.8e-94
>prophage 3
LR134236	Escherichia coli strain NCTC9008 genome assembly, chromosome: 1	4757340	1692110	1701555	4757340		Enterobacteria_phage(85.71%)	10	NA	NA
VED01725.1|1692110_1693037_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.8	1.7e-23
VED01726.1|1693041_1693773_+	ABC transporter permease	NA	NA	NA	NA	NA
VED01727.1|1693753_1693861_-	putative inner membrane protein	NA	NA	NA	NA	NA
VED01728.1|1693920_1694652_-	MerR family transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
VED01729.1|1694873_1696559_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
VED01730.1|1696555_1697275_+	two-component response-regulatory protein YehT	NA	NA	NA	NA	NA
VED01731.1|1697321_1697792_+	conserved protein, DUF1456 family	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
VED01732.1|1697832_1698294_-	lipoprotein yehR	NA	Q9EYF5	Enterobacteria_phage	98.0	1.7e-74
VED01733.1|1698418_1700422_-	zinc finger SWIM domain-containing protein	NA	Q9EYF6	Enterobacteria_phage	96.3	0.0e+00
VED01734.1|1700418_1701555_-	von Willebrand factor type A domain protein YehP	NA	Q9EYF7	Enterobacteria_phage	97.7	8.5e-163
>prophage 4
LR134236	Escherichia coli strain NCTC9008 genome assembly, chromosome: 1	4757340	1713186	1777038	4757340	terminase,capsid,tail,protease,lysis,holin,plate,tRNA,integrase	Escherichia_phage(48.89%)	72	1740428:1740454	1772714:1772740
VED01741.1|1713186_1715220_-|tRNA	methionyl-tRNA synthetase	tRNA	A0A1V0SDF2	Indivirus	27.6	2.3e-54
VED01742.1|1715351_1716461_+	ATPase	NA	NA	NA	NA	NA
VED01743.1|1716723_1717005_+	fimbrial-like adhesin protein	NA	NA	NA	NA	NA
VED01744.1|1717297_1717840_+	fimbrial protein	NA	NA	NA	NA	NA
VED01745.1|1717919_1718594_+	putative periplasmic pilin chaperone	NA	NA	NA	NA	NA
VED01746.1|1718609_1721090_+	fimbrial outer membrane usher protein	NA	NA	NA	NA	NA
VED01747.1|1721105_1722140_+	putative fimbrial adhesin	NA	NA	NA	NA	NA
VED01748.1|1722221_1722560_-	periplasmic modulator of Ni and Co efflux	NA	NA	NA	NA	NA
VED01749.1|1722778_1723603_-	nickel/cobalt efflux protein RcnA	NA	NA	NA	NA	NA
VED01750.1|1723723_1723996_+	transcriptional repressor RcnR	NA	NA	NA	NA	NA
VED01751.1|1724218_1725007_+	hydroxyethylthiazole kinase	NA	NA	NA	NA	NA
VED01752.1|1725003_1725804_+	phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
VED01753.1|1725868_1726687_+	1,4-beta-N-acetylmuramidase	NA	D0R7H8	Paenibacillus_phage	38.0	1.9e-23
VED01754.1|1726738_1727485_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
VED01755.1|1727458_1728424_-	putative carbohydrate/pyrimidine kinase	NA	NA	NA	NA	NA
VED01756.1|1728420_1729425_-	putative ADP-ribosylglycohydrolase	NA	A0A1S6UB21	Serratia_phage	29.0	6.4e-13
VED01757.1|1729421_1730699_-	major facilitator superfamily protein	NA	NA	NA	NA	NA
VED01758.1|1730955_1732008_+	fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
VED01759.1|1732315_1733170_+	tagatose-bisphosphate aldolase	NA	NA	NA	NA	NA
VED01760.1|1733198_1734461_+	putative tagatose 6-phosphate kinase	NA	NA	NA	NA	NA
VED01761.1|1734470_1734923_+	galactitol-specific PTS system EIIA component	NA	NA	NA	NA	NA
VED01762.1|1734953_1735238_+	galactitol-specific PTS system EIIB component	NA	NA	NA	NA	NA
VED01763.1|1735241_1736597_+	galactitol-specific PTS system EIIC component	NA	NA	NA	NA	NA
VED01764.1|1736644_1737685_+	galactitol-1-phosphate 5-dehydrogenase	NA	NA	NA	NA	NA
VED01765.1|1737784_1738564_+	galactitol utilization operon repressor	NA	NA	NA	NA	NA
VED01766.1|1738645_1739545_-	lipid kinase	NA	A0A1V0SBJ0	Catovirus	29.0	1.7e-12
VED01767.1|1739950_1740268_+	protein	NA	NA	NA	NA	NA
1740428:1740454	attL	AAAAAATAAGCCCGTGTAAGGGAGATT	NA	NA	NA	NA
VED01768.1|1740533_1741547_-|integrase	phage integrase	integrase	Q83VS6	Escherichia_phage	99.4	8.3e-194
VED01769.1|1741662_1741962_-	bacteriophage P2 C-like protein	NA	Q1JS61	Enterobacteria_phage	100.0	2.4e-48
VED01770.1|1742083_1742359_+	bacteriophage P2 Cox-like protein	NA	Q1JS60	Enterobacteria_phage	100.0	1.3e-48
VED01771.1|1742369_1742540_+	Uncharacterised protein	NA	S4TNZ7	Salmonella_phage	100.0	6.1e-25
VED01772.1|1742536_1743037_+	Phage protein B	NA	M1SV55	Escherichia_phage	100.0	2.6e-92
VED01773.1|1743100_1743325_+	Protein of uncharacterised function (DUF2732)	NA	S4TP68	Salmonella_phage	98.6	1.4e-32
VED01774.1|1743324_1743627_+	Uncharacterised protein	NA	A0A0F7LCL4	Escherichia_phage	98.0	8.5e-46
VED01775.1|1743626_1743851_+	C4-type zinc finger protein, DksA/TraR family	NA	S4TRY6	Salmonella_phage	100.0	2.9e-35
VED01776.1|1743847_1744123_+	relication initiation protein	NA	Q858T5	Yersinia_virus	100.0	3.8e-45
VED01777.1|1744112_1746398_+	Replication gene A protein (GpA)	NA	A0A0F7LBQ2	Escherichia_phage	98.5	0.0e+00
VED01778.1|1746748_1748254_+	Uncharacterised protein	NA	Q858T2	Yersinia_virus	28.3	1.5e-05
VED01779.1|1748323_1749208_+	DNA adenine methylase from prophage	NA	NA	NA	NA	NA
VED01780.1|1749543_1750578_-|capsid	phage capsid protein	capsid	M1SV64	Escherichia_phage	98.8	1.0e-199
VED01781.1|1750577_1752350_-	Terminase, ATPase subunit (GpP)	NA	A0A0F7LCK3	Escherichia_phage	99.8	0.0e+00
VED01782.1|1752523_1753378_+|capsid	phage capsid scaffolding protein	capsid	Q778Z1	Enterobacteria_phage	98.2	4.7e-134
VED01783.1|1753436_1754510_+|capsid	major capsid protein	capsid	Q94MH9	Enterobacteria_phage	99.4	6.7e-202
VED01784.1|1754513_1755257_+|terminase	small terminase subunit	terminase	Q858W5	Yersinia_virus	98.8	2.7e-125
VED01785.1|1755356_1755866_+|capsid	capsid completion protein	capsid	U5N0S3	Enterobacteria_phage	100.0	1.1e-90
VED01786.1|1755865_1756069_+|tail	phage tail protein X	tail	A0A0F7LCN2	Escherichia_phage	100.0	3.0e-31
VED01787.1|1756072_1756354_+|holin,lysis	phage lysis holin	holin,lysis	A0A0F7LDF8	Escherichia_phage	100.0	3.7e-43
VED01788.1|1756353_1756851_+	phage lysin	NA	A0A0F7LBS0	Escherichia_phage	100.0	3.1e-93
VED01789.1|1756865_1757291_+	LysA protein	NA	A0A0F7LBP4	Escherichia_phage	92.9	8.9e-57
VED01790.1|1757278_1757704_+	LysB protein	NA	A0A0F7L9Y0	Escherichia_phage	96.5	8.0e-66
VED01791.1|1757690_1757849_+|lysis	phage lysis protein LysC	lysis	M1RZ27	Escherichia_phage	100.0	2.6e-22
VED01792.1|1757811_1758279_+|tail	tail protein	tail	A0A0F7LA33	Escherichia_phage	98.7	1.1e-81
VED01793.1|1758271_1758724_+|tail	tail protein	tail	A0A0F7LBV9	Escherichia_phage	98.7	5.3e-76
VED01794.1|1758790_1759426_+|plate	Baseplate assembly protein V (GpV)	plate	U5N3F0	Enterobacteria_phage	98.1	2.6e-113
VED01795.1|1759422_1759770_+|plate	phage baseplate protein	plate	A0A0F7L9X3	Escherichia_phage	100.0	1.7e-58
VED01796.1|1759774_1760683_+|plate	baseplate assembly protein	plate	A0A0F7LCJ3	Escherichia_phage	99.7	3.4e-162
VED01797.1|1760675_1761206_+|tail	tail protein I (GpI)	tail	U5N0U8	Enterobacteria_phage	100.0	2.3e-102
VED01798.1|1761216_1763346_+|tail	putative tail fiber protein (GpH)	tail	U5N099	Enterobacteria_phage	56.2	4.3e-144
VED01799.1|1763349_1763877_+|tail	tail assembly chaperone gp38	tail	U5N0T1	Enterobacteria_phage	95.4	3.4e-90
VED01800.1|1764207_1764993_+	Protein of uncharacterised function (DUF2971)	NA	NA	NA	NA	NA
VED01801.1|1765079_1765565_+	Uncharacterised protein	NA	NA	NA	NA	NA
VED01802.1|1766008_1767199_+|tail	major tail sheath protein FI	tail	A0A0F7LBW9	Escherichia_phage	99.5	1.4e-224
VED01803.1|1767211_1767730_+|tail	phage major tail tube protein FII	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
VED01804.1|1767786_1768062_+|tail	tail protein E (GpE)	tail	A0A0F7LDQ8	Escherichia_phage	100.0	5.7e-41
VED01805.1|1768206_1770654_+|tail	phage related tail protein	tail	M1T2S3	Escherichia_phage	96.6	0.0e+00
VED01806.1|1770668_1771148_+	gpU phage protein	NA	A0A0F7LDE8	Escherichia_phage	99.4	1.5e-84
VED01807.1|1771147_1772311_+	phage protein D	NA	U5N3V4	Enterobacteria_phage	99.2	8.3e-206
VED01808.1|1772392_1772611_+	transcriptional activator Ogr/delta	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
VED01809.1|1772884_1774246_-|protease	putative protease	protease	Q6DW11	Phage_TP	99.7	1.9e-217
1772714:1772740	attR	AAAAAATAAGCCCGTGTAAGGGAGATT	NA	NA	NA	NA
VED01810.1|1774392_1774725_-	protein	NA	NA	NA	NA	NA
VED01811.1|1774915_1775638_-	two-component response regulator	NA	W8CYM9	Bacillus_phage	33.6	3.7e-31
VED01812.1|1775634_1777038_-	two-component sensor kinase	NA	W8CYF6	Bacillus_phage	29.0	3.0e-32
>prophage 5
LR134236	Escherichia coli strain NCTC9008 genome assembly, chromosome: 1	4757340	1870899	1959784	4757340	integrase,transposase	Acidithiobacillus_phage(15.79%)	75	1909862:1909921	1951665:1951745
VED01890.1|1870899_1871922_-|transposase	transposase	transposase	A0A2L1IVA1	Escherichia_phage	98.8	6.6e-199
VED01891.1|1873572_1873779_-	CP4-44 prophage	NA	NA	NA	NA	NA
VED01892.1|1873775_1874150_-	toxin of the YeeV-YeeU toxin-antitoxin system	NA	NA	NA	NA	NA
VED01893.1|1874239_1874608_-	antitoxin of the YeeV-YeeU toxin-antitoxin system; CP4-44 prophage	NA	NA	NA	NA	NA
VED01894.1|1874657_1874771_-	Uncharacterised protein	NA	NA	NA	NA	NA
VED01895.1|1874770_1874992_-	CP4-44 prophage	NA	A0A142F0X9	Klebsiella_phage	45.8	1.9e-10
VED01896.1|1875054_1875531_-	putative DNA repair protein	NA	NA	NA	NA	NA
VED01897.1|1875546_1876020_-	antirestriction protein	NA	A9J566	Pseudomonas_phage	31.2	4.3e-12
VED01898.1|1876208_1876361_-	antirestriction protein	NA	NA	NA	NA	NA
VED01899.1|1876360_1877179_-	CP4-57 prophage protein	NA	A0A2C9CX26	Yersinia_phage	39.3	8.0e-46
VED01900.1|1877333_1877492_-	putative plasmid-like protein	NA	NA	NA	NA	NA
VED01901.1|1877562_1879074_-	adhesin	NA	NA	NA	NA	NA
VED01902.1|1879254_1880796_+|transposase	transposase for ISEc12	transposase	K4I413	Acidithiobacillus_phage	46.4	1.7e-129
VED01903.1|1880810_1881557_+|transposase	transposase	transposase	U5N3V8	Enterobacteria_phage	31.6	3.5e-24
VED01904.1|1881614_1882997_-	antigen 43, truncation	NA	NA	NA	NA	NA
VED01905.1|1883368_1884241_-	putative GTP-binding protein	NA	NA	NA	NA	NA
VED01906.1|1884325_1885243_-	ybl124	NA	NA	NA	NA	NA
VED01907.1|1885799_1885928_+	Uncharacterised protein	NA	NA	NA	NA	NA
VED01908.1|1886442_1886952_-	Uncharacterised protein	NA	NA	NA	NA	NA
VED01909.1|1887139_1887346_-	putative regulatory protein	NA	NA	NA	NA	NA
VED01910.1|1888576_1888777_-	Uncharacterised protein	NA	NA	NA	NA	NA
VED01911.1|1888975_1889545_+	malate transporter	NA	NA	NA	NA	NA
VED01912.1|1889710_1890109_+	ybl85	NA	NA	NA	NA	NA
VED01913.1|1890127_1890547_+	ybl126	NA	NA	NA	NA	NA
VED01914.1|1890601_1891081_-|transposase	transposase	transposase	NA	NA	NA	NA
VED01915.1|1891266_1891671_+	DNA-directed RNA polymerase, beta subunit/140 kD subunit	NA	NA	NA	NA	NA
VED01916.1|1892134_1893670_+|transposase	transposase for ISEc12	transposase	K4I413	Acidithiobacillus_phage	40.6	9.5e-101
VED01917.1|1893686_1894442_+|transposase	transposase	transposase	K4HZD4	Acidithiobacillus_phage	43.4	3.1e-44
VED01918.1|1895303_1895939_+|transposase	transposase	transposase	NA	NA	NA	NA
VED01919.1|1896590_1897625_-	phosphotriesterase	NA	NA	NA	NA	NA
VED01920.1|1897627_1897891_-	Putative inner membrane protein	NA	NA	NA	NA	NA
VED01921.1|1897984_1898593_-	Putative inner membrane protein	NA	NA	NA	NA	NA
VED01922.1|1898649_1899243_-	cytoplasmic protein	NA	NA	NA	NA	NA
VED01923.1|1899259_1900165_-	IS2 element protein	NA	Q9ZXG3	Shigella_phage	96.7	9.4e-173
VED01924.1|1900122_1900488_-|transposase	transposase	transposase	Q76S41	Shigella_phage	98.3	1.8e-58
VED01925.1|1900576_1900744_-	cytoplasmic protein	NA	NA	NA	NA	NA
VED01926.1|1900757_1901972_-	carbohydrate kinase	NA	NA	NA	NA	NA
VED01927.1|1902166_1902283_-|transposase	putative transposase, ISEc23	transposase	A0A0P0ZBS5	Stx2-converting_phage	71.4	1.2e-08
VED01928.1|1904028_1904571_+	bifunctional adenosylcobalamin biosynthesis protein [includes adenosylcobinamide kinase; adenosylcobinamide-phosphate guanylyltransferase]	NA	NA	NA	NA	NA
VED01929.1|1904567_1905311_+	cobalamin synthase	NA	NA	NA	NA	NA
VED01930.1|1905322_1906402_+	Nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase	NA	NA	NA	NA	NA
VED01931.1|1906463_1907399_+	ErfK/YbiS/YcfS/YnhG family protein	NA	NA	NA	NA	NA
VED01932.1|1907855_1908773_+	Nitrogen assimilation regulatory protein nac	NA	NA	NA	NA	NA
VED01933.1|1908874_1909825_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
1909862:1909921	attL	TTGGCTCCTCTGACTGGACTCGAACCAGTGACATACGGATTAACAGTCCGCCGTTCTACC	NA	NA	NA	NA
VED01934.1|1910131_1911586_+	multidrug efflux system	NA	NA	NA	NA	NA
VED01935.1|1912216_1912933_-	putative cytoplasmic protein	NA	NA	NA	NA	NA
VED01936.1|1913275_1914730_-	AMP nucleosidase	NA	NA	NA	NA	NA
VED01937.1|1914831_1916148_-	shikimate transporter	NA	NA	NA	NA	NA
VED01938.1|1916462_1917515_+	ADP-heptose--LPS heptosyltransferase-like protein	NA	NA	NA	NA	NA
VED01939.1|1917776_1920035_-	adhesin	NA	NA	NA	NA	NA
VED01940.1|1920167_1920917_-	adhesin	NA	NA	NA	NA	NA
VED01941.1|1921566_1923588_-	pesticin/yersiniabactin TonB-dependent receptor	NA	NA	NA	NA	NA
VED01942.1|1923718_1925296_-	yersiniabactin siderophore biosynthetic protein	NA	NA	NA	NA	NA
VED01943.1|1925299_1926103_-	yersiniabactin siderophore biosynthetic protein	NA	NA	NA	NA	NA
VED01944.1|1926099_1927200_-	Thiazolinyl-S-HMWP1 reductase YbtU	NA	NA	NA	NA	NA
VED01945.1|1927196_1935968_-	non-ribosomal peptide synthase (yersiniabactin siderophore biosynthetic protein)	NA	NA	NA	NA	NA
VED01946.1|1935964_1936687_-	peptide/polyketide synthetase protein	NA	D0R7J2	Paenibacillus_phage	34.5	1.9e-27
VED01947.1|1936774_1942882_-	phenyloxazoline synthase MbtB	NA	A0A2K9L3I8	Tupanvirus	27.3	3.1e-33
VED01948.1|1943072_1944032_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
VED01949.1|1944198_1946001_+	ABC transporter ATP-binding/permease rpotein	NA	W8CYL7	Bacillus_phage	28.1	1.9e-31
VED01950.1|1945987_1947790_+	permease and ATP-binding protein of yersiniabactin-iron ABC transporter YbtQ	NA	W8CYL7	Bacillus_phage	26.5	6.1e-22
VED01951.1|1947782_1949063_+	yersiniabactin-iron transporter permease YbtX	NA	NA	NA	NA	NA
VED01952.1|1949090_1950395_+	putative chorismate binding protein	NA	NA	NA	NA	NA
VED01953.1|1950588_1951017_-|integrase	phage integrase	integrase	A0A1B0VMI6	Pseudomonas_phage	48.0	2.2e-23
VED01954.1|1951107_1951338_-|integrase	phage integrase	integrase	NA	NA	NA	NA
VED01955.1|1951342_1951504_-|integrase	integrase	integrase	A7X7X0	Dichelobacter_phage	51.3	1.7e-05
VED01956.1|1951841_1952639_-	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
1951665:1951745	attR	TTGGCTCCTCTGACTGGACTCGAACCAGTGACATACGGATTAACAGTCCGCCGTTCTACCGACTGAACTACAGAGGAATCG	NA	NA	NA	NA
VED01957.1|1953491_1954142_-	metal ABC transporter substrate binding protein	NA	NA	NA	NA	NA
VED01958.1|1954398_1955034_-	sulfite oxidase subunit YedZ	NA	NA	NA	NA	NA
VED01959.1|1955034_1956039_-	putative oxidoreductase	NA	NA	NA	NA	NA
VED01960.1|1956147_1956561_-	transthyretin-like protein	NA	NA	NA	NA	NA
VED01961.1|1956582_1957365_+	transcriptional regulatory protein YedW	NA	W8CYM9	Bacillus_phage	35.2	4.8e-32
VED01962.1|1957364_1958723_+	two-component sensor kinase	NA	Q8QKV7	Ectocarpus_siliculosus_virus	19.4	5.1e-05
VED01963.1|1958830_1959526_-	chaperone protein	NA	NA	NA	NA	NA
VED01964.1|1959574_1959784_-|transposase	IS1 transposase	transposase	NA	NA	NA	NA
>prophage 6
LR134236	Escherichia coli strain NCTC9008 genome assembly, chromosome: 1	4757340	2320392	2364510	4757340	protease,lysis,integrase,transposase	Escherichia_phage(29.63%)	55	2346527:2346542	2360289:2360304
VED02323.1|2320392_2321214_-|protease	putative protease	protease	NA	NA	NA	NA
VED02324.1|2321489_2321798_-	acid shock protein	NA	NA	NA	NA	NA
VED02325.1|2322221_2323475_-	major facilitator superfamily protein	NA	NA	NA	NA	NA
VED02326.1|2323581_2324475_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
VED02327.1|2324609_2325830_+	protein Mlc (making large colonies protein)	NA	NA	NA	NA	NA
VED02328.1|2325954_2326650_+	dithiobiotin synthetase	NA	NA	NA	NA	NA
VED02329.1|2326602_2327859_-	voltage-gated ClC-type chloride channel	NA	NA	NA	NA	NA
VED02330.1|2328053_2328668_-	anaerobic dimethyl sulfoxide reductase maturation protein (twin-arginine leader-binding protein)	NA	A0A077SLS7	Escherichia_phage	35.8	3.3e-28
VED02331.1|2328710_2329565_-	putative dimethyl sulfoxide reductase, anchor subunit	NA	NA	NA	NA	NA
VED02332.1|2329566_2330184_-	anaerobic dimethyl sulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
VED02333.1|2330194_2332591_-	putative dimethyl sulfoxide reductase, olydopterin dinucleotide binding subunit	NA	A0A077SK27	Escherichia_phage	48.6	8.2e-208
VED02334.1|2332678_2335105_-	putative dimethyl sulfoxide reductase, oxidoreductase subunit	NA	A0A077SK27	Escherichia_phage	49.2	5.9e-214
VED02335.1|2335303_2335609_-	protein	NA	NA	NA	NA	NA
VED02336.1|2335680_2336427_+	lipoprotein	NA	NA	NA	NA	NA
VED02337.1|2336429_2336990_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
VED02338.1|2337024_2337366_-	protein	NA	NA	NA	NA	NA
VED02339.1|2337500_2337827_+	inner membrane protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
VED02340.1|2338032_2339247_+	starvation sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
VED02341.1|2339258_2340278_+	dehydrogenase	NA	E3SJ82	Synechococcus_phage	26.2	4.3e-17
VED02342.1|2340465_2341746_-|integrase	defective integrase; Qin prophage	integrase	B6DZ48	Enterobacteria_phage	62.1	3.3e-155
VED02343.1|2341780_2342017_-	putative excisionase	NA	S4TND0	Salmonella_phage	50.7	6.1e-15
VED02344.1|2342104_2344576_-	putative exonuclease from phage origin	NA	A0A192Y6E0	Salmonella_phage	56.7	8.5e-59
VED02345.1|2344668_2344860_-	putative prophage protein	NA	NA	NA	NA	NA
VED02346.1|2344856_2345045_-	division inhibition protein	NA	NA	NA	NA	NA
VED02347.1|2345444_2345609_+	Uncharacterised protein	NA	NA	NA	NA	NA
VED02348.1|2345612_2345831_-	putative prophage protein	NA	NA	NA	NA	NA
VED02349.1|2345860_2345989_-	putative prophage protein	NA	NA	NA	NA	NA
VED02350.1|2345990_2346146_-	putative prophage protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
VED02351.1|2346312_2346720_-	repressor protein of division inhibition gene	NA	K7PM82	Enterobacteria_phage	54.7	4.4e-13
2346527:2346542	attL	CATGTTGGTGAGCATT	NA	NA	NA	NA
VED02352.1|2346803_2347034_+	repressor protein of division inhibition gene	NA	NA	NA	NA	NA
VED02353.1|2347017_2347539_+	YdfX	NA	NA	NA	NA	NA
VED02354.1|2347519_2348485_+	ybl78	NA	U5P0A0	Shigella_phage	60.2	2.2e-55
VED02355.1|2348525_2348948_+	putative prophage protein	NA	A0A0U2QQN3	Escherichia_phage	92.0	4.4e-64
VED02356.1|2348944_2349301_+	putative methyltransferase	NA	H9C170	Pectobacterium_phage	69.6	1.6e-38
VED02357.1|2350453_2350633_+	membrane protein	NA	NA	NA	NA	NA
VED02358.1|2350967_2352281_+|integrase,transposase	putative integrase/transposase	integrase,transposase	NA	NA	NA	NA
VED02359.1|2352717_2353050_-	Qin prophage protein	NA	NA	NA	NA	NA
VED02360.1|2353582_2353822_+	antitoxin of the RelE-RelB toxin-antitoxin system and transcriptional repressor of relBEF	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	54.4	1.6e-18
VED02361.1|2353821_2354109_+	toxin of the RelE-RelB toxin-antitoxin system	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	66.0	1.4e-29
VED02362.1|2354180_2354336_+	putative host cell-killing modulation protein	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
VED02363.1|2354552_2354804_+	putative prophage protein	NA	NA	NA	NA	NA
VED02364.1|2355150_2356200_+	putative prophage protein	NA	A0A291AWV9	Escherichia_phage	57.3	1.3e-112
VED02365.1|2356213_2356966_+	lambdoid prophage Qin antitermination protein Q-like protein	NA	A0A192Y5X6	Salmonella_phage	92.4	2.7e-133
VED02366.1|2357387_2357600_-	cold shock-like protein CspF	NA	NA	NA	NA	NA
VED02367.1|2358717_2358837_-	Uncharacterised protein	NA	NA	NA	NA	NA
VED02368.1|2358878_2359085_+|lysis	phage lysis protein	lysis	A5LH82	Enterobacteria_phage	92.6	9.9e-30
VED02369.1|2359089_2359401_+	Qin prophage protein	NA	K7PGU6	Enterobacteria_phage	64.6	2.0e-26
VED02370.1|2359397_2359931_+	prophage lysozyme (endolysin)	NA	K7PLY1	Enterobacteria_phage	93.2	6.4e-97
VED02371.1|2360001_2360424_+	Qin prophage protein	NA	NA	NA	NA	NA
2360289:2360304	attR	AATGCTCACCAACATG	NA	NA	NA	NA
VED02372.1|2361672_2361846_+	GnsA/GnsB family transcriptional regulator	NA	NA	NA	NA	NA
VED02373.1|2361997_2362408_-	Qin prophage	NA	C6ZCX4	Enterobacteria_phage	78.7	1.2e-55
VED02374.1|2362454_2362748_-|transposase	IS1 transposase	transposase	NA	NA	NA	NA
VED02375.1|2362876_2363152_-|transposase	IS1 transposase	transposase	A0A2L1IV22	Escherichia_phage	98.6	6.6e-37
VED02376.1|2363369_2363960_-	putative DNA-invertase	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
VED02377.1|2364276_2364510_-	Qin prophage DNA-binding transcriptional regulator	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
>prophage 7
LR134236	Escherichia coli strain NCTC9008 genome assembly, chromosome: 1	4757340	2473744	2498744	4757340	transposase	Escherichia_phage(22.22%)	29	NA	NA
VED02465.1|2473744_2474038_-|transposase	IS1 transposase	transposase	NA	NA	NA	NA
VED02466.1|2474166_2474442_-|transposase	IS1 transposase	transposase	A0A2L1IV22	Escherichia_phage	98.6	6.6e-37
VED02467.1|2474470_2475082_-	putative glutathione S-transferase	NA	NA	NA	NA	NA
VED02468.1|2475347_2476847_+	L-asparagine permease	NA	NA	NA	NA	NA
VED02469.1|2476961_2478023_-	putative receptor	NA	NA	NA	NA	NA
VED02470.1|2478264_2480367_+	TonB-dependent receptor	NA	A0A1B0VCF0	Salmonella_phage	65.3	1.8e-134
VED02471.1|2480402_2481068_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
VED02472.1|2481265_2482303_-	putative zinc-binding dehydrogenase	NA	NA	NA	NA	NA
VED02473.1|2482483_2483002_+	acetyltransferase yncA	NA	NA	NA	NA	NA
VED02474.1|2482998_2483448_+	inner membrane protein	NA	NA	NA	NA	NA
VED02475.1|2483448_2483682_-	putative cytoplasmic protein	NA	NA	NA	NA	NA
VED02476.1|2483767_2483941_-	inner membrane protein	NA	NA	NA	NA	NA
VED02477.1|2484327_2485752_-	gamma-aminobutyraldehyde dehydrogenase	NA	NA	NA	NA	NA
VED02478.1|2485773_2486568_-	transporter permease	NA	NA	NA	NA	NA
VED02479.1|2486557_2487499_-	ABC transporter permease	NA	NA	NA	NA	NA
VED02480.1|2487499_2488513_-	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	55.4	1.1e-25
VED02481.1|2488530_2489676_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
VED02482.1|2489920_2491327_-	transcriptional regulator protein YdcR	NA	NA	NA	NA	NA
VED02483.1|2491405_2491843_-	putative transcriptional regulator	NA	A0A0R6PH90	Moraxella_phage	51.1	5.0e-31
VED02484.1|2491867_2492044_-	toxin of the HicA-HicB toxin-antitoxin system	NA	A0A0M3LQ86	Mannheimia_phage	57.9	3.6e-12
VED02485.1|2492325_2492496_+	protein	NA	NA	NA	NA	NA
VED02486.1|2492587_2494549_-	putative peptidase	NA	Q6DW11	Phage_TP	28.3	2.7e-23
VED02487.1|2494621_2495158_-	putative transcriptional regulator	NA	NA	NA	NA	NA
VED02488.1|2495249_2495873_+	benzoate transporter	NA	NA	NA	NA	NA
VED02489.1|2495883_2496177_-|transposase	IS1 transposase	transposase	NA	NA	NA	NA
VED02490.1|2496305_2496581_-|transposase	IS1 transposase	transposase	A0A2L1IV22	Escherichia_phage	98.6	6.6e-37
VED02491.1|2496691_2497201_+	putative benzoate transporter	NA	NA	NA	NA	NA
VED02492.1|2497240_2498389_-|transposase	transposase	transposase	A0A1W6JP07	Morganella_phage	97.1	1.2e-204
VED02493.1|2498456_2498744_+|transposase	transposase, C-ter fragment, truncated protein	transposase	A0A1S5RHE3	Helicobacter_phage	66.7	3.1e-29
>prophage 8
LR134236	Escherichia coli strain NCTC9008 genome assembly, chromosome: 1	4757340	2921994	3023807	4757340	terminase,capsid,tail,protease,integrase,lysis,transposase,plate,tRNA,holin	Enterobacteria_phage(29.82%)	93	2970869:2970884	2998097:2998112
VED02899.1|2921994_2923395_+|tRNA	asparaginyl-tRNA synthetase	tRNA	A0A2K9V902	Bandra_megavirus	36.1	5.3e-82
VED02900.1|2923996_2925085_+	outer membrane protein F	NA	Q1MVN1	Enterobacteria_phage	54.5	2.8e-99
VED02901.1|2925269_2926460_+	aspartate aminotransferase	NA	NA	NA	NA	NA
VED02902.1|2926681_2927329_-	metal-binding hydrolase	NA	NA	NA	NA	NA
VED02903.1|2927355_2927904_-	exported protein YcbK	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	7.0e-06
VED02904.1|2928084_2929932_-	putative peptidoglycan binding domain-containing protein	NA	NA	NA	NA	NA
VED02905.1|2930192_2934653_-	chromosome partition protein	NA	NA	NA	NA	NA
VED02906.1|2934652_2935357_-	condesin subunit E	NA	NA	NA	NA	NA
VED02907.1|2935337_2936660_-	chromosome partition protein	NA	NA	NA	NA	NA
VED02908.1|2936656_2937442_-	metallothionein SmtA	NA	NA	NA	NA	NA
VED02909.1|2937577_2938357_+	inner membrane protein	NA	NA	NA	NA	NA
VED02910.1|2938333_2939227_-	Uncharacterised protein	NA	NA	NA	NA	NA
VED02911.1|2939380_2940127_-	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
VED02912.1|2940123_2940306_-	peroxide and acid resistance protein, UPF0434 family	NA	NA	NA	NA	NA
VED02913.1|2940357_2941590_-	putative cytoplasmic protein	NA	NA	NA	NA	NA
VED02914.1|2941626_2942613_-	tetraacyldisaccharide 4'-kinase (lipid A 4'-kinase)	NA	NA	NA	NA	NA
VED02915.1|2942609_2944358_-	lipid A export permease MsbA	NA	W8CYL7	Bacillus_phage	29.8	2.5e-57
VED02916.1|2944394_2946659_-	putative competence-related protein	NA	NA	NA	NA	NA
VED02917.1|2946866_2947151_-	integration host factor	NA	A7KV42	Bacillus_phage	40.2	3.2e-10
VED02918.1|2947310_2948984_-	30S ribosomal protein S1	NA	NA	NA	NA	NA
VED02919.1|2949094_2949778_-	cytidylate kinase	NA	NA	NA	NA	NA
VED02920.1|2949950_2950715_-	peptidase, M48B family	NA	NA	NA	NA	NA
VED02921.1|2950883_2952167_-	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
VED02922.1|2952237_2953326_-	phosphoserine aminotransferase	NA	M1Q1P2	Streptococcus_phage	46.8	3.5e-81
VED02923.1|2953524_2954217_-	membrane protein YcaP	NA	NA	NA	NA	NA
VED02924.1|2954346_2956107_+	putative fatty acid binding protein	NA	NA	NA	NA	NA
VED02925.1|2956512_2957370_+	formate transporter	NA	NA	NA	NA	NA
VED02926.1|2957424_2959707_+	formate acetyltransferase 1	NA	A0A2P0VNR5	Tetraselmis_virus	41.5	1.0e-162
VED02927.1|2960025_2960244_-	transcriptional activator Ogr/delta	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
VED02928.1|2960325_2961489_-	phage protein D	NA	U5N3V4	Enterobacteria_phage	99.0	1.2e-204
VED02929.1|2961488_2961968_-	gpU phage protein	NA	Q7Y4C7	Escherichia_virus	99.4	1.1e-84
VED02930.1|2961982_2964430_-|tail	phage tail tape measure protein	tail	Q7Y4C8	Escherichia_virus	97.1	0.0e+00
VED02931.1|2964574_2964850_-|tail	tail protein E (GpE)	tail	A0A0F7LDQ8	Escherichia_phage	98.9	2.2e-40
VED02932.1|2964906_2965425_-|tail	phage major tail tube protein FII	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
VED02933.1|2965437_2966628_-|tail	major tail sheath protein FI	tail	A0A0F7LBW9	Escherichia_phage	99.7	4.8e-225
VED02934.1|2966888_2967581_-	lysogenic conversion protein from Bacteriophage P2-EC53	NA	Q858R9	Enterobacteria_phage	97.8	2.3e-123
VED02935.1|2968072_2968252_+	Protein of uncharacterised function (DUF3606)	NA	NA	NA	NA	NA
VED02936.1|2968304_2968583_+	putative SinR-like protein	NA	NA	NA	NA	NA
VED02937.1|2968803_2969331_-|tail	tail assembly chaperone gp38	tail	U5N0T1	Enterobacteria_phage	93.7	1.3e-89
VED02938.1|2969334_2971464_-|tail	putative tail fiber protein (GpH)	tail	U5N099	Enterobacteria_phage	55.6	1.8e-142
2970869:2970884	attL	GCCTTTACCGCCTTTG	NA	NA	NA	NA
VED02939.1|2971474_2972005_-|tail	tail protein I (GpI)	tail	U5N0U8	Enterobacteria_phage	100.0	2.3e-102
VED02940.1|2971997_2972906_-|plate	baseplate assembly protein	plate	U5N3T9	Enterobacteria_phage	99.7	4.4e-162
VED02941.1|2972910_2973258_-|plate	phage baseplate protein	plate	A0A0F7LDQ1	Escherichia_phage	100.0	1.3e-58
VED02942.1|2973254_2973950_-|plate	Baseplate assembly protein V (GpV)	plate	A0A0F7LBP2	Escherichia_phage	99.1	7.6e-114
VED02943.1|2974117_2975659_+|transposase	transposase for ISEc12	transposase	K4I413	Acidithiobacillus_phage	46.4	1.7e-129
VED02944.1|2975673_2976420_+|transposase	transposase	transposase	U5N3V8	Enterobacteria_phage	31.6	3.5e-24
VED02945.1|2976562_2977348_+	Uncharacterised protein	NA	NA	NA	NA	NA
VED02946.1|2977419_2977872_-|tail	tail protein	tail	A0A0F7LBV9	Escherichia_phage	99.3	2.4e-76
VED02947.1|2977864_2978332_-|tail	tail protein	tail	Q7Y4E0	Escherichia_virus	98.7	4.3e-81
VED02948.1|2978294_2978453_-|lysis	phage lysis protein LysC	lysis	M1RZ27	Escherichia_phage	100.0	2.6e-22
VED02949.1|2978421_2978865_-	LysB protein	NA	U5N3W5	Enterobacteria_phage	93.6	2.7e-64
VED02950.1|2978852_2979278_-	LysA protein	NA	U5N096	Enterobacteria_phage	92.9	1.7e-55
VED02951.1|2979292_2979790_-	phage lysin	NA	A0A0F7LBS0	Escherichia_phage	100.0	3.1e-93
VED02952.1|2979789_2980071_-|holin,lysis	phage lysis holin	holin,lysis	A0A0F7LA12	Escherichia_phage	100.0	1.3e-43
VED02953.1|2980074_2980278_-|tail	phage tail protein X	tail	U5N3E7	Enterobacteria_phage	100.0	4.0e-31
VED02954.1|2980277_2980787_-|capsid	capsid completion protein	capsid	U5N0S3	Enterobacteria_phage	100.0	1.1e-90
VED02955.1|2980886_2981630_-|terminase	small terminase subunit	terminase	A0A0F7LBP7	Escherichia_phage	98.8	4.6e-125
VED02956.1|2981633_2982707_-|capsid	major capsid protein	capsid	Q94MK7	Enterobacteria_phage	99.2	5.7e-201
VED02957.1|2982765_2983620_-|capsid	phage capsid scaffolding protein	capsid	Q94MB7	Escherichia_virus	89.4	1.7e-139
VED02958.1|2983793_2985566_+	Terminase, ATPase subunit (GpP)	NA	A0A0F7LCK3	Escherichia_phage	100.0	0.0e+00
VED02959.1|2985565_2986600_+|capsid	phage capsid protein	capsid	U5N087	Enterobacteria_phage	98.5	2.3e-199
VED02960.1|2987103_2989320_+	Uncharacterized protein conserved in bacteria	NA	NA	NA	NA	NA
VED02961.1|2989328_2989424_-	Uncharacterised protein	NA	NA	NA	NA	NA
VED02962.1|2989569_2991834_-	Replication gene A protein (GpA)	NA	A0A0F7LBQ2	Escherichia_phage	98.1	0.0e+00
VED02963.1|2991823_2992099_-	relication initiation protein	NA	U5N3W1	Enterobacteria_phage	100.0	3.8e-45
VED02964.1|2992095_2992320_-	C4-type zinc finger protein, DksA/TraR family	NA	S4TRY6	Salmonella_phage	98.6	5.0e-35
VED02965.1|2992319_2992622_-	Uncharacterised protein	NA	Q7Y4C1	Escherichia_virus	96.0	5.0e-46
VED02966.1|2992621_2992846_-	Protein of uncharacterised function (DUF2732)	NA	S4TP68	Salmonella_phage	98.6	3.0e-32
VED02967.1|2992909_2993410_-	Phage protein B	NA	S4TTB7	Salmonella_phage	99.4	3.8e-91
VED02968.1|2993587_2993944_-	phage regulatory protein	NA	Q1JS28	Enterobacteria_phage	99.2	1.5e-62
VED02969.1|2994052_2994352_+	Phage protein C	NA	Q1JS29	Enterobacteria_phage	100.0	3.0e-51
VED02970.1|2994445_2995441_+|integrase	integrase	integrase	A0A0F7LBR0	Escherichia_phage	100.0	5.4e-190
VED02971.1|2995472_2996270_+	pyruvate formate lyase-activating enzyme 1	NA	A0A2P0VNQ0	Tetraselmis_virus	26.6	1.3e-21
VED02972.1|2996351_2996942_-	NAD(P)H dehydrogenase (quinone)	NA	NA	NA	NA	NA
VED02973.1|2997041_2997950_+	DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
VED02974.1|2997950_2999381_-	putative amino acid permease	NA	NA	NA	NA	NA
2998097:2998112	attR	CAAAGGCGGTAAAGGC	NA	NA	NA	NA
VED02975.1|2999590_3000739_-	major facilitator superfamily protein	NA	NA	NA	NA	NA
VED02976.1|3001052_3001679_+	protein YcaC	NA	NA	NA	NA	NA
VED02977.1|3001713_3002577_-	anaerobic dimethyl sulfoxide reductase subunit C	NA	NA	NA	NA	NA
VED02978.1|3002578_3003196_-	anaerobic dimethyl sulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	60.6	5.0e-77
VED02979.1|3003206_3005651_-	anaerobic dimethyl sulfoxide reductase chain A	NA	A0A077SK27	Escherichia_phage	49.7	1.5e-220
VED02980.1|3005889_3007182_-|tRNA	seryl-tRNA synthetase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.2	1.5e-94
VED02981.1|3007272_3008616_-	putative ATPase	NA	G3MBE0	Bacillus_virus	41.0	5.6e-81
VED02982.1|3008626_3009238_-	outer-membrane lipoprotein carrier protein	NA	NA	NA	NA	NA
VED02983.1|3009392_3013382_-	cell division protein FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	1.2e-86
VED02984.1|3013516_3014011_-	leucine-responsive transcriptional regulator	NA	NA	NA	NA	NA
VED02985.1|3014555_3015521_+	thioredoxin reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	8.5e-63
VED02986.1|3015643_3017410_+	ABC transporter ATP-binding protein/permease	NA	W8CYL7	Bacillus_phage	24.3	7.0e-23
VED02987.1|3017410_3019132_+	ABC transporter ATP-binding protein/permease	NA	W8CYL7	Bacillus_phage	25.2	1.7e-21
VED02988.1|3019173_3019878_+|tRNA	leucyl/phenylalanyl-tRNA-protein transferase	tRNA	NA	NA	NA	NA
VED02989.1|3020162_3020381_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
VED02990.1|3021179_3023456_-|protease	ATP-dependent Clp protease ATP-binding subunit	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
VED02991.1|3023486_3023807_-|protease	ATP-dependent Clp protease adaptor protein	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
>prophage 9
LR134236	Escherichia coli strain NCTC9008 genome assembly, chromosome: 1	4757340	3058755	3091483	4757340	terminase,capsid,tail,lysis,portal,plate,integrase	Salmonella_phage(86.49%)	42	3084452:3084466	3095421:3095435
VED03026.1|3058755_3058974_-	prophage P2 OGR-like protein	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
VED03027.1|3059064_3060165_-	Late control protein D protein	NA	A0A1S6KZZ5	Salmonella_phage	87.7	3.8e-176
VED03028.1|3060161_3060647_-|tail	bacteriophage tail protein GpU	tail	E5G6Q2	Salmonella_phage	81.2	1.7e-67
VED03029.1|3060643_3063721_-|tail	putative phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	68.8	0.0e+00
VED03030.1|3063847_3064150_-|tail	tail E family protein	tail	A0A1S6KZZ9	Salmonella_phage	89.0	5.3e-40
VED03031.1|3064204_3064720_-|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	94.7	4.8e-89
VED03032.1|3064729_3065902_-|tail	tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.0	3.9e-203
VED03033.1|3066008_3066422_-|tail	tail fiber assembly protein	tail	U5P0S4	Shigella_phage	74.3	4.0e-22
VED03034.1|3066421_3068509_-|tail	tail fiber domain-containing protein	tail	A0A0F7LDR4	Escherichia_phage	42.7	3.9e-73
VED03035.1|3068505_3069111_-|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	92.0	9.8e-110
VED03036.1|3069103_3070012_-|plate	Baseplate assembly protein GpJ	plate	A0A1S6KZY6	Salmonella_phage	90.4	2.0e-143
VED03037.1|3069998_3070358_-	GPW/gp25 family protein	NA	A0A1S6KZZ4	Salmonella_phage	87.4	1.5e-52
VED03038.1|3070354_3070933_-|plate	phage baseplate assembly protein V	plate	A0A1S6KZX7	Salmonella_phage	86.5	2.1e-93
VED03039.1|3071041_3072793_+	Uncharacterised protein	NA	NA	NA	NA	NA
VED03040.1|3072818_3073262_-|tail	phage tail completion protein	tail	A0A1S6L001	Salmonella_phage	78.8	2.3e-55
VED03041.1|3073254_3073686_-|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	92.3	2.4e-70
VED03042.1|3073781_3074210_-|lysis	lysis-like protein	lysis	E5G6N2	Salmonella_phage	86.5	5.8e-56
VED03043.1|3074206_3074722_-	glycoside hydrolase family protein	NA	E5G6N1	Salmonella_phage	92.4	1.3e-89
VED03044.1|3074702_3074918_-	putative secretory protein	NA	E5G6N0	Salmonella_phage	80.3	1.8e-26
VED03045.1|3074921_3075125_-|tail	tail X family protein	tail	E5G6M9	Salmonella_phage	92.5	1.4e-31
VED03046.1|3075124_3075589_-|capsid	capsid completion protein	capsid	A0A1S6KZW8	Salmonella_phage	89.6	6.4e-77
VED03047.1|3075684_3076335_-|terminase	small terminase subunit	terminase	E5G6M7	Salmonella_phage	95.8	1.5e-111
VED03048.1|3076338_3077394_-|capsid	P2 family phage major capsid protein	capsid	E5G6M6	Salmonella_phage	93.4	2.9e-181
VED03049.1|3077410_3078244_-|capsid	capsid scaffolding	capsid	A0A1S6KZW9	Salmonella_phage	91.7	1.5e-121
VED03050.1|3078386_3080153_+	Terminase, ATPase subunit	NA	A0A1S6KZW3	Salmonella_phage	99.3	0.0e+00
VED03051.1|3080152_3081184_+|capsid,portal	capsid portal protein	capsid,portal	A0A1S6KZW5	Salmonella_phage	87.3	2.2e-170
VED03052.1|3081224_3081842_-	MTH538 TIR-like domain (DUF1863)	NA	NA	NA	NA	NA
VED03053.1|3081841_3082573_-	Uncharacterised protein	NA	NA	NA	NA	NA
VED03054.1|3082917_3083595_-	Uncharacterised protein	NA	NA	NA	NA	NA
VED03055.1|3083708_3083942_-	Prophage protein	NA	E5G6M1	Salmonella_phage	100.0	4.7e-36
VED03056.1|3083952_3084141_-	Uncharacterised protein	NA	E5G6M0	Salmonella_phage	96.8	1.6e-26
VED03057.1|3084293_3086708_-	putative replication protein for prophage	NA	E5G6L9	Salmonella_phage	98.0	0.0e+00
3084452:3084466	attL	GCTGTCGCTGATGGT	NA	NA	NA	NA
VED03058.1|3086704_3087562_-	site-specific DNA-methyltransferase	NA	E5G6L8	Salmonella_phage	97.9	7.1e-162
VED03059.1|3087558_3087786_-	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	100.0	2.7e-36
VED03060.1|3087785_3088019_-	Protein of uncharacterised function (DUF2732)	NA	E5G6L6	Salmonella_phage	98.7	6.4e-33
VED03061.1|3088086_3088428_-	Uncharacterised protein	NA	E5G6L5	Salmonella_phage	99.1	6.0e-56
VED03062.1|3088391_3088592_-	Protein of uncharacterised function (DUF2724)	NA	E5G6L4	Salmonella_phage	98.5	7.1e-33
VED03063.1|3088599_3089109_-	phage regulatory protein CII	NA	E5G6L3	Salmonella_phage	98.2	1.3e-86
VED03064.1|3089141_3089363_-	ybl30	NA	NA	NA	NA	NA
VED03065.1|3089488_3090058_+	repressor protein	NA	A0A1S6KZZ7	Salmonella_phage	42.9	7.2e-38
VED03066.1|3090073_3090265_+	Uncharacterised protein	NA	A0A0R6PIH8	Moraxella_phage	68.2	4.0e-09
VED03067.1|3090451_3091483_+|integrase	integrase	integrase	A0A218M4I3	Erwinia_phage	56.7	5.6e-105
3095421:3095435	attR	ACCATCAGCGACAGC	NA	NA	NA	NA
>prophage 10
LR134236	Escherichia coli strain NCTC9008 genome assembly, chromosome: 1	4757340	3159374	3220649	4757340	terminase,capsid,coat,tail,lysis,portal,transposase,tRNA,integrase,head	Enterobacteria_phage(56.14%)	75	3185161:3185176	3229619:3229634
VED03132.1|3159374_3159650_+|transposase	IS1 transposase	transposase	A0A2L1IV22	Escherichia_phage	98.6	6.6e-37
VED03133.1|3159778_3160072_+|transposase	IS1 transposase	transposase	NA	NA	NA	NA
VED03134.1|3160146_3160851_-	inner membrane protein	NA	NA	NA	NA	NA
VED03135.1|3160987_3161440_-	molybdopterin converting factor subunit 2	NA	NA	NA	NA	NA
VED03136.1|3161441_3161687_-	molybdopterin converting factor subunit 1	NA	NA	NA	NA	NA
VED03137.1|3161679_3162165_-	molybdenum cofactor biosynthesis protein C	NA	NA	NA	NA	NA
VED03138.1|3162167_3162680_-	molybdenum cofactor biosynthesis protein B	NA	NA	NA	NA	NA
VED03139.1|3164087_3164996_+	transferase with NAD(P)-binding Rossmann-fold domain; UPF0052 family	NA	A1IMD5	Streptococcus_phage	31.1	1.4e-27
VED03140.1|3165187_3167209_-	UvrABC system protein B (excinuclease ABC subunit B)	NA	NA	NA	NA	NA
VED03141.1|3167787_3168465_-	dithiobiotin synthetase	NA	NA	NA	NA	NA
VED03142.1|3168457_3169213_-	biotin biosynthesis protein BioC	NA	NA	NA	NA	NA
VED03143.1|3169199_3170354_-	8-amino-7-oxononanoate synthase	NA	NA	NA	NA	NA
VED03144.1|3170350_3171391_-	biotin synthetase	NA	NA	NA	NA	NA
VED03145.1|3171477_3172767_+	adenosylmethionine-8-amino-7-oxononanoate aminotransferase	NA	A0A1V0SKB7	Klosneuvirus	29.0	7.7e-19
VED03146.1|3172825_3173302_+	putative phosphatidylethanolamine-binding protein	NA	NA	NA	NA	NA
VED03147.1|3173631_3173847_-	Transposase IS3/IS911 family protein	NA	U5P4I9	Shigella_phage	88.5	1.4e-18
VED03148.1|3174009_3174363_+	IS2 ORF2	NA	Q9ZXG3	Shigella_phage	69.9	3.7e-40
VED03149.1|3174404_3175148_-	putative AraC-type regulatory protein encoded in prophage CP-933H	NA	NA	NA	NA	NA
VED03150.1|3177234_3179142_-|tail	tail fiber protein	tail	X2KTY7	Enterobacteria_phage	61.2	1.4e-05
VED03151.1|3179278_3180016_+	Uncharacterised protein	NA	NA	NA	NA	NA
VED03152.1|3180577_3181177_-	outer membrane precursor Lom	NA	Q687E7	Enterobacteria_phage	96.0	1.8e-108
VED03153.1|3181246_3184744_-	Host specificity protein J of prophage	NA	A0A291AWT4	Escherichia_phage	98.6	0.0e+00
VED03154.1|3184803_3185376_-|tail	phage tail assembly protein	tail	A0A0K2FJB0	Escherichia_phage	98.4	7.4e-83
3185161:3185176	attL	AATCTGGAATACGCCA	NA	NA	NA	NA
VED03155.1|3185372_3186116_-|tail	putative tail fiber component K of prophage	tail	K7PLW1	Enterobacteria_phage	96.8	2.5e-147
VED03156.1|3186121_3186820_-|tail	phage minor tail protein	tail	A0A0K2FJ01	Enterobacteria_phage	100.0	2.3e-134
VED03157.1|3186819_3187149_-|tail	Minor tail protein M	tail	A0A0K2FIE9	Enterobacteria_phage	100.0	9.6e-59
VED03158.1|3187145_3189725_-|tail	putative phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	93.8	0.0e+00
VED03159.1|3189717_3190152_-|tail	minor tail protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
VED03160.1|3190133_3190556_-|tail	phage minor tail protein	tail	A0A0K2FIQ8	Enterobacteria_phage	100.0	6.7e-73
VED03161.1|3190571_3191312_-|tail	Major tail protein V	tail	A0A0K2FJ05	Enterobacteria_phage	98.4	2.1e-130
VED03162.1|3191319_3191715_-|tail	phage minor tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	100.0	1.0e-70
VED03163.1|3191711_3192290_-|tail	Minor tail protein Z (GpZ)	tail	A0A2R9YJK4	Escherichia_phage	99.5	5.9e-80
VED03164.1|3192301_3192655_-|capsid	minor capsid protein	capsid	A0A2R9YJJ5	Escherichia_phage	98.3	4.4e-62
VED03165.1|3192666_3193062_-	DNA packaging protein from bacteriophage origin	NA	A0A2R9YJP4	Escherichia_phage	92.4	1.0e-54
VED03166.1|3193103_3194129_-|head,coat	phage major head protein (major coat protein)	head,coat	C6ZCY2	Enterobacteria_phage	97.9	3.6e-189
VED03167.1|3194184_3194517_-	Head decoration protein from bacteriophage origin	NA	A0A2R9YJN3	Escherichia_phage	100.0	1.7e-55
VED03168.1|3194526_3195846_-|capsid	minor capsid protein C from bacteriophage origin	capsid	A0A0K2FI53	Enterobacteria_phage	99.3	2.5e-235
VED03169.1|3195826_3197428_-|capsid,portal	phage portal protein (minor capsid protein)	capsid,portal	A0A0K2FJC0	Enterobacteria_phage	99.2	2.9e-310
VED03170.1|3197424_3197631_-|head,tail	head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
VED03171.1|3197627_3199553_-|terminase	phage terminase large subunit	terminase	A0A0K2FJ14	Enterobacteria_phage	99.8	0.0e+00
VED03172.1|3199527_3200073_-	prophage qsr' DNA packaging protein NU1-like protein	NA	A0A0K2FIG2	Enterobacteria_phage	99.4	4.7e-95
VED03173.1|3200752_3201163_+	phage protein	NA	C6ZCX4	Enterobacteria_phage	76.3	1.3e-52
VED03174.1|3201208_3201373_+|tRNA	Arginyl-tRNA synthetase	tRNA	NA	NA	NA	NA
VED03175.1|3201841_3202330_-	T5orf172 domain	NA	K7P7S3	Enterobacteria_phage	99.4	1.6e-86
VED03176.1|3202535_3202994_-	Putative endopeptidase	NA	K7PJW6	Enterobacteria_phage	80.3	6.2e-56
VED03177.1|3202990_3203488_-	phage lysozome	NA	M1FJA0	Enterobacteria_phage	95.2	5.6e-87
VED03178.1|3203487_3203703_-|lysis	lysis protein S from lambdoid prophage	lysis	A5LH82	Enterobacteria_phage	100.0	2.6e-33
VED03179.1|3204275_3205373_+	outer membrane porin; DLP12 prophage	NA	Q1MVN1	Enterobacteria_phage	77.1	6.7e-157
VED03180.1|3205562_3205946_-	lambdoid prophage DLP12 antitermination protein Q	NA	A0A088CD47	Shigella_phage	83.3	4.4e-55
VED03181.1|3206031_3206169_-	DLP12 prophage; small protein	NA	K7PHH3	Enterobacteria_phage	73.2	2.9e-09
VED03182.1|3206168_3206531_-	endodeoxyribonuclease RUS	NA	K7PM48	Enterobacteria_phage	96.6	1.5e-60
VED03183.1|3206737_3207079_-	putative protein ninx	NA	Q76H72	Enterobacteria_phage	96.5	1.6e-61
VED03184.1|3207254_3207782_-	DNA N-6-adenine-methyltransferase of bacteriophage	NA	A0A1I9LJP9	Stx_converting_phage	100.0	9.5e-101
VED03185.1|3207778_3208219_-	recombination protein ninB from phage origin	NA	A0A220NRM1	Escherichia_phage	100.0	7.0e-81
VED03186.1|3208292_3208583_-	putative exclusion protein Ren of prophage	NA	K7P7K7	Enterobacteria_phage	100.0	9.6e-47
VED03187.1|3208579_3209281_-	replication protein P of bacteriophage	NA	A0A0K2FIT1	Enterobacteria_phage	99.6	1.7e-129
VED03188.1|3209277_3210177_-	replication protein from bacteriophage origin	NA	A0A0K2FJ31	Enterobacteria_phage	99.7	5.5e-173
VED03189.1|3210209_3210509_-	regulatory protein	NA	A0A0P0ZBJ0	Stx2-converting_phage	96.0	2.0e-47
VED03190.1|3210615_3210843_-	regulatory protein from bacteriophage origin	NA	G9L677	Escherichia_phage	100.0	7.8e-36
VED03191.1|3210921_3211629_+	phage repressor protein CI	NA	G9L676	Escherichia_phage	98.3	2.8e-132
VED03192.1|3211758_3212658_+	Uncharacterised protein	NA	NA	NA	NA	NA
VED03193.1|3212886_3213102_-	Uncharacterised protein	NA	NA	NA	NA	NA
VED03194.1|3213425_3214007_-	putative superinfection exclusion protein B of prophage	NA	K7P6T7	Enterobacteria_phage	92.2	1.5e-91
VED03195.1|3214220_3214421_+	restriction alleviation protein	NA	A5VWA0	Enterobacteria_phage	98.5	7.1e-33
VED03196.1|3214603_3214972_+	putative single-stranded DNA binding protein of prophage	NA	M1FPD2	Enterobacteria_phage	100.0	2.0e-65
VED03197.1|3215177_3215321_+	Kil protein of bacteriphage BP-933W	NA	A0A0N7C2U2	Escherichia_phage	95.7	1.8e-17
VED03198.1|3215395_3215692_+	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	100.0	1.6e-49
VED03199.1|3215697_3216483_+	bacteriophage recombination protein	NA	A0A1I9LJN0	Stx_converting_phage	99.6	1.4e-148
VED03200.1|3216479_3217160_+	exonuclease	NA	Q6H9Z0	Enterobacteria_phage	99.6	3.5e-132
VED03201.1|3217156_3217339_+	phage protein	NA	A0A0P0ZD61	Stx2-converting_phage	96.7	3.7e-28
VED03202.1|3217311_3217503_+	phage protein	NA	A0A0P0ZC67	Stx2-converting_phage	98.4	9.5e-27
VED03203.1|3217579_3217795_+	ybl17	NA	A0A1I9LJM7	Stx_converting_phage	100.0	1.0e-32
VED03204.1|3218325_3218475_-	putative transmembrane protein	NA	NA	NA	NA	NA
VED03205.1|3219170_3219338_+	Uncharacterised protein	NA	A5VWB7	Enterobacteria_phage	98.2	2.9e-27
VED03206.1|3219878_3220649_+|integrase	phage integrase	integrase	K7P6P6	Enterobacteria_phage	99.6	1.2e-139
3229619:3229634	attR	AATCTGGAATACGCCA	NA	NA	NA	NA
>prophage 11
LR134236	Escherichia coli strain NCTC9008 genome assembly, chromosome: 1	4757340	3672456	3698076	4757340	holin,transposase	Escherichia_phage(57.14%)	23	NA	NA
VED03610.1|3672456_3674490_-|holin	high-affinity choline transport protein (BCCT-family transporter)	holin	A0A2I7QNT1	Vibrio_phage	27.4	3.4e-21
VED03611.1|3674618_3675206_+	transcriptional regulator BetI	NA	NA	NA	NA	NA
VED03612.1|3675219_3676692_+	betaine aldehyde dehydrogenase	NA	NA	NA	NA	NA
VED03613.1|3676705_3678376_+|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.2	3.1e-60
VED03614.1|3678588_3679257_+	inner membrane protein	NA	NA	NA	NA	NA
VED03615.1|3679499_3680195_-	transporter	NA	NA	NA	NA	NA
VED03616.1|3680187_3681615_-	putative electron transport protein YkgF	NA	NA	NA	NA	NA
VED03617.1|3681625_3682345_-	hydroxyacid oxidoreductase (Fe-S centre)	NA	NA	NA	NA	NA
VED03618.1|3682871_3683726_-	transcriptional regulator YkgD	NA	NA	NA	NA	NA
VED03619.1|3683951_3685277_+	putative pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	47.6	2.5e-113
VED03620.1|3685633_3686227_+	inner membrane protein	NA	NA	NA	NA	NA
VED03621.1|3686816_3687668_+	Putatve transcriptional regulator ykgA	NA	NA	NA	NA	NA
VED03622.1|3687624_3687783_+	Uncharacterised protein	NA	NA	NA	NA	NA
VED03623.1|3687807_3692064_-	Ig domain-containing protein	NA	NA	NA	NA	NA
VED03624.1|3693178_3693280_+	small predicted membrane protein	NA	NA	NA	NA	NA
VED03625.1|3693639_3693906_+	50S ribosomal protein L31	NA	NA	NA	NA	NA
VED03626.1|3693905_3694046_+	50S ribosomal protein L36	NA	NA	NA	NA	NA
VED03627.1|3694864_3695242_-|transposase	IS1 transposase	transposase	Q71TF0	Escherichia_phage	100.0	1.3e-67
VED03628.1|3695286_3695562_-|transposase	IS1 transposase	transposase	A0A2L1IV22	Escherichia_phage	98.6	6.6e-37
VED03629.1|3695715_3696666_-	magnesium and cobalt transport protein CorA	NA	NA	NA	NA	NA
VED03630.1|3697035_3697350_+	protein	NA	NA	NA	NA	NA
VED03631.1|3697378_3697654_+|transposase	IS1 transposase	transposase	A0A2L1IV22	Escherichia_phage	98.6	6.6e-37
VED03632.1|3697698_3698076_+|transposase	IS1 transposase	transposase	Q71TF0	Escherichia_phage	100.0	1.3e-67
>prophage 12
LR134236	Escherichia coli strain NCTC9008 genome assembly, chromosome: 1	4757340	3703716	3733562	4757340	protease,transposase	Streptococcus_phage(25.0%)	33	NA	NA
VED03642.1|3703716_3706206_-|protease	putative serine protease	protease	NA	NA	NA	NA
VED03643.1|3706214_3707201_-	ATPase	NA	E5EQU5	Bathycoccus_sp._RCC1105_virus	27.6	4.8e-13
VED03644.1|3707855_3709109_-	gamma-glutamyl phosphate reductase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	9.8e-96
VED03645.1|3709120_3710224_-	gamma-glutamyl kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
VED03646.1|3710511_3711567_+	outer membrane phosphoporin protein E	NA	Q1MVN1	Enterobacteria_phage	61.1	9.1e-119
VED03647.1|3711605_3712007_-	sigma factor-binding protein crl (curlin genes transcriptional activator)	NA	NA	NA	NA	NA
VED03648.1|3712064_3713309_-	esterase	NA	NA	NA	NA	NA
VED03649.1|3713400_3713859_-	xanthine-guanine phosphoribosyltransferase	NA	NA	NA	NA	NA
VED03650.1|3714119_3715577_+	aminoacyl-histidine dipeptidase	NA	NA	NA	NA	NA
VED03651.1|3715633_3716134_-	peptide chain release factor H	NA	NA	NA	NA	NA
VED03652.1|3716102_3716369_-	ykfJ	NA	NA	NA	NA	NA
VED03653.1|3716602_3716977_-	putative acetyltransferase	NA	NA	NA	NA	NA
VED03654.1|3717064_3717463_-	toxin YafO	NA	NA	NA	NA	NA
VED03655.1|3717465_3717759_-	antitoxin of the YafO-YafN toxin-antitoxin system	NA	NA	NA	NA	NA
VED03656.1|3717810_3718866_-	DNA polymerase IV	NA	NA	NA	NA	NA
VED03657.1|3718936_3719572_-	Chemotaxis protein MotB	NA	NA	NA	NA	NA
VED03658.1|3719666_3721406_+	flagellar system protein	NA	NA	NA	NA	NA
VED03659.1|3721621_3722119_-|transposase	RAYT REP element-mobilizing transposase; TnpA(REP)	transposase	NA	NA	NA	NA
VED03660.1|3722294_3723068_-	NlpC/P60 family protein	NA	A0A1V0DZX6	Clostridioides_phage	37.7	1.2e-19
VED03661.1|3723253_3723514_+	antitoxin of YafQ-DinJ toxin-antitoxin system	NA	NA	NA	NA	NA
VED03662.1|3723516_3723795_+	toxin of the YafQ-DinJ toxin-antitoxin system	NA	NA	NA	NA	NA
VED03663.1|3723950_3724691_+	membrane protein	NA	NA	NA	NA	NA
VED03664.1|3724661_3725429_-	amidotransferase	NA	NA	NA	NA	NA
VED03665.1|3725572_3726151_-	phosphoheptose isomerase	NA	A0A067XQR2	Caulobacter_phage	32.0	1.1e-14
VED03666.1|3726390_3728835_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
VED03667.1|3728877_3729351_-	inhibitor of vertebrate lysozyme precursor	NA	NA	NA	NA	NA
VED03668.1|3729504_3730275_+	putative carbon-nitrogen hydrolase	NA	NA	NA	NA	NA
VED03669.1|3730255_3730387_+	Uncharacterised protein	NA	NA	NA	NA	NA
VED03670.1|3730568_3730700_-	H repeat-containing Rhs element protein	NA	NA	NA	NA	NA
VED03671.1|3731067_3731361_-|transposase	IS1 transposase	transposase	NA	NA	NA	NA
VED03672.1|3731489_3731765_-|transposase	IS1 transposase	transposase	A0A2L1IV22	Escherichia_phage	98.6	6.6e-37
VED03673.1|3731852_3732470_+|transposase	transposase, IS30	transposase	NA	NA	NA	NA
VED03674.1|3732743_3733562_+|transposase	IS600 orfAB' transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.9	1.3e-64
>prophage 13
LR134236	Escherichia coli strain NCTC9008 genome assembly, chromosome: 1	4757340	4135600	4145624	4757340	transposase	Shigella_phage(30.0%)	11	NA	NA
VED04040.1|4135600_4136557_+	iron-dicitrate transporter subunit FecD	NA	A0A2H4IY97	uncultured_Caudovirales_phage	26.1	1.1e-17
VED04041.1|4136557_4137325_+	iron(III) dicitrate transport system, ATP-binding protein	NA	G3M9Y6	Bacillus_virus	24.8	6.4e-13
VED04042.1|4137882_4138140_-	KpLE2 phage-like element	NA	NA	NA	NA	NA
VED04043.1|4138222_4138465_-|transposase	putative transposase	transposase	Q716C2	Shigella_phage	92.4	4.7e-39
VED04044.1|4138461_4138875_-|transposase	transposase ORF B (fragment), IS911	transposase	Q716C2	Shigella_phage	95.6	1.5e-61
VED04045.1|4139191_4140343_+|transposase	IS30 transposase encoded within prophage CP-933T	transposase	W5R8L2	Staphylococcus_phage	36.0	2.6e-42
VED04046.1|4140262_4140613_-|transposase	transposase ORF A, IS3 family	transposase	Q716C1	Shigella_phage	97.7	8.9e-39
VED04047.1|4140713_4141286_+	lysogenic conversion protein from Bacteriophage P2-EC53	NA	Q858R9	Enterobacteria_phage	69.0	2.2e-71
VED04048.1|4141334_4142159_-	Uncharacterised protein	NA	L7TR00	Rhizobium_phage	35.5	3.0e-16
VED04049.1|4142972_4143992_+	oxidoreductase	NA	A0A0G2Y405	Acanthamoeba_polyphaga_mimivirus	30.7	8.4e-45
VED04050.1|4144121_4145624_+	ATPase	NA	A0A248XCZ8	Klebsiella_phage	45.1	2.7e-84
