The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
LR134234	Escherichia coli strain NCTC8623 genome assembly, chromosome: 1	4943400	2203	24066	4943400	portal,terminase,plate,tail,capsid	Salmonella_phage(90.32%)	32	NA	NA
VED15109.1|2203_3229_-|capsid,portal	capsid portal protein	capsid,portal	E5G6M3	Salmonella_phage	87.6	6.4e-170
VED15111.1|3228_3399_-	Terminase, ATPase subunit	NA	E5G6M4	Salmonella_phage	100.0	1.5e-23
VED15113.1|3430_3712_-	Terminase, ATPase subunit	NA	A0A1S6KZW3	Salmonella_phage	98.9	7.2e-47
VED15115.1|3683_3938_-	Terminase, ATPase subunit	NA	A0A1S6KZW3	Salmonella_phage	98.7	2.2e-39
VED15117.1|3964_4204_-	Terminase, ATPase subunit	NA	A0A1S6KZW3	Salmonella_phage	96.1	3.3e-37
VED15121.1|4453_4999_-	Terminase, ATPase subunit	NA	A0A1S6KZW3	Salmonella_phage	99.4	1.9e-99
VED15126.1|5141_5729_+|capsid	capsid scaffolding	capsid	A0A1S6KZW9	Salmonella_phage	91.6	9.9e-91
VED15128.1|5997_6321_+|capsid	P2 family phage major capsid protein	capsid	E5G6M6	Salmonella_phage	93.3	1.4e-46
VED15130.1|6286_6934_+|capsid	P2 family phage major capsid protein	capsid	E5G6M6	Salmonella_phage	92.7	2.7e-105
VED15132.1|7061_7703_+|terminase	small terminase subunit	terminase	E5G6M7	Salmonella_phage	89.3	1.7e-96
VED15135.1|7807_8272_+|capsid	capsid completion protein	capsid	A0A1S6KZW8	Salmonella_phage	89.6	6.4e-77
VED15137.1|8586_8964_+	glycoside hydrolase family protein	NA	A0A1S6KZY9	Salmonella_phage	95.3	4.1e-29
VED15139.1|8927_9191_+	glycoside hydrolase family protein	NA	E5G6N1	Salmonella_phage	89.5	7.9e-40
VED15141.1|9192_9543_+	membrane protein	NA	A0A1S6KZZ2	Salmonella_phage	40.9	1.0e-13
VED15143.1|9589_9844_+	regulatory protein	NA	A0A1S6KZX8	Salmonella_phage	72.4	4.4e-19
VED15145.1|10092_10524_+|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	93.7	7.6e-72
VED15148.1|10725_10962_+|tail	phage tail protein	tail	E5G6N4	Salmonella_phage	86.8	1.3e-30
VED15150.1|11211_11610_+|plate	phage baseplate assembly protein V	plate	A0A1S6KZX7	Salmonella_phage	86.2	8.9e-59
VED15152.1|11606_11966_+	GPW/gp25 family protein	NA	A0A1S6KZZ4	Salmonella_phage	85.7	2.8e-51
VED15154.1|11952_12861_+|plate	Baseplate assembly protein GpJ	plate	A0A1S6KZY6	Salmonella_phage	90.7	2.7e-143
VED15157.1|12853_13459_+|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	92.5	2.6e-110
VED15160.1|13455_15042_+|tail	variable tail fiber protein	tail	M1TAS6	Escherichia_phage	73.5	1.9e-208
VED15162.1|15041_15647_+|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	84.4	1.4e-92
VED15164.1|15615_15813_-	Uncharacterised protein	NA	NA	NA	NA	NA
VED15166.1|16210_16777_+	site-specific DNA recombinase; e14 prophage	NA	A0A1S6L009	Salmonella_phage	84.2	4.9e-87
VED15167.1|16919_18092_+|tail	tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.3	7.8e-204
VED15168.1|18101_18617_+|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	95.3	2.1e-89
VED15169.1|18671_18974_+|tail	tail E family protein	tail	A0A1S6KZZ9	Salmonella_phage	88.0	1.6e-39
VED15170.1|19100_22178_+|tail	putative phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	69.0	0.0e+00
VED15171.1|22174_22660_+|tail	bacteriophage tail protein GpU	tail	E5G6Q2	Salmonella_phage	81.2	1.7e-67
VED15172.1|22656_23757_+	Late control protein D protein	NA	A0A1S6KZZ5	Salmonella_phage	87.7	6.5e-176
VED15173.1|23847_24066_+	prophage P2 OGR-like protein	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
>prophage 2
LR134234	Escherichia coli strain NCTC8623 genome assembly, chromosome: 1	4943400	740534	793446	4943400	lysis,portal,head,integrase,terminase,transposase,tail,capsid,coat	Enterobacteria_phage(37.78%)	64	765713:765728	798142:798157
VED15815.1|740534_742130_-|tail	putative tail fiber protein	tail	K7PHC9	Enterobacteria_phage	66.5	7.4e-48
VED15816.1|742260_742998_+	Uncharacterised protein	NA	NA	NA	NA	NA
VED15817.1|743559_744159_-	membrane protein, Lom/All family	NA	H6WZM8	Escherichia_phage	94.0	2.5e-105
VED15818.1|744226_747706_-	Host specificity protein J of prophage	NA	A0A291AWT4	Escherichia_phage	90.5	0.0e+00
VED15819.1|747766_748339_-|tail	phage tail assembly protein	tail	A0A0K2FJB0	Escherichia_phage	98.9	2.0e-83
VED15820.1|748335_749079_-|tail	putative tail fiber component K of prophage	tail	K7PLW1	Enterobacteria_phage	96.0	6.1e-146
VED15821.1|749084_749783_-|tail	phage minor tail protein	tail	A0A0K2FJ01	Enterobacteria_phage	99.1	5.6e-133
VED15822.1|749782_750112_-|tail	Minor tail protein M	tail	A0A2R9YJM0	Escherichia_phage	100.0	2.5e-59
VED15823.1|750108_752688_-|tail	putative phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	95.1	0.0e+00
VED15824.1|752680_753115_-|tail	minor tail protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
VED15825.1|753096_753519_-|tail	phage minor tail protein	tail	A0A0K2FIQ8	Enterobacteria_phage	97.1	2.4e-70
VED15826.1|753534_754275_-|tail	Major tail protein V	tail	A0A0K2FJ05	Enterobacteria_phage	97.2	5.2e-129
VED15827.1|754282_754678_-|tail	phage minor tail protein	tail	A0A2R9YJI2	Escherichia_phage	99.2	6.5e-70
VED15828.1|754674_755253_-|tail	Minor tail protein Z (GpZ)	tail	A0A2R9YJK4	Escherichia_phage	99.5	5.9e-80
VED15829.1|755264_755618_-|capsid	minor capsid protein	capsid	A0A2R9YJJ5	Escherichia_phage	97.4	6.4e-61
VED15830.1|755629_756025_-	DNA packaging protein from bacteriophage origin	NA	A0A2R9YJP4	Escherichia_phage	95.5	1.1e-58
VED15831.1|756066_757092_-|head,coat	phage major head protein (major coat protein)	head,coat	C6ZCY2	Enterobacteria_phage	97.9	4.0e-188
VED15832.1|757147_757480_-	Head decoration protein from bacteriophage origin	NA	A0A2R9YJN3	Escherichia_phage	98.2	2.5e-54
VED15833.1|757489_758809_-|capsid	minor capsid protein C from bacteriophage origin	capsid	A0A0K2FI53	Enterobacteria_phage	98.9	1.3e-234
VED15834.1|758789_760391_-|capsid,portal	phage portal protein (minor capsid protein)	capsid,portal	A0A0K2FJC0	Enterobacteria_phage	99.4	1.3e-310
VED15835.1|760387_760594_-|head,tail	head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
VED15836.1|760590_762516_-|terminase	phage terminase large subunit	terminase	A0A0K2FJ14	Enterobacteria_phage	99.7	0.0e+00
VED15837.1|762490_763036_-	prophage qsr' DNA packaging protein NU1-like protein	NA	A0A0K2FIG2	Enterobacteria_phage	97.8	5.2e-94
VED15838.1|763424_763658_+	Qin prophage	NA	A0A0K2FIR8	Escherichia_phage	82.5	5.6e-21
VED15839.1|763715_764126_+	Qin prophage	NA	C6ZCX4	Enterobacteria_phage	79.4	2.5e-56
VED15840.1|764277_764451_-	GnsA/GnsB family transcriptional regulator	NA	NA	NA	NA	NA
VED15841.1|765699_766197_-	Qin prophage protein	NA	A0A291LBG9	Klebsiella_phage	29.5	2.9e-06
765713:765728	attL	TTTTTATCTCTTAAAG	NA	NA	NA	NA
VED15842.1|766193_766727_-	prophage lysozyme (endolysin)	NA	K7PLY1	Enterobacteria_phage	93.2	6.4e-97
VED15843.1|766723_767035_-	Qin prophage protein	NA	K7PGU6	Enterobacteria_phage	64.6	2.0e-26
VED15844.1|767039_767246_-|lysis	phage lysis protein	lysis	A5LH82	Enterobacteria_phage	94.1	4.5e-30
VED15845.1|767287_767407_+	Uncharacterised protein	NA	NA	NA	NA	NA
VED15846.1|768524_768737_+	cold shock-like protein CspF	NA	NA	NA	NA	NA
VED15847.1|769158_769911_-	lambdoid prophage Qin antitermination protein Q-like protein	NA	A0A192Y5X6	Salmonella_phage	92.8	7.1e-134
VED15848.1|769924_770974_-	putative prophage protein	NA	A0A291AWV9	Escherichia_phage	57.3	1.3e-112
VED15849.1|771320_771572_-	putative prophage protein	NA	NA	NA	NA	NA
VED15850.1|771788_771944_-	putative host cell-killing modulation protein	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
VED15851.1|772015_772303_-	toxin of the RelE-RelB toxin-antitoxin system	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	66.0	1.4e-29
VED15852.1|772302_772542_-	antitoxin of the RelE-RelB toxin-antitoxin system and transcriptional repressor of relBEF	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	54.4	1.6e-18
VED15853.1|773074_773407_+	Qin prophage protein	NA	NA	NA	NA	NA
VED15854.1|773843_775157_-|integrase,transposase	putative integrase/transposase	integrase,transposase	NA	NA	NA	NA
VED15855.1|775491_775671_-	membrane protein	NA	NA	NA	NA	NA
VED15856.1|776823_777180_-	putative methyltransferase	NA	H9C170	Pectobacterium_phage	69.6	1.6e-38
VED15857.1|777176_777599_-	putative prophage protein	NA	A0A0U2QQN3	Escherichia_phage	92.0	4.4e-64
VED15858.1|777639_778605_-	ybl78	NA	U5P0A0	Shigella_phage	60.2	2.2e-55
VED15859.1|778585_779107_-	YdfX	NA	NA	NA	NA	NA
VED15860.1|779090_779321_-	repressor protein of division inhibition gene	NA	NA	NA	NA	NA
VED15861.1|779404_779812_+	repressor protein of division inhibition gene	NA	K7PM82	Enterobacteria_phage	54.7	4.4e-13
VED15862.1|779978_780134_+	putative prophage protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
VED15863.1|780135_780264_+	putative prophage protein	NA	NA	NA	NA	NA
VED15864.1|780293_780512_+	putative prophage protein	NA	NA	NA	NA	NA
VED15865.1|780515_780680_-	Uncharacterised protein	NA	NA	NA	NA	NA
VED15866.1|781079_781268_+	division inhibition protein	NA	NA	NA	NA	NA
VED15867.1|781264_781456_+	putative prophage protein	NA	NA	NA	NA	NA
VED15868.1|781548_784020_+	putative exonuclease from phage origin	NA	A0A192Y6E0	Salmonella_phage	56.7	8.5e-59
VED15869.1|784107_784344_+	putative excisionase	NA	S4TND0	Salmonella_phage	50.7	6.1e-15
VED15870.1|784378_785659_+|integrase	defective integrase; Qin prophage	integrase	B6DZ48	Enterobacteria_phage	62.1	3.3e-155
VED15871.1|785846_786866_-	dehydrogenase	NA	E3SJ82	Synechococcus_phage	25.9	9.7e-17
VED15872.1|786880_788092_-	starvation sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.8e-46
VED15873.1|788297_788624_-	inner membrane protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
VED15874.1|788758_789100_+	protein	NA	NA	NA	NA	NA
VED15875.1|789134_789695_+	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
VED15876.1|789697_790444_-	lipoprotein	NA	NA	NA	NA	NA
VED15877.1|790515_790821_+	protein	NA	NA	NA	NA	NA
VED15878.1|791019_793446_+	putative dimethyl sulfoxide reductase, oxidoreductase subunit	NA	A0A077SK27	Escherichia_phage	49.2	2.7e-214
798142:798157	attR	TTTTTATCTCTTAAAG	NA	NA	NA	NA
>prophage 3
LR134234	Escherichia coli strain NCTC8623 genome assembly, chromosome: 1	4943400	1258577	1269799	4943400		Acanthocystis_turfacea_Chlorella_virus(25.0%)	10	NA	NA
VED16546.1|1258577_1259744_-	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	51.9	1.9e-109
VED16548.1|1259991_1261398_-	6-phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.3	1.4e-37
VED16550.1|1261560_1262931_-	phosphomannomutase CpsG	NA	A0A127AWJ1	Bacillus_phage	28.2	1.3e-32
VED16552.1|1262955_1263702_-	putative glycosyltransferase	NA	A0A1V0SAH6	Catovirus	41.6	2.1e-08
VED16554.1|1263785_1265171_-	putative mannose-1-phosphate guanylyltransferase	NA	A0A1V0SH58	Hokovirus	29.5	1.4e-47
VED16556.1|1265182_1265638_-	GDP-mannose mannosyl hydrolase	NA	NA	NA	NA	NA
VED16558.1|1265640_1266606_-	GDP-L-fucose synthetase	NA	M1I5W5	Acanthocystis_turfacea_Chlorella_virus	51.7	9.9e-88
VED16560.1|1266609_1267731_-	GDP-mannose 4,6-dehydratase	NA	M1HVG7	Acanthocystis_turfacea_Chlorella_virus	64.4	2.5e-130
VED16562.1|1267741_1268770_-	putative glycosyl transferase	NA	NA	NA	NA	NA
VED16564.1|1268785_1269799_-	UDP-glucose 4-epimerase	NA	A0A2K9L5H6	Tupanvirus	52.0	2.7e-88
>prophage 4
LR134234	Escherichia coli strain NCTC8623 genome assembly, chromosome: 1	4943400	1369964	1379406	4943400		Enterobacteria_phage(85.71%)	10	NA	NA
VED16724.1|1369964_1371101_+	von Willebrand factor type A domain protein YehP	NA	Q9EYF7	Enterobacteria_phage	97.7	1.1e-162
VED16726.1|1371097_1373098_+	zinc finger SWIM domain-containing protein	NA	Q9EYF6	Enterobacteria_phage	95.8	0.0e+00
VED16727.1|1373222_1373684_+	lipoprotein yehR	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
VED16729.1|1373724_1374195_-	conserved protein, DUF1456 family	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
VED16731.1|1374241_1374961_-	two-component response-regulatory protein YehT	NA	NA	NA	NA	NA
VED16733.1|1374957_1376643_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
VED16735.1|1376864_1377596_+	MerR family transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
VED16737.1|1377655_1377763_+	putative inner membrane protein	NA	NA	NA	NA	NA
VED16739.1|1377743_1378475_-	ABC transporter permease	NA	NA	NA	NA	NA
VED16741.1|1378479_1379406_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.8	2.8e-23
>prophage 5
LR134234	Escherichia coli strain NCTC8623 genome assembly, chromosome: 1	4943400	1578937	1655940	4943400	portal,integrase,terminase,tRNA,tail,holin,coat	Enterobacteria_phage(50.79%)	93	1576142:1576158	1630969:1630985
1576142:1576158	attL	ATGCGCGACATCAAAAA	NA	NA	NA	NA
VED17122.1|1578937_1579750_-|tRNA	tRNA pseudouridine synthase A	tRNA	NA	NA	NA	NA
VED17124.1|1579749_1580763_-	putative semialdehyde dehydrogenase	NA	NA	NA	NA	NA
VED17126.1|1580828_1581965_-	erythronate-4-phosphate dehydrogenase	NA	A0A2R8FDS8	Brazilian_cedratvirus	29.1	5.9e-23
VED17128.1|1582063_1583059_+	cell division protein	NA	NA	NA	NA	NA
VED17130.1|1583055_1584234_-	major facilitator superfamily protein	NA	NA	NA	NA	NA
VED17132.1|1584526_1585747_-	3-oxoacyl-ACP synthase	NA	NA	NA	NA	NA
VED17134.1|1585905_1587912_+|tRNA	tRNA U-34 5-methylaminomethyl-2-thiouridine biosynthesis protein MnmC	tRNA	NA	NA	NA	NA
VED17136.1|1588032_1588311_-	protein	NA	NA	NA	NA	NA
VED17138.1|1588344_1588893_-	putative transporting ATPase	NA	NA	NA	NA	NA
VED17140.1|1588892_1589702_-	inner membrane protein	NA	NA	NA	NA	NA
VED17142.1|1589701_1590526_-	penicillin-insensitive murein endopeptidase	NA	NA	NA	NA	NA
VED17144.1|1590529_1591615_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	48.4	9.1e-90
VED17146.1|1591649_1592582_-	N5-glutamine S-adenosyl-L-methionine-dependent methyltransferase	NA	NA	NA	NA	NA
VED17148.1|1592747_1593299_+	Smr protein/MutS2	NA	NA	NA	NA	NA
VED17151.1|1593371_1594226_-	putative fimbrial adhesin protein	NA	NA	NA	NA	NA
VED17153.1|1594227_1594767_-	fimbrial protein	NA	NA	NA	NA	NA
VED17155.1|1594763_1595252_-	putative fimbrial subunit protein	NA	NA	NA	NA	NA
VED17157.1|1595248_1595758_-	putative fimbrial protein	NA	NA	NA	NA	NA
VED17159.1|1595773_1596526_-	pili assembly chaperone	NA	NA	NA	NA	NA
VED17161.1|1596545_1599191_-	fimbrial outer membrane usher protein StfC	NA	NA	NA	NA	NA
VED17163.1|1599272_1599836_-	fimbrial-like adhesin protein	NA	NA	NA	NA	NA
VED17165.1|1600519_1601005_-	phosphohistidine phosphatase	NA	NA	NA	NA	NA
VED17167.1|1601210_1603352_-	fatty acid oxidation complex alpha subunit [includes: enoyl-CoA hydratase; 3-hydroxyacyl-CoA dehydrogenase; 3-hydroxybutyryl-CoA epimerase]	NA	NA	NA	NA	NA
VED17169.1|1603351_1604662_-	fatty acid oxidation comple beta subunit (3 -ketoacyl-CoA thiolase)	NA	NA	NA	NA	NA
VED17171.1|1604841_1605126_-	protein YfcZ	NA	NA	NA	NA	NA
VED17173.1|1605497_1606838_+	long-chain fatty acid transport protein	NA	NA	NA	NA	NA
VED17175.1|1607203_1608262_+	Uncharacterised protein	NA	NA	NA	NA	NA
VED17177.1|1608443_1609199_-	lipoprotein	NA	NA	NA	NA	NA
VED17179.1|1609492_1610425_+	transporter protein	NA	E7DYY8	Enterobacteria_phage	100.0	1.2e-167
VED17181.1|1610736_1611894_+|integrase	integrase	integrase	A5VW56	Enterobacteria_phage	100.0	5.7e-223
VED17183.1|1612394_1613324_+	CPS-53 (KpLE1) prophage; bactoprenol glucosyl transferase	NA	M1FQW5	Enterobacteria_phage	90.5	3.9e-158
VED17185.1|1613313_1615125_+	Uncharacterised protein	NA	NA	NA	NA	NA
VED17187.1|1615189_1617118_-|tail	putative tail spike protein	tail	X4YDU4	Salmonella_phage	67.7	7.5e-212
VED17189.1|1617253_1617505_+	putative transcriptional repressor	NA	E7C9U8	Salmonella_phage	91.6	6.6e-36
VED17191.1|1617520_1618489_-	P63C domain	NA	A9YX09	Burkholderia_phage	48.6	8.5e-71
VED17193.1|1618570_1618834_+	Uncharacterised protein	NA	NA	NA	NA	NA
VED17195.1|1618851_1621080_-	prophage protein	NA	A0A088CQ71	Enterobacteria_phage	99.3	0.0e+00
VED17197.1|1621079_1622483_-	DNA transfer protein GP20	NA	I1TEJ5	Salmonella_phage	64.7	5.2e-146
VED17199.1|1622492_1623185_-	putative DNA transfer protein	NA	G5DA80	Enterobacteria_phage	99.1	2.1e-111
VED17201.1|1623187_1623643_-	Head assembly protein	NA	A0A2D1GLX4	Escherichia_phage	99.3	6.7e-87
VED17203.1|1623642_1624344_-	Packaged DNA stabilization protein from phage	NA	A0A2D1GLK3	Escherichia_phage	99.6	1.9e-120
VED17205.1|1624343_1625762_-	Packaged DNA stabilization protein from phage	NA	Q9AYZ4	Salmonella_phage	99.6	4.2e-276
VED17207.1|1625762_1626263_-	DNA stabilization protein GP4	NA	G8EYJ2	Enterobacteria_phage	98.2	1.2e-89
VED17209.1|1626240_1626483_-	Uncharacterised protein	NA	A0A2D1GLK1	Escherichia_phage	88.6	3.0e-25
VED17211.1|1626527_1627823_-|coat	putative coat protein	coat	A0A2D1GLV2	Escherichia_phage	98.6	1.0e-241
VED17213.1|1627822_1628734_-	Scaffolding protein (Protein gp8)	NA	A0A2D1GLN7	Escherichia_phage	100.0	1.3e-161
VED17215.1|1628747_1630913_-|portal	portal protein (protein gp1)	portal	A0A2D1GLJ6	Escherichia_phage	99.9	0.0e+00
VED17217.1|1630913_1632413_-|terminase	DNA packaging protein gp2 (terminase large subunit)	terminase	A0A2D1GLW6	Escherichia_phage	100.0	4.8e-307
1630969:1630985	attR	TTTTTGATGTCGCGCAT	NA	NA	NA	NA
VED17219.1|1632390_1632879_-	DNA packaging protein gp3 (Terminase small subunit)	NA	G8EYI7	Enterobacteria_phage	99.4	4.1e-90
VED17221.1|1632914_1633157_-	Protein of uncharacterised function (DUF2560)	NA	A0A0M4R322	Salmonella_phage	100.0	7.5e-37
VED17223.1|1633304_1633520_-	Protein of uncharacterised function (DUF551)	NA	A0A193GZ43	Enterobacter_phage	75.7	3.1e-26
VED17225.1|1633959_1634427_-	Endopeptidase from phage origin (Lysis protein Rz)	NA	A0A291AWW3	Escherichia_phage	96.8	7.2e-76
VED17227.1|1634423_1634900_-	phage endolysin	NA	K7PKV2	Enterobacteria_phage	100.0	1.7e-88
VED17229.1|1634883_1635207_-|holin	holin	holin	G5DA93	Enterobacteria_phage	100.0	1.3e-52
VED17231.1|1635640_1636264_-	late gene regulator	NA	K7P6X1	Enterobacteria_phage	100.0	3.0e-114
VED17233.1|1636260_1636449_-	prophage protein	NA	K7PH29	Enterobacteria_phage	100.0	1.9e-27
VED17235.1|1636445_1636808_-	prophage holliday junction resolvase	NA	A5VW85	Enterobacteria_phage	100.0	9.2e-63
VED17237.1|1636804_1637095_-	82 prophage-derived uncharacterized protein ybcO	NA	K7PKV0	Enterobacteria_phage	100.0	3.4e-52
VED17239.1|1637094_1637817_-	DNA-binding protein	NA	K7PL51	Enterobacteria_phage	92.9	3.9e-121
VED17244.1|1637809_1637986_-	NinF family protein	NA	A0A220NRM2	Escherichia_phage	100.0	1.9e-26
VED17246.1|1637978_1638335_-	putative protein ninx	NA	A0A088CQ65	Enterobacteria_phage	62.5	1.8e-39
VED17248.1|1638650_1639241_-	adenine methylase	NA	A0A193GYV6	Enterobacter_phage	76.5	2.5e-86
VED17250.1|1639237_1639681_-	recombination protein ninB from phage origin	NA	A0A2I6PIF6	Escherichia_phage	97.2	2.5e-78
VED17252.1|1639658_1639823_-	Uncharacterised protein	NA	A0A1R3Y6Z7	Salmonella_virus	90.7	2.1e-19
VED17254.1|1639825_1640077_-	Uncharacterised protein	NA	A0A220NQX3	Salmonella_phage	65.5	2.9e-23
VED17256.1|1640373_1641810_-	P protein; replicative DNA helicase	NA	G5DA90	Enterobacteria_phage	99.0	2.0e-273
VED17258.1|1641799_1642690_-	replication protein O	NA	G5DA89	Enterobacteria_phage	99.3	1.7e-158
VED17260.1|1642676_1642838_-	prophage protein	NA	Q76H53	Enterobacteria_phage	100.0	1.3e-21
VED17262.1|1642872_1643154_-	transcriptional activator protein	NA	K7PMG0	Enterobacteria_phage	98.9	7.4e-44
VED17264.1|1643270_1643486_-	repressor protein	NA	A0A0N7C2U7	Escherichia_phage	98.6	8.2e-35
VED17266.1|1643561_1644257_+	Repressor protein CI from phage origin	NA	A0A0N7BTS4	Escherichia_phage	96.5	1.3e-129
VED17268.1|1644679_1645012_+	prophage protein	NA	Q716D8	Shigella_phage	99.1	1.4e-54
VED17270.1|1645281_1645482_+	restriction alleviation protein	NA	A0A0K2FJE6	Enterobacteria_phage	98.5	7.1e-33
VED17272.1|1645521_1645815_+	Uncharacterised protein	NA	A0A1R3Y5U4	Salmonella_virus	75.0	4.7e-33
VED17274.1|1645814_1645973_+	Uncharacterised protein	NA	K7PMD4	Enterobacterial_phage	100.0	9.9e-22
VED17276.1|1646156_1646291_+	prophage regulatory protein cIII	NA	K7PHK2	Enterobacteria_phage	100.0	3.1e-16
VED17278.1|1646275_1646428_+	putative host killing protein	NA	A5VWA5	Enterobacteria_phage	100.0	4.7e-21
VED17280.1|1646503_1646674_+	Uncharacterised protein	NA	A5VWA7	Enterobacteria_phage	100.0	4.2e-26
VED17282.1|1646682_1647390_+	Rad52/22 double-strand break repair protein	NA	K7PKU3	Enterobacteria_phage	99.6	2.9e-137
VED17284.1|1647390_1647858_+	Uncharacterised protein	NA	A0A2I7QWC6	Vibrio_phage	62.0	1.2e-46
VED17286.1|1647854_1648361_+	single-stranded DNA-binding protein	NA	K7PHK1	Enterobacteria_phage	98.8	6.8e-80
VED17288.1|1648374_1648668_+	Anti-RecBCD protein 2	NA	G8C7L1	Escherichia_phage	99.0	2.5e-50
VED17290.1|1648678_1648969_+	Gene 24 protein	NA	K7P7M4	Enterobacteria_phage	99.0	4.8e-46
VED17292.1|1648965_1649130_+	prophage protein	NA	K7P7R0	Enterobacteria_phage	98.1	1.9e-23
VED17294.1|1649126_1649576_+	CPS-53 (KpLE1) prophage protein	NA	K7PMI0	Enterobacteria_phage	85.9	1.0e-63
VED17296.1|1649572_1650016_+	EA22-like protein	NA	K7P6J7	Enterobacteria_phage	56.3	1.4e-57
VED17298.1|1650017_1650209_+	Uncharacterised protein	NA	G9L660	Escherichia_phage	98.4	2.3e-25
VED17300.1|1650211_1650892_+	prophage protein (fragment)	NA	K7P7E4	Enterobacteria_phage	50.6	6.6e-54
VED17302.1|1651102_1651270_+	Uncharacterised protein	NA	A0A0K2FJ46	Enterobacteria_phage	100.0	1.3e-27
VED17304.1|1651327_1651528_+	response regulator inhibitor for tor operon	NA	K7P7V0	Enterobacteria_phage	100.0	2.4e-33
VED17306.1|1652057_1653305_-	galactoside permease	NA	NA	NA	NA	NA
VED17308.1|1653376_1654291_-	aminoimidazole riboside kinase	NA	NA	NA	NA	NA
VED17310.1|1654506_1655940_+	sucrose-6-phosphate hydrolase	NA	F8WPR5	Bacillus_phage	25.4	7.0e-29
>prophage 6
LR134234	Escherichia coli strain NCTC8623 genome assembly, chromosome: 1	4943400	1922407	1939527	4943400	transposase,integrase	Enterobacteria_phage(50.0%)	16	1918951:1918964	1936960:1936973
1918951:1918964	attL	CGACTATTTGAACT	NA	NA	NA	NA
VED17794.1|1922407_1923628_+|integrase	integrase family protein	integrase	A0A1B5FPC6	Escherichia_phage	49.9	8.4e-108
VED17796.1|1923715_1923934_-	Uncharacterised protein	NA	NA	NA	NA	NA
VED17798.1|1923947_1925255_-	Uncharacterised protein	NA	NA	NA	NA	NA
VED17800.1|1925788_1926361_-	prophage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	97.3	2.2e-95
VED17802.1|1926434_1926935_-	transcriptional activator Ogr/delta	NA	NA	NA	NA	NA
VED17804.1|1926931_1927666_-	glycoprotein 3	NA	Q7M2A2	Enterobacteria_phage	98.8	5.2e-129
VED17807.1|1928217_1928484_+	prophage regulatory protein	NA	Q7M299	Enterobacteria_phage	97.7	1.6e-43
VED17809.1|1929063_1929351_+	prophage derepression protein	NA	Q7M2A0	Enterobacteria_phage	97.9	8.6e-48
VED17812.1|1929343_1929799_+	putative prophage protein	NA	Q7M298	Enterobacteria_phage	99.1	1.6e-64
VED17818.1|1929934_1930255_+	P4 phage protein	NA	NA	NA	NA	NA
VED17823.1|1930269_1932603_+	putative prophage DNA primase	NA	Q7M2A8	Enterobacteria_phage	98.8	0.0e+00
VED17826.1|1933284_1934514_+|integrase	integrase	integrase	A0A1B5FPC6	Escherichia_phage	100.0	1.5e-234
VED17830.1|1934552_1934969_+	Uncharacterised protein	NA	A0A1B5FPM5	Escherichia_phage	100.0	1.1e-72
VED17832.1|1935040_1936789_-	Uncharacterised protein	NA	A0A1B5FPH1	Escherichia_phage	99.8	0.0e+00
VED17834.1|1936790_1938509_-	putative histidine kinase-like protein	NA	A0A1B5FPD5	Escherichia_phage	99.8	3.2e-307
1936960:1936973	attR	AGTTCAAATAGTCG	NA	NA	NA	NA
VED17836.1|1938660_1939527_-|transposase	IS3 element transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	2.3e-51
>prophage 7
LR134234	Escherichia coli strain NCTC8623 genome assembly, chromosome: 1	4943400	2026940	2035697	4943400	integrase,tRNA	Escherichia_phage(71.43%)	7	2024483:2024496	2038024:2038037
2024483:2024496	attL	ATCAATATCTTTCT	NA	NA	NA	NA
VED18025.1|2026940_2028512_-|integrase	phage integrase	integrase	A0A0R6PGY7	Moraxella_phage	28.0	4.8e-23
VED18027.1|2028551_2031119_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.4	3.9e-30
VED18029.1|2031224_2031881_+	serine/threonine-specific protein phosphatase 2	NA	A0A222YWF0	Escherichia_phage	46.7	4.3e-50
VED18031.1|2031931_2032699_-	DeoR family transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	3.3e-70
VED18033.1|2032894_2033803_+	oxidoreductase YgbJ	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
VED18035.1|2033799_2035062_+|tRNA	paral putative tRNA synthase	tRNA	A0A077SLJ7	Escherichia_phage	61.4	1.3e-135
VED18037.1|2035058_2035697_+	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
2038024:2038037	attR	ATCAATATCTTTCT	NA	NA	NA	NA
>prophage 8
LR134234	Escherichia coli strain NCTC8623 genome assembly, chromosome: 1	4943400	3123357	3133319	4943400	integrase	Enterobacteria_phage(100.0%)	11	3123175:3123197	3133797:3133819
3123175:3123197	attL	GACTCCTGTGATCTTCCGCCAAA	NA	NA	NA	NA
VED21869.1|3123357_3124527_+|integrase	integrase	integrase	Q7M297	Enterobacteria_phage	90.2	4.6e-204
VED21871.1|3124596_3125466_+	phosphoglycolate phosphatase	NA	NA	NA	NA	NA
VED21873.1|3125465_3126110_+	Uncharacterised protein	NA	NA	NA	NA	NA
VED21875.1|3126495_3127068_-	prophage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	95.2	2.7e-93
VED21877.1|3127141_3127642_-	transcriptional activator Ogr/delta	NA	NA	NA	NA	NA
VED21879.1|3127638_3128373_-	glycoprotein 3	NA	Q7M2A2	Enterobacteria_phage	98.8	2.3e-129
VED21881.1|3128924_3129191_+	prophage regulatory protein	NA	Q7M299	Enterobacteria_phage	100.0	4.9e-45
VED21883.1|3129779_3130067_+	prophage derepression protein	NA	Q7M2A0	Enterobacteria_phage	97.9	8.6e-48
VED21885.1|3130059_3130515_+	putative prophage protein	NA	Q7M298	Enterobacteria_phage	100.0	7.2e-65
VED21887.1|3130650_3130971_+	P4 phage protein	NA	NA	NA	NA	NA
VED21889.1|3130985_3133319_+	putative prophage DNA primase	NA	Q7M2A8	Enterobacteria_phage	99.0	0.0e+00
3133797:3133819	attR	GACTCCTGTGATCTTCCGCCAAA	NA	NA	NA	NA
>prophage 9
LR134234	Escherichia coli strain NCTC8623 genome assembly, chromosome: 1	4943400	3382191	3461050	4943400	lysis,holin,integrase,terminase,plate,tRNA,protease,tail,capsid	Escherichia_phage(45.65%)	93	3376268:3376285	3462626:3462643
3376268:3376285	attL	CAGCGGCATCTCTTCGGG	NA	NA	NA	NA
VED22336.1|3382191_3383064_+|tRNA	tRNA-processing ribonuclease BN	tRNA	NA	NA	NA	NA
VED22338.1|3383060_3383498_+|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
VED22340.1|3383542_3384484_+	putative acetyltransferase	NA	NA	NA	NA	NA
VED22342.1|3384547_3385456_-	lipase	NA	NA	NA	NA	NA
VED22344.1|3385684_3385996_+	transcription elongation factor GreB	NA	NA	NA	NA	NA
VED22346.1|3385996_3386287_+	transcriptional regulator	NA	NA	NA	NA	NA
VED22348.1|3386372_3386465_+	Uncharacterised protein	NA	NA	NA	NA	NA
VED22350.1|3386891_3387110_+	CopG-family DNA-binding protein	NA	NA	NA	NA	NA
VED22352.1|3387328_3387571_+	YiiF protein	NA	NA	NA	NA	NA
VED22354.1|3387570_3387681_+	enterobactin synthase multienzyme complex phosphopantetheinyltransferase	NA	NA	NA	NA	NA
VED22356.1|3387900_3388830_-	putative formate dehydrogenase formation protein	NA	NA	NA	NA	NA
VED22358.1|3388826_3389462_-	formate dehydrogenase, cytochrome b556(fdo) subunit	NA	NA	NA	NA	NA
VED22360.1|3389458_3390361_-	formate dehydrogenase-O	NA	NA	NA	NA	NA
VED22362.1|3393617_3394451_+	formate dehydrogenase accessory protein	NA	NA	NA	NA	NA
VED22364.1|3394603_3395644_+	putative lipoprotein	NA	NA	NA	NA	NA
VED22366.1|3395693_3397442_-	frv operon regulatory protein	NA	NA	NA	NA	NA
VED22368.1|3397441_3398512_-	fructose-specific phosphotransferase system protein FrvX	NA	NA	NA	NA	NA
VED22370.1|3398501_3399953_-	PTS system subunit IIC	NA	NA	NA	NA	NA
VED22372.1|3399963_3400410_-	fructose-like phosphotransferase system subunit EIIA	NA	NA	NA	NA	NA
VED22374.1|3400722_3401037_-	L-rhamnose mutarotase	NA	NA	NA	NA	NA
VED22376.1|3401046_3401871_-	rhamnulose-1-phosphate aldolase	NA	NA	NA	NA	NA
VED22378.1|3402045_3403305_-	L-rhamnose isomerase	NA	NA	NA	NA	NA
VED22380.1|3403301_3404771_-	rhamnulokinase	NA	NA	NA	NA	NA
VED22382.1|3405058_3405895_+	L-rhamnose operon regulatory protein	NA	NA	NA	NA	NA
VED22384.1|3405878_3406817_+	transcriptional activator RhaR	NA	NA	NA	NA	NA
VED22386.1|3406813_3407848_-	L rhamnose-proton symporter	NA	NA	NA	NA	NA
VED22388.1|3408132_3408753_+	Mn dependent superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	59.8	4.9e-64
VED22390.1|3409012_3409996_+	2-keto-3-deoxygluconate permease	NA	NA	NA	NA	NA
VED22392.1|3410144_3410819_+	MOSC domain-containing protein	NA	NA	NA	NA	NA
VED22394.1|3410924_3412298_-	two-component sensor kinase	NA	W8CYF6	Bacillus_phage	25.9	3.8e-16
VED22396.1|3412294_3412993_-	transcriptional regulatory protein CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	5.3e-06
VED22398.1|3413142_3413643_+	repressor CpxP	NA	NA	NA	NA	NA
VED22400.1|3413829_3414810_-|integrase	site-specific recombinase, phage integrase family protein	integrase	S4TP66	Salmonella_phage	100.0	4.7e-186
VED22402.1|3414879_3415173_-	Helix-turn-helix domain protein	NA	Q1JS37	Enterobacteria_phage	100.0	2.7e-49
VED22404.1|3415309_3415582_+	Regulatory phage protein cox	NA	Q1JS36	Enterobacteria_phage	100.0	1.4e-47
VED22406.1|3415751_3416252_+	Phage protein B	NA	M1SV55	Escherichia_phage	100.0	2.6e-92
VED22408.1|3416315_3416540_+	Protein of uncharacterised function (DUF2732)	NA	S4TP68	Salmonella_phage	98.6	1.0e-32
VED22410.1|3416539_3416839_+	Uncharacterised protein	NA	S4TUD1	Salmonella_phage	98.0	6.0e-44
VED22412.1|3416841_3417066_+	C4-type zinc finger protein, DksA/TraR family	NA	S4TRY6	Salmonella_phage	100.0	2.9e-35
VED22414.1|3417062_3417338_+	relication initiation protein	NA	U5N3W1	Enterobacteria_phage	98.9	3.3e-44
VED22416.1|3417327_3419604_+	Replication gene A protein (GpA)	NA	A0A0F7LBQ2	Escherichia_phage	98.0	0.0e+00
VED22418.1|3419805_3420750_+	HsdRM	NA	Q7Y4B5	Escherichia_virus	76.1	2.5e-144
VED22420.1|3420757_3421747_-	Uncharacterised protein	NA	NA	NA	NA	NA
VED22422.1|3421736_3422282_-	Uncharacterised protein	NA	Q858T2	Yersinia_virus	55.0	2.0e-24
VED22424.1|3422259_3422859_-	ParB/RepB/Spo0J family partition protein	NA	Q858T2	Yersinia_virus	65.6	7.3e-65
VED22426.1|3423273_3424308_-|capsid	phage capsid protein	capsid	U5N087	Enterobacteria_phage	99.1	1.6e-200
VED22428.1|3424307_3426080_-	Terminase, ATPase subunit (GpP)	NA	A0A0F7LCK3	Escherichia_phage	99.8	0.0e+00
VED22430.1|3426253_3427108_+|capsid	phage capsid scaffolding protein	capsid	Q94MI4	Enterobacteria_phage	100.0	1.3e-139
VED22432.1|3427166_3428240_+|capsid	major capsid protein	capsid	Q94MH9	Enterobacteria_phage	98.9	2.5e-201
VED22434.1|3428243_3428987_+|terminase	small terminase subunit	terminase	Q94MK6	Enterobacteria_phage	98.4	8.6e-124
VED22436.1|3429086_3429596_+|capsid	capsid completion protein	capsid	U5N0S3	Enterobacteria_phage	99.4	3.3e-90
VED22438.1|3429595_3429799_+|tail	phage tail protein X	tail	U5N3E7	Enterobacteria_phage	100.0	4.0e-31
VED22440.1|3429802_3430084_+|holin,lysis	phage lysis holin	holin,lysis	A0A0F7LDF8	Escherichia_phage	100.0	3.7e-43
VED22442.1|3430083_3430581_+	phage lysin	NA	A0A0F7LBS0	Escherichia_phage	100.0	3.1e-93
VED22444.1|3430595_3431021_+	LysA protein	NA	U5N096	Enterobacteria_phage	96.5	1.2e-58
VED22446.1|3431008_3431434_+	LysB protein	NA	U5N3W5	Enterobacteria_phage	95.7	6.1e-66
VED22448.1|3431420_3431579_+|lysis	phage lysis protein	lysis	A0A0F7LCN5	Escherichia_phage	100.0	2.6e-22
VED22450.1|3431541_3432009_+|tail	tail protein	tail	A0A0F7LA33	Escherichia_phage	98.7	1.5e-81
VED22452.1|3432001_3432454_+|tail	tail protein	tail	A0A0F7LBV9	Escherichia_phage	100.0	6.3e-77
VED22454.1|3432520_3433156_+|plate	Baseplate assembly protein V (GpV)	plate	Q7Y4D8	Escherichia_virus	100.0	2.4e-106
VED22456.1|3433152_3433500_+|plate	phage baseplate protein	plate	A0A0F7L9X3	Escherichia_phage	100.0	1.7e-58
VED22458.1|3433504_3434413_+|plate	baseplate assembly protein	plate	A0A0F7LCQ9	Escherichia_phage	99.3	7.5e-162
VED22460.1|3434405_3435017_+|tail	phage P2-related tail formation protein	tail	A0A0F7LA36	Escherichia_phage	99.0	1.4e-116
VED22462.1|3435013_3436306_+|tail	phage tail fiber protein	tail	M1TAS6	Escherichia_phage	70.6	1.4e-182
VED22464.1|3436305_3436899_+|tail	tail fiber assembly protein from lambdoid prophage	tail	Q9MCR5	Enterobacteria_phage	63.3	6.6e-58
VED22467.1|3436870_3437311_-	CPS-53 (KpLE1) prophage protein	NA	A0A0F7LDZ0	Escherichia_phage	66.7	7.5e-51
VED22469.1|3437739_3438333_+	Resolvase domain-containing protein	NA	A0A0F7LA37	Escherichia_phage	98.0	1.2e-104
VED22471.1|3438392_3439583_+|tail	major tail sheath protein FI	tail	A0A0F7LBW9	Escherichia_phage	99.5	1.4e-224
VED22473.1|3439595_3440114_+|tail	phage major tail tube protein FII	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
VED22475.1|3440170_3440446_+|tail	tail protein E (GpE)	tail	A0A0F7LDQ8	Escherichia_phage	100.0	5.7e-41
VED22477.1|3440590_3443038_+|tail	phage related tail protein	tail	A0A0F7LCI6	Escherichia_phage	96.0	0.0e+00
VED22479.1|3443052_3443532_+	gpU phage protein	NA	O64315	Escherichia_phage	100.0	5.1e-85
VED22481.1|3443531_3444695_+	phage protein D	NA	A0A0F7LDZ2	Escherichia_phage	98.4	1.0e-203
VED22483.1|3444776_3444995_+	transcriptional activator Ogr/delta	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
VED22485.1|3445231_3446134_+	ferrous-iron efflux pump	NA	NA	NA	NA	NA
VED22487.1|3446079_3446184_-	Uncharacterised protein	NA	NA	NA	NA	NA
VED22489.1|3446314_3447277_+	6-phosphofructokinase	NA	NA	NA	NA	NA
VED22491.1|3447596_3448586_+	sulfate-binding protein (sulfate starvation-induced protein 2)	NA	NA	NA	NA	NA
VED22493.1|3448691_3449447_+	CDP-diacylglycerol pyrophosphatase	NA	NA	NA	NA	NA
VED22495.1|3449501_3450269_-	triosephosphate isomerase	NA	NA	NA	NA	NA
VED22497.1|3450376_3450976_-	Protein of uncharacterised function (DUF1454)	NA	NA	NA	NA	NA
VED22499.1|3451076_3451517_+	inner membrane protein	NA	NA	NA	NA	NA
VED22501.1|3451728_3452028_+	conserved protein, UPF0381 family	NA	NA	NA	NA	NA
VED22503.1|3452054_3452483_+	universal stress protein D	NA	NA	NA	NA	NA
VED22505.1|3452487_3453234_-	ferredoxin--NADP reductase	NA	NA	NA	NA	NA
VED22507.1|3453330_3454341_-	fructose 1,6-bisphosphatase II	NA	NA	NA	NA	NA
VED22509.1|3454476_3455985_-	glycerol kinase	NA	NA	NA	NA	NA
VED22511.1|3456007_3456853_-	glycerol uptake facilitator protein	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.0	4.4e-15
VED22513.1|3457283_3457523_+	cell division factor ZapB	NA	NA	NA	NA	NA
VED22515.1|3457607_3458093_-	ribonuclease activity regulator protein RraA	NA	NA	NA	NA	NA
VED22517.1|3458185_3459112_-	1,4-dihydroxy-2-naphthoate octaprenyltransferase	NA	NA	NA	NA	NA
VED22519.1|3459178_3460510_-|protease	ATP-dependent hslVU protease ATP-binding subunit HslU	protease	A0A191ZC11	Erwinia_phage	29.9	1.7e-45
VED22521.1|3460519_3461050_-|protease	ATP-dependent hslVU protease peptidase subunit HslV	protease	NA	NA	NA	NA
3462626:3462643	attR	CAGCGGCATCTCTTCGGG	NA	NA	NA	NA
>prophage 10
LR134234	Escherichia coli strain NCTC8623 genome assembly, chromosome: 1	4943400	3833953	3849972	4943400	integrase	Enterobacteria_phage(61.54%)	15	3832124:3832139	3857673:3857688
3832124:3832139	attL	GTGCTGTTCATCGAAA	NA	NA	NA	NA
VED22859.1|3833953_3835456_-	ATPase	NA	A0A248XCZ8	Klebsiella_phage	44.8	6.1e-84
VED22860.1|3835585_3836605_-	oxidoreductase	NA	A0A0G2Y405	Acanthamoeba_polyphaga_mimivirus	30.4	1.9e-44
VED22861.1|3837048_3838305_+|integrase	site-specific recombinase, phage integrase family	integrase	B7SYF8	Stenotrophomonas_phage	42.2	9.6e-75
VED22862.1|3838348_3839179_+	Uncharacterised protein	NA	A0A0F7L9X0	Escherichia_phage	35.9	3.6e-46
VED22863.1|3839613_3840186_-	prophage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	97.3	2.9e-95
VED22864.1|3840200_3840446_-	putative prophage regulatory protein	NA	Q7M294	Enterobacteria_phage	100.0	1.8e-41
VED22865.1|3840442_3841177_-	glycoprotein 3	NA	Q7M2A2	Enterobacteria_phage	98.0	8.8e-129
VED22866.1|3841728_3841995_+	prophage regulatory protein	NA	Q7M299	Enterobacteria_phage	100.0	4.9e-45
VED22867.1|3842583_3842871_+	prophage derepression protein	NA	Q7M2A0	Enterobacteria_phage	97.9	8.6e-48
VED22868.1|3842863_3843319_+	putative prophage protein	NA	Q7M298	Enterobacteria_phage	98.2	1.0e-63
VED22869.1|3843454_3843775_+	P4 phage protein	NA	NA	NA	NA	NA
VED22870.1|3843789_3846123_+	putative prophage DNA primase	NA	Q7M2A8	Enterobacteria_phage	98.8	0.0e+00
VED22871.1|3846376_3846673_+	Uncharacterised protein	NA	Q38404	Enterobacteria_phage	100.0	2.4e-24
VED22872.1|3846635_3846815_-	Uncharacterised protein	NA	NA	NA	NA	NA
VED22873.1|3847080_3849972_+	putative helicase	NA	A0A2H4J643	uncultured_Caudovirales_phage	53.5	4.3e-288
3857673:3857688	attR	GTGCTGTTCATCGAAA	NA	NA	NA	NA
>prophage 11
LR134234	Escherichia coli strain NCTC8623 genome assembly, chromosome: 1	4943400	4534309	4591436	4943400	portal,head,integrase,terminase,tRNA,protease,tail,capsid,coat	Enterobacteria_phage(61.11%)	70	4544471:4544517	4591861:4591907
VED23469.1|4534309_4535695_+|tRNA	cysteinyl-tRNA synthetase	tRNA	M1PG92	Moumouvirus	34.8	3.9e-45
VED23470.1|4535730_4536252_-	putative membrane-bound metal-dependent hydrolase	NA	NA	NA	NA	NA
VED23471.1|4536359_4536572_-	putative RNA-binding protein	NA	NA	NA	NA	NA
VED23472.1|4536573_4537440_-	5,10-methylene-tetrahydrofolate dehydrogenase	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
VED23473.1|4537920_4538463_+	fimbrial-like protein	NA	NA	NA	NA	NA
VED23474.1|4538682_4539375_+	fimbrial chaperone	NA	NA	NA	NA	NA
VED23475.1|4539405_4542015_+	fimbrial outer membrane usher protein	NA	NA	NA	NA	NA
VED23476.1|4542027_4543035_+	fimbrial protein	NA	NA	NA	NA	NA
VED23477.1|4543045_4543561_+	fimbrial protein	NA	NA	NA	NA	NA
VED23478.1|4543563_4544196_-	two component transcriptional regulator, LuxR family	NA	NA	NA	NA	NA
4544471:4544517	attL	CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
VED23479.1|4544530_4545694_-|integrase	site-specific recombinase, phage integrase family protein	integrase	A0A088CD23	Shigella_phage	86.6	3.0e-200
VED23480.1|4545892_4546171_-	bacteriophage protein	NA	M1FPC8	Enterobacteria_phage	97.8	4.9e-48
VED23481.1|4546218_4546437_-	ybl16	NA	M1FQT7	Enterobacteria_phage	100.0	7.5e-36
VED23482.1|4546535_4546751_-	ybl17	NA	A0A1I9LJM7	Stx_converting_phage	100.0	1.0e-32
VED23483.1|4546990_4547173_-	phage protein	NA	A0A1U8QQC1	Enterobacteria_phage	96.7	6.9e-27
VED23484.1|4547169_4547850_-	exonuclease	NA	B6DZ61	Enterobacteria_phage	98.2	5.1e-131
VED23485.1|4547846_4548632_-	bacteriophage recombination protein	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
VED23486.1|4548637_4548934_-	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	98.0	8.9e-48
VED23487.1|4549009_4549216_-	prophage Kil protein	NA	K7P6H3	Enterobacteria_phage	83.8	2.1e-27
VED23488.1|4549765_4550044_-	Uncharacterised protein	NA	NA	NA	NA	NA
VED23489.1|4550221_4550485_-	Uncharacterised protein	NA	A0A2H4FNC7	Salmonella_phage	95.4	4.2e-41
VED23490.1|4550567_4551053_-	Regulatory protein CI from bacteriophage origin	NA	Q76H56	Enterobacteria_phage	84.5	3.1e-74
VED23491.1|4551370_4551598_+	represror Cro	NA	Q76H55	Enterobacteria_phage	67.6	6.4e-22
VED23492.1|4551628_4552168_+	bacteriophage regulatory protein CII	NA	M9NZI6	Enterobacteria_phage	66.7	6.8e-62
VED23493.1|4552179_4553184_+	replication protein O	NA	A0A0M5M7Y1	Salmonella_phage	63.8	1.9e-110
VED23494.1|4553180_4553882_+	replication protein P of bacteriophage	NA	K7P6G2	Enterobacteria_phage	99.1	1.1e-128
VED23495.1|4553878_4554181_+	Ren protein from phage origin	NA	A0A0N6WES4	Escherichia_phage	95.7	1.1e-42
VED23496.1|4554248_4554581_+	Multidrug transporter emrE	NA	NA	NA	NA	NA
VED23497.1|4554837_4556364_+	site-specific invertase; DLP12 prophage	NA	Q3HQV4	Burkholderia_phage	27.7	7.9e-31
VED23498.1|4556583_4556793_+	antirepressor protein	NA	NA	NA	NA	NA
VED23499.1|4556998_4557928_+	Uncharacterised protein	NA	A0A1R3Y6Z6	Salmonella_virus	40.0	3.0e-57
VED23500.1|4558124_4558580_+	DLP12 prophage; DNA base-flipping protein	NA	I6PD71	Cronobacter_phage	66.9	9.2e-60
VED23501.1|4558579_4558750_+	prophage protein NinE	NA	K7P7K0	Enterobacteria_phage	69.8	2.4e-13
VED23502.1|4558742_4559033_+	DLP12 prophage	NA	K7PGZ6	Enterobacteria_phage	93.8	2.5e-47
VED23503.1|4559029_4559392_+	endodeoxyribonuclease RUS	NA	K7PM48	Enterobacteria_phage	95.7	1.6e-59
VED23504.1|4559614_4559992_+	putative antitermination protein Q-like protein; DLP12 prophage	NA	Q777W5	Enterobacteria_phage	84.2	1.6e-54
VED23505.1|4560147_4560672_-	lipoprotein	NA	A0A1W6JNX6	Morganella_phage	54.1	4.2e-48
VED23506.1|4560864_4561824_+	putative pathogenicity island protein	NA	NA	NA	NA	NA
VED23507.1|4562142_4562874_+	putative araC-type regulatory protein from bacteriophage origin	NA	NA	NA	NA	NA
VED23508.1|4563041_4563257_+	Lysis protein S	NA	M1FN85	Enterobacteria_phage	94.4	4.5e-33
VED23509.1|4563256_4563754_+	phage lysozome	NA	A5LH83	Enterobacteria_phage	98.8	4.9e-91
VED23510.1|4563750_4564212_+	Rz endopeptidase from lambdoid prophage DLP12	NA	A0A0K2FJD0	Enterobacteria_phage	99.3	2.4e-76
VED23511.1|4564243_4564537_-	lambdoid prophage DLP12 Bor-like protein	NA	A0A2R2X2B2	Escherichia_phage	97.9	5.7e-47
VED23512.1|4564827_4565238_-	putative envelope protein	NA	C6ZCX4	Enterobacteria_phage	98.5	2.7e-71
VED23513.1|4565523_4565730_+	DLP12 prophage; predicted protein	NA	A0A0K2FJ18	Enterobacteria_phage	100.0	5.8e-30
VED23514.1|4566477_4567023_+	prophage qsr' DNA packaging protein NU1-like protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.9	1.4e-94
VED23515.1|4566997_4568923_+|terminase	phage terminase large subunit	terminase	A0A0K2FJ14	Enterobacteria_phage	99.5	0.0e+00
VED23516.1|4568919_4569126_+|head,tail	head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
VED23517.1|4569122_4570724_+|capsid,portal	phage portal protein (minor capsid protein)	capsid,portal	A0A0K2FJC0	Enterobacteria_phage	99.2	2.5e-309
VED23518.1|4570704_4572024_+|capsid	minor capsid protein C from bacteriophage origin	capsid	A0A2I6TC87	Escherichia_phage	97.3	1.2e-229
VED23519.1|4572033_4572366_+	Head decoration protein from bacteriophage origin	NA	C6ZCY1	Enterobacteria_phage	100.0	2.2e-55
VED23520.1|4572421_4573447_+|head,coat	phage major head protein (major coat protein)	head,coat	C6ZCY2	Enterobacteria_phage	98.2	2.8e-189
VED23521.1|4573488_4573884_+	DNA packaging protein from bacteriophage origin	NA	A0A2R9YJP4	Escherichia_phage	96.2	5.2e-59
VED23522.1|4573895_4574249_+|capsid	minor capsid protein	capsid	A0A2R9YJJ5	Escherichia_phage	97.4	6.4e-61
VED23523.1|4574260_4574839_+|tail	minor tail protein	tail	A0A2R9YJK4	Escherichia_phage	97.9	7.8e-80
VED23524.1|4574835_4575231_+|tail	phage minor tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	100.0	1.0e-70
VED23525.1|4575238_4575979_+|tail	Major tail protein V	tail	A0A0K2FJ05	Enterobacteria_phage	98.8	7.3e-131
VED23526.1|4575994_4576417_+|tail	phage minor tail protein	tail	A0A0K2FIQ8	Enterobacteria_phage	96.4	3.1e-70
VED23527.1|4576398_4576833_+|tail	minor tail protein T	tail	A0A0K2FJB3	Enterobacteria_phage	98.3	2.5e-62
VED23528.1|4576825_4579387_+|tail	tail component of prophage	tail	A0A0K2FI43	Enterobacteria_phage	97.5	0.0e+00
VED23529.1|4579383_4579713_+|tail	Minor tail protein M	tail	A0A0K2FIE9	Enterobacteria_phage	100.0	9.6e-59
VED23530.1|4579712_4580411_+|tail	phage minor tail protein	tail	A0A0K2FJ01	Enterobacteria_phage	99.1	7.3e-133
VED23531.1|4580416_4581160_+|tail	putative tail fiber component K of prophage	tail	K7PLW1	Enterobacteria_phage	97.6	1.2e-149
VED23532.1|4581156_4581729_+|tail	phage tail assembly protein	tail	A0A0K2FJB0	Escherichia_phage	99.5	6.7e-84
VED23533.1|4581789_4585188_+	Host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	89.8	0.0e+00
VED23534.1|4585254_4585854_+	outer membrane precursor Lom	NA	A0A0P0ZCF6	Stx2-converting_phage	97.0	4.8e-109
VED23535.1|4585918_4588945_+|tail	tail fiber protein	tail	U5N099	Enterobacteria_phage	81.4	3.6e-67
VED23536.1|4589583_4590240_-	methylase	NA	NA	NA	NA	NA
VED23537.1|4590482_4591136_-|protease	outer membrane protease	protease	NA	NA	NA	NA
VED23538.1|4591187_4591436_-|protease	outer membrane protease	protease	NA	NA	NA	NA
4591861:4591907	attR	CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
>prophage 12
LR134234	Escherichia coli strain NCTC8623 genome assembly, chromosome: 1	4943400	4878783	4942606	4943400	portal,integrase,terminase,plate,transposase,tail,capsid	Salmonella_phage(78.26%)	73	4882984:4883000	4934855:4934871
VED23787.1|4878783_4879764_+|transposase	IS621, transposase	transposase	NA	NA	NA	NA
VED23788.1|4880019_4881285_-	protein	NA	NA	NA	NA	NA
VED23789.1|4881436_4882252_-	putative hydrolase	NA	NA	NA	NA	NA
VED23790.1|4882397_4884830_-	putative formate acetyltransferase 3 (pyruvate formate lyase 3)	NA	A0A076YHZ7	Citrobacter_phage	43.5	6.1e-09
4882984:4883000	attL	GGCGCACCGTTAATCAG	NA	NA	NA	NA
VED23791.1|4884835_4885735_-	putative pyruvate formate-lyase 3-activating enzyme	NA	NA	NA	NA	NA
VED23792.1|4885865_4886528_+	fructose-6-phosphate aldolase	NA	A0A0E3HJ81	Synechococcus_phage	34.6	5.7e-26
VED23793.1|4886603_4887353_-	molybdopterin biosynthesis protein	NA	NA	NA	NA	NA
VED23794.1|4887352_4888588_-	molybdopterin biosynthesis protein	NA	NA	NA	NA	NA
VED23795.1|4888791_4889757_+	putative L-asparaginase	NA	NA	NA	NA	NA
VED23796.1|4889743_4891615_+	glutathione transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.7	4.0e-16
VED23797.1|4891634_4893173_+	putative binding protein yliB precursor	NA	NA	NA	NA	NA
VED23798.1|4893190_4894111_+	ABC transporter permease	NA	NA	NA	NA	NA
VED23799.1|4894113_4895025_+	ABC transporter permease	NA	NA	NA	NA	NA
VED23800.1|4895202_4897551_+	cyclic di-GMP phosphodiesterase	NA	NA	NA	NA	NA
VED23801.1|4897558_4898887_+	putative signaling protein	NA	NA	NA	NA	NA
VED23802.1|4898933_4900259_-	radical SAM superfamily protein	NA	NA	NA	NA	NA
VED23803.1|4900471_4900855_+	biofilm formation regulatory protein BssR	NA	NA	NA	NA	NA
VED23804.1|4900965_4902081_+	aldose sugar dehydrogenase	NA	NA	NA	NA	NA
VED23805.1|4902077_4902704_-	glutathione S-transferase	NA	NA	NA	NA	NA
VED23806.1|4902950_4904153_+	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	48.0	8.2e-100
VED23807.1|4904199_4904958_-	deoxyribose operon repressor	NA	NA	NA	NA	NA
VED23808.1|4905015_4905612_-	putative phosphatase	NA	NA	NA	NA	NA
VED23809.1|4905896_4907129_+	multidrug translocase mdfA	NA	NA	NA	NA	NA
VED23810.1|4907169_4907448_-	protein	NA	NA	NA	NA	NA
VED23811.1|4907539_4908355_-	putative hydrolase	NA	NA	NA	NA	NA
VED23812.1|4908354_4909482_-	DEOR-type transcriptional regulator	NA	NA	NA	NA	NA
VED23813.1|4909646_4910183_+	DEOR-type transcriptional regulator	NA	NA	NA	NA	NA
VED23814.1|4910422_4911406_-	Uncharacterised protein	NA	NA	NA	NA	NA
VED23815.1|4911513_4912533_-|integrase	integrase	integrase	A0A218M4I3	Erwinia_phage	57.0	3.2e-105
VED23816.1|4912721_4912913_-	Uncharacterised protein	NA	A0A0R6PIH8	Moraxella_phage	65.9	6.8e-09
VED23817.1|4912928_4913498_-	repressor protein	NA	A0A1S6KZZ7	Salmonella_phage	43.9	1.7e-39
VED23818.1|4913623_4913845_+	ybl30	NA	NA	NA	NA	NA
VED23819.1|4913877_4914387_+	phage regulatory protein CII	NA	E5G6L3	Salmonella_phage	98.8	5.8e-87
VED23820.1|4914394_4914595_+	Protein of uncharacterised function (DUF2724)	NA	E5G6L4	Salmonella_phage	97.0	6.0e-32
VED23821.1|4914558_4914900_+	Uncharacterised protein	NA	E5G6L5	Salmonella_phage	99.1	4.6e-56
VED23822.1|4914967_4915201_+	Protein of uncharacterised function (DUF2732)	NA	E5G6L6	Salmonella_phage	94.8	3.5e-31
VED23823.1|4915200_4915428_+	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	100.0	2.7e-36
VED23824.1|4915424_4916282_+	site-specific DNA-methyltransferase	NA	E5G6L8	Salmonella_phage	94.7	7.6e-156
VED23825.1|4916278_4918693_+	putative replication protein for prophage	NA	E5G6L9	Salmonella_phage	97.4	0.0e+00
VED23826.1|4918846_4919035_+	Uncharacterised protein	NA	E5G6M0	Salmonella_phage	98.4	5.5e-27
VED23827.1|4919045_4919279_+	Prophage protein	NA	E5G6M1	Salmonella_phage	98.7	2.3e-35
VED23828.1|4919454_4920513_-	Uncharacterised protein	NA	NA	NA	NA	NA
VED23829.1|4921164_4922925_+	RNA-directed DNA polymerase	NA	Q7M2A9	Enterobacteria_phage	28.8	1.2e-11
VED23830.1|4922966_4923992_-|capsid,portal	capsid portal protein	capsid,portal	E5G6M3	Salmonella_phage	87.6	6.4e-170
VED23831.1|4923991_4925758_-	Terminase, ATPase subunit	NA	A0A1S6KZW3	Salmonella_phage	99.3	0.0e+00
VED23832.1|4925900_4926734_+|capsid	capsid scaffolding	capsid	A0A1S6KZW9	Salmonella_phage	92.1	3.1e-122
VED23833.1|4926750_4927809_+|capsid	P2 family phage major capsid protein	capsid	E5G6M6	Salmonella_phage	93.1	8.4e-181
VED23834.1|4927812_4928463_+|terminase	small terminase subunit	terminase	E5G6M7	Salmonella_phage	94.4	2.8e-110
VED23835.1|4928558_4929023_+|capsid	capsid completion protein	capsid	A0A1S6KZW8	Salmonella_phage	89.6	6.4e-77
VED23836.1|4929022_4929226_+|tail	tail X family protein	tail	E5G6M9	Salmonella_phage	92.5	1.4e-31
VED23837.1|4929229_4929445_+	putative secretory protein	NA	E5G6N0	Salmonella_phage	77.5	4.1e-26
VED23838.1|4929425_4929938_+	glycoside hydrolase family protein	NA	E5G6N1	Salmonella_phage	91.7	5.2e-88
VED23839.1|4929939_4930317_+	membrane protein	NA	A0A1S6KZZ2	Salmonella_phage	38.4	6.7e-16
VED23840.1|4930313_4930742_+	regulatory protein	NA	E5G6N2	Salmonella_phage	74.5	5.4e-46
VED23841.1|4930837_4931269_+|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	93.7	7.6e-72
VED23842.1|4931261_4931708_+|tail	phage tail protein	tail	A0A1S6L001	Salmonella_phage	86.3	2.3e-63
VED23843.1|4931776_4932355_+|plate	phage baseplate assembly protein V	plate	A0A1S6KZX7	Salmonella_phage	85.4	4.4e-91
VED23844.1|4932351_4932711_+	GPW/gp25 family protein	NA	A0A1S6KZZ4	Salmonella_phage	85.7	2.8e-51
VED23845.1|4932697_4933606_+|plate	Baseplate assembly protein GpJ	plate	A0A1S6KZY6	Salmonella_phage	90.7	2.7e-143
VED23846.1|4933598_4934204_+|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	92.5	2.6e-110
VED23847.1|4934200_4935592_+|tail	putative variable tail fiber protein	tail	M1TAS6	Escherichia_phage	77.4	4.4e-161
4934855:4934871	attR	CTGATTAACGGTGCGCC	NA	NA	NA	NA
VED23848.1|4935578_4935776_+	Uncharacterised protein	NA	NA	NA	NA	NA
VED23849.1|4935744_4936350_-|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	84.4	1.4e-92
VED23850.1|4936349_4936925_-|tail	putative tail fiber/collar phage protein	tail	A0A0F7LCR3	Escherichia_phage	62.3	7.3e-54
VED23851.1|4936955_4937522_+	site-specific DNA recombinase; e14 prophage	NA	A0A1S6L009	Salmonella_phage	84.2	4.9e-87
VED23852.1|4937664_4938837_+|tail	tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.3	7.8e-204
VED23853.1|4938846_4939362_+|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	95.3	2.1e-89
VED23854.1|4939416_4939719_+|tail	tail E family protein	tail	A0A1S6KZZ9	Salmonella_phage	88.0	1.6e-39
VED23855.1|4939845_4940358_+|tail	putative phage tail tape measure protein	tail	A0A1S6L010	Salmonella_phage	81.1	1.9e-29
VED23856.1|4940502_4941219_+|tail	putative phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	87.3	5.2e-102
VED23857.1|4941199_4941562_+|tail	putative phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	84.5	9.2e-47
VED23858.1|4941564_4942158_+|tail	TP901 family phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	55.6	3.1e-07
VED23859.1|4942102_4942606_+|tail	TP901 family phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	68.9	4.0e-56
