The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
LR134233	Salmonella enterica subsp. enterica strain NCTC9684 genome assembly, chromosome: 1	4610917	136706	143835	4610917		Prochlorococcus_phage(16.67%)	8	NA	NA
VEC90149.1|136706_137303_-	ADP-L-Glycero-D-mannoheptose-6-epimerase	NA	R9S880	Prochlorococcus_phage	41.5	4.8e-24
VEC90150.1|137262_137556_-	ADP-L-Glycero-D-mannoheptose-6-epimerase	NA	NA	NA	NA	NA
VEC90151.1|137842_138973_+	2-amino-3-ketobutyrate coenzyme A ligase	NA	V5LQ39	Emiliania_huxleyi_virus	31.2	3.9e-27
VEC90152.1|139046_139577_+	threonine 3-dehydrogenase	NA	K7Z7U2	Megavirus	34.1	4.4e-05
VEC90153.1|139576_140071_+	threonine 3-dehydrogenase	NA	R9TPW0	Vibrio_phage	84.6	1.0e-19
VEC90154.1|140564_141599_+	glycosyl transferase	NA	A0A1V0SAH6	Catovirus	31.3	1.4e-07
VEC90155.1|141585_142548_-	Putative periplasmic protein YibQ -like protein with nucleoside di phosphatase and polysaccharide deacetylase	NA	NA	NA	NA	NA
VEC90156.1|142551_143835_-	Periplasmic septal ring factor with murein hydrolase activity EnvC/YibP	NA	G9BW84	Planktothrix_phage	30.3	6.1e-08
>prophage 2
LR134233	Salmonella enterica subsp. enterica strain NCTC9684 genome assembly, chromosome: 1	4610917	475331	515849	4610917	tRNA,protease	Organic_Lake_phycodnavirus(50.0%)	47	NA	NA
VEC90481.1|475331_476297_-|tRNA	tRNA-dihydrouridine synthase B	tRNA	NA	NA	NA	NA
VEC90482.1|476957_477839_-	50S ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
VEC90483.1|477850_479302_-	sodium/pantothenate symporter	NA	NA	NA	NA	NA
VEC90484.1|479291_479534_-	Membrane protein	NA	NA	NA	NA	NA
VEC90485.1|479642_480527_-	biotin carboxylase	NA	NA	NA	NA	NA
VEC90486.1|480523_480991_-	biotin carboxylase	NA	NA	NA	NA	NA
VEC90487.1|481001_481472_-	Biotin carboxyl carrier protein of acetyl-CoA carboxylase	NA	NA	NA	NA	NA
VEC90488.1|481864_482464_-	Membrane protein YedZ	NA	NA	NA	NA	NA
VEC90489.1|482464_483469_-	reductase	NA	NA	NA	NA	NA
VEC90490.1|483581_484556_-	oxidoreductase	NA	NA	NA	NA	NA
VEC90491.1|484759_486700_+	lipoprotein	NA	NA	NA	NA	NA
VEC90492.1|487007_488051_+	rod shape-determining protein mreB	NA	F2Y0P3	Organic_Lake_phycodnavirus	22.3	6.7e-05
VEC90493.1|488115_489168_+	rod shape-determining protein	NA	NA	NA	NA	NA
VEC90494.1|489167_489659_+	rod shape-determining protein MreD	NA	NA	NA	NA	NA
VEC90495.1|489667_490261_+	Septum formation protein Maf	NA	NA	NA	NA	NA
VEC90496.1|490250_491720_+	ribonuclease G	NA	NA	NA	NA	NA
VEC90497.1|491830_495670_+	Uncharacterized protein involved in outer membrane biogenesis	NA	NA	NA	NA	NA
VEC90498.1|495774_495924_+|protease	protease TldD	protease	NA	NA	NA	NA
VEC90499.1|495947_496121_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEC90500.1|496157_497219_+|protease	protease TldD	protease	NA	NA	NA	NA
VEC90501.1|497341_498271_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
VEC90502.1|498452_498656_+	electron transfer flavoprotein FixA	NA	NA	NA	NA	NA
VEC90503.1|498663_499596_+	Fusaric acid resistance protein fusE	NA	NA	NA	NA	NA
VEC90504.1|499601_501569_+	fusaric acid resistance protein FusB/ fusaricacid resistance protein FusC	NA	NA	NA	NA	NA
VEC90505.1|501739_502012_+	putative ribonuclease inhibitor	NA	NA	NA	NA	NA
VEC90506.1|502071_502338_-	membrane protein	NA	NA	NA	NA	NA
VEC90507.1|502441_502705_-	membrane protein	NA	NA	NA	NA	NA
VEC90508.1|503070_503541_-	arginine repressor	NA	NA	NA	NA	NA
VEC90509.1|503955_504852_+	malate dehydrogenase	NA	NA	NA	NA	NA
VEC90510.1|505012_505642_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
VEC90511.1|505628_506294_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
VEC90512.1|506504_507773_+	possible membrane transport protein	NA	Q6A201	Oenococcus_phage	33.0	1.1e-59
VEC90513.1|507805_508705_+	tartrate dehydratase subunit alpha	NA	NA	NA	NA	NA
VEC90514.1|508704_508812_+	L(+)-tartrate dehydratase subunit beta	NA	NA	NA	NA	NA
VEC90515.1|509025_509202_+	L(+)-tartrate dehydratase subunit beta	NA	NA	NA	NA	NA
VEC90516.1|509168_509318_+	L(+)-tartrate dehydratase subunit beta	NA	NA	NA	NA	NA
VEC90517.1|509473_509737_+	oxaloacetate decarboxylase subunit gamma	NA	NA	NA	NA	NA
VEC90518.1|509840_510290_+	Oxaloacetate decarboxylase alpha chain	NA	NA	NA	NA	NA
VEC90519.1|510709_511336_+	oxaloacetate decarboxylase alpha subunit	NA	NA	NA	NA	NA
VEC90520.1|511332_511503_+	oxaloacetate decarboxylase	NA	NA	NA	NA	NA
VEC90521.1|511518_511707_+	oxaloacetate decarboxylase subunit beta	NA	NA	NA	NA	NA
VEC90522.1|511956_512820_+	oxaloacetate decarboxylase subunit beta	NA	NA	NA	NA	NA
VEC90523.1|512872_513571_+	membrane protein	NA	NA	NA	NA	NA
VEC90524.1|513604_514039_-|protease	serine endoprotease	protease	NA	NA	NA	NA
VEC90525.1|514085_514610_-|protease	serine endoprotease	protease	NA	NA	NA	NA
VEC90526.1|514840_515113_-|protease	serine protease	protease	NA	NA	NA	NA
VEC90527.1|515531_515849_-|protease	serine protease	protease	NA	NA	NA	NA
>prophage 3
LR134233	Salmonella enterica subsp. enterica strain NCTC9684 genome assembly, chromosome: 1	4610917	1055233	1062602	4610917	tRNA	Pseudomonas_phage(16.67%)	10	NA	NA
VEC91096.1|1055233_1055731_+	competence damage-inducible protein A	NA	B5TK85	Pseudomonas_phage	51.6	4.4e-31
VEC91097.1|1055815_1056877_+	recombinase A	NA	A0A2D1GPX2	Mycobacterium_phage	63.8	3.0e-114
VEC91098.1|1056954_1057494_+	Regulatory protein recX	NA	NA	NA	NA	NA
VEC91099.1|1058005_1058518_+|tRNA	alanyl-tRNA synthetase	tRNA	A0A1V0SK38	Klosneuvirus	38.2	1.5e-21
VEC91100.1|1058514_1059561_+|tRNA	alanyl-tRNA synthetase	tRNA	A0A2K9L3D8	Tupanvirus	33.5	1.9e-20
VEC91101.1|1059571_1059976_+|tRNA	alanyl-tRNA synthetase	tRNA	NA	NA	NA	NA
VEC91102.1|1059963_1060155_+|tRNA	alanyl-tRNA synthetase	tRNA	NA	NA	NA	NA
VEC91103.1|1060227_1060359_+|tRNA	alanyl-tRNA synthetase	tRNA	NA	NA	NA	NA
VEC91104.1|1060593_1060779_+	carbon storage regulator	NA	A0A2I7RT00	Vibrio_phage	66.7	4.9e-12
VEC91105.1|1062035_1062602_+	Phosphatase YqaB	NA	M1I5S4	Acanthocystis_turfacea_Chlorella_virus	27.6	7.2e-14
>prophage 4
LR134233	Salmonella enterica subsp. enterica strain NCTC9684 genome assembly, chromosome: 1	4610917	1573664	1587464	4610917	holin,tail,protease,head	Salmonella_phage(35.71%)	15	NA	NA
VEC91591.1|1573664_1574339_+|tail	side tail fiber protein	tail	Q6K1H2	Salmonella_virus	80.4	1.7e-46
VEC91592.1|1575116_1577555_+	E3 ubiquitin-protein ligase SspH2	NA	Q9MBL9	Phage_Gifsy-2	89.6	2.2e-51
VEC91593.1|1577554_1577656_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEC91594.1|1577645_1577876_+	DNA-binding protein	NA	Q8HA92	Salmonella_phage	100.0	5.0e-38
VEC91595.1|1577883_1578858_+	putative cytoplasmic protein	NA	A0A1C9IHZ5	Salmonella_phage	97.2	1.6e-186
VEC91596.1|1578875_1579241_+	phage antiterminator	NA	A5LH77	Enterobacteria_phage	81.7	7.4e-52
VEC91597.1|1579649_1580600_-	NTPase	NA	R9TRQ8	Vibrio_phage	28.5	1.1e-19
VEC91598.1|1580896_1581226_+|holin	holin	holin	Q8SBE1	Shigella_phage	94.6	3.9e-36
VEC91599.1|1581239_1581758_+|head,protease	phage pro-head protease	head,protease	Q8SBH9	Shigella_phage	88.0	5.2e-75
VEC91600.1|1581818_1583060_+	bacteriophage protein	NA	Q8HAB4	Salmonella_phage	94.4	2.3e-52
VEC91601.1|1583062_1583590_+|tail	tail protein	tail	A0A1S6KZZ1	Salmonella_phage	31.3	3.1e-11
VEC91602.1|1583967_1584411_+|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	43.9	1.4e-28
VEC91603.1|1584464_1586180_-	acetylase	NA	T1SAQ6	Salmonella_phage	30.1	3.1e-52
VEC91604.1|1586130_1586295_-	acetylase	NA	A0A193GZ69	Enterobacter_phage	62.2	1.0e-05
VEC91605.1|1586792_1587464_+	DNA polymerase V subunit	NA	Q1MVE7	Enterobacteria_phage	71.3	1.3e-49
>prophage 5
LR134233	Salmonella enterica subsp. enterica strain NCTC9684 genome assembly, chromosome: 1	4610917	1659520	1668689	4610917	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
VEC91679.1|1659520_1660468_+	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	27.8	2.8e-10
VEC91680.1|1660451_1661183_+	putative permease transmembrane component	NA	NA	NA	NA	NA
VEC91681.1|1661163_1661271_-	membrane protein	NA	NA	NA	NA	NA
VEC91682.1|1661330_1662032_-	transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	86.8	2.1e-95
VEC91683.1|1662417_1663968_+	putative sensor kinase	NA	Q9EYF3	Enterobacteria_phage	91.4	2.0e-239
VEC91684.1|1663964_1664684_+	two-component system response regulator	NA	NA	NA	NA	NA
VEC91685.1|1664730_1665198_+	Protein of uncharacterised function (DUF1456)	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
VEC91686.1|1665254_1665785_-	lipoprotein	NA	NA	NA	NA	NA
VEC91687.1|1665956_1666415_-	lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
VEC91688.1|1666655_1668689_-|tRNA	methionyl-tRNA synthetase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.0e-54
>prophage 6
LR134233	Salmonella enterica subsp. enterica strain NCTC9684 genome assembly, chromosome: 1	4610917	1735591	1746096	4610917		Enterobacteria_phage(37.5%)	11	NA	NA
VEC91751.1|1735591_1736995_+	Colanic acid biosynthesis protein wcaM	NA	A0A291LBB9	Klebsiella_phage	26.5	4.0e-21
VEC91752.1|1737172_1738066_+	UTP-glucose-1-phosphate uridylyltransferase	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
VEC91753.1|1738442_1739528_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.6e-102
VEC91754.1|1739527_1740427_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.0	5.1e-30
VEC91755.1|1740474_1741353_+	glucose-1-phosphate thymidylyltransferase	NA	I7I009	Enterobacteria_phage	65.5	2.1e-108
VEC91756.1|1741356_1741905_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.0	1.3e-52
VEC91757.1|1741910_1742741_+	CDP-6-deoxy-delta-3,4-glucoseen reductase	NA	NA	NA	NA	NA
VEC91758.1|1742740_1742902_+	CDP-6-deoxy-delta-3,4-glucoseen reductase	NA	NA	NA	NA	NA
VEC91759.1|1742898_1743672_+	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
VEC91760.1|1743676_1744756_+	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.5	1.7e-16
VEC91761.1|1744782_1746096_+	lipopolysaccharide biosynthesis protein	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	7.0e-52
>prophage 7
LR134233	Salmonella enterica subsp. enterica strain NCTC9684 genome assembly, chromosome: 1	4610917	1939512	1987624	4610917	tail,terminase,integrase,tRNA,transposase	Bacillus_virus(10.53%)	56	1975800:1975822	1986128:1986150
VEC91996.1|1939512_1941246_-|tRNA	arginyl-tRNA synthetase	tRNA	A0A2K9L6Z2	Tupanvirus	33.9	9.8e-86
VEC91997.1|1941482_1942052_+	Protein yecM	NA	NA	NA	NA	NA
VEC91998.1|1942071_1942818_+	copper homeostasis protein CutC	NA	NA	NA	NA	NA
VEC91999.1|1943040_1943499_+|transposase	transposase for IS200	transposase	I4AZI8	Saccharomonospora_phage	31.5	1.0e-13
VEC92000.1|1943764_1944736_-|tRNA	tRNA (5-methoxyuridine) 34 synthase	tRNA	NA	NA	NA	NA
VEC92001.1|1944732_1945476_-|tRNA	tRNA (uridine-5-oxyacetic acid methyl ester) 34 synthase	tRNA	F5B419	Synechococcus_phage	30.9	3.2e-25
VEC92002.1|1945516_1945912_-	membrane protein	NA	NA	NA	NA	NA
VEC92003.1|1945964_1946312_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEC92004.1|1946317_1946782_-	Protein of uncharacterised function DUF72	NA	Q859D1	Escherichia_coli_phage	78.5	3.4e-46
VEC92005.1|1946778_1947345_-	putative isochorismatase hydrolase	NA	NA	NA	NA	NA
VEC92006.1|1947718_1949440_+|tRNA	aspartyl-tRNA synthetase	tRNA	NA	NA	NA	NA
VEC92007.1|1949542_1949995_+	dATP pyrophosphohydrolase	NA	NA	NA	NA	NA
VEC92008.1|1950024_1950765_+	Probable transcriptional regulatory protein YebC	NA	NA	NA	NA	NA
VEC92009.1|1950801_1951323_+	crossover junction endodeoxyribonuclease	NA	G3MA90	Bacillus_virus	35.1	2.6e-10
VEC92010.1|1951324_1951924_-	protein yebB	NA	NA	NA	NA	NA
VEC92011.1|1952132_1952744_+	membrane protein	NA	NA	NA	NA	NA
VEC92012.1|1953183_1953492_+	Holliday junction ATP-dependent DNA helicase ruvA	NA	NA	NA	NA	NA
VEC92013.1|1953460_1953727_+	Holliday junction ATP-dependent DNA helicase ruvA	NA	NA	NA	NA	NA
VEC92014.1|1953803_1954415_+	Holliday junction DNA helicase	NA	A0A127AWE7	Bacillus_phage	27.1	3.2e-07
VEC92015.1|1954411_1954813_+	Holliday junction DNA helicase	NA	NA	NA	NA	NA
VEC92016.1|1954891_1955677_-	high-affinity zinc uptake system membrane protein	NA	NA	NA	NA	NA
VEC92017.1|1955673_1956363_-	high-affinity zinc transporter ATPase	NA	G3M9Y6	Bacillus_virus	30.3	5.2e-14
VEC92018.1|1956698_1957145_+	high-affinity zinc transporter periplasmic protein	NA	NA	NA	NA	NA
VEC92019.1|1957470_1957986_+	Cell wall endopeptidase family M23/M37	NA	NA	NA	NA	NA
VEC92020.1|1957999_1958791_+	Cell wall endopeptidase family M23/M37	NA	A8ATH6	Listeria_phage	40.9	1.6e-14
VEC92021.1|1958907_1959879_+	lipid A biosynthesis (KDO)2-(lauroyl)-lipid IVA acyltransferase	NA	NA	NA	NA	NA
VEC92022.1|1959951_1961394_-	pyruvate kinase A	NA	NA	NA	NA	NA
VEC92023.1|1961517_1962387_-	DNA-binding transcriptional regulator HexR	NA	NA	NA	NA	NA
VEC92024.1|1962728_1964204_+	glucose 6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	37.5	2.6e-79
VEC92025.1|1964438_1966250_+	6-phosphogluconate dehydratase	NA	NA	NA	NA	NA
VEC92026.1|1966287_1966929_+	KHG/KDPG aldolase	NA	NA	NA	NA	NA
VEC92027.1|1967028_1968207_-	phosphoribosylglycinamide formyltransferase 2	NA	NA	NA	NA	NA
VEC92028.1|1968337_1968628_+	DNA damage-inducible gene in SOS regulon-dependent on cyclic AMP and H-NS	NA	NA	NA	NA	NA
VEC92029.1|1968695_1969049_+	protein YebF	NA	NA	NA	NA	NA
VEC92030.1|1969142_1969802_+	inner membrane protein YebE	NA	NA	NA	NA	NA
VEC92031.1|1970015_1972067_+	oligopeptidase	NA	NA	NA	NA	NA
VEC92032.1|1972103_1972802_-	exodeoxyribonuclease X	NA	Q6UAU3	Klebsiella_phage	40.4	2.8e-07
VEC92033.1|1972825_1973482_-	Putative amido hydrolase	NA	NA	NA	NA	NA
VEC92034.1|1973589_1973820_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	60.3	2.9e-14
VEC92035.1|1973957_1974332_+	Copper resistance protein CopC	NA	NA	NA	NA	NA
VEC92036.1|1974332_1975208_+	membrane protein	NA	NA	NA	NA	NA
VEC92037.1|1975224_1975578_+	Protein of uncharacterised function (DUF2511)	NA	NA	NA	NA	NA
1975800:1975822	attL	GGAATCGTATTCGGTCTCTTTTT	NA	NA	NA	NA
VEC92038.1|1975839_1975968_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEC92039.1|1975952_1976222_-|integrase	integrase	integrase	K7PHK0	Enterobacteria_phage	47.8	2.7e-11
VEC92040.1|1976236_1977031_-|integrase	phage integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	56.0	1.3e-72
VEC92041.1|1977027_1978134_-	exodeoxyribonuclease 8	NA	Q9QF34	Lambdoid_phage	65.0	8.2e-54
VEC92042.1|1978164_1978395_+	lytic enzyme	NA	Q8HA86	Salmonella_phage	93.7	6.1e-28
VEC92043.1|1978448_1978982_+	exported phage protein	NA	A0A291LBG9	Klebsiella_phage	43.0	5.4e-11
VEC92044.1|1979238_1979406_-	lytic enzyme	NA	NA	NA	NA	NA
VEC92045.1|1979713_1979977_+|terminase	terminase	terminase	Q9EYD0	Enterobacteria_phage	57.5	6.5e-18
VEC92046.1|1980131_1980563_+|tail	caudovirales tail fibre assembly protein	tail	A0A0M4QWS3	Salmonella_phage	90.4	4.3e-59
VEC92047.1|1982579_1982702_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEC92048.1|1983150_1983765_-	disulfide bond formation protein	NA	NA	NA	NA	NA
VEC92049.1|1983774_1983933_-	membrane protein	NA	NA	NA	NA	NA
VEC92050.1|1984065_1984980_-	drug/metabolite transporter DMT permease	NA	NA	NA	NA	NA
VEC92051.1|1986766_1987624_+|transposase	transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	28.2	1.3e-19
1986128:1986150	attR	GGAATCGTATTCGGTCTCTTTTT	NA	NA	NA	NA
>prophage 8
LR134233	Salmonella enterica subsp. enterica strain NCTC9684 genome assembly, chromosome: 1	4610917	3223629	3230620	4610917	transposase	Salmonella_phage(57.14%)	9	NA	NA
VEC93384.1|3223629_3223995_-	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	41.5	1.8e-18
VEC93385.1|3224258_3225113_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
VEC93386.1|3225163_3225598_-	cation efflux system protein CusA	NA	NA	NA	NA	NA
VEC93387.1|3226648_3227011_+	translocase	NA	I1TED9	Salmonella_phage	99.2	1.1e-60
VEC93388.1|3227007_3227934_+	bactoprenol glucosyl transferase	NA	I1TED8	Salmonella_phage	97.4	4.9e-169
VEC93389.1|3227926_3229312_+	putative inner membrane protein	NA	B9UDL6	Salmonella_phage	40.2	1.2e-73
VEC93390.1|3229622_3229781_-	Uncharacterised protein	NA	A0A1W5PUZ7	Salmonella_phage	67.3	8.4e-13
VEC93391.1|3229952_3230171_+|transposase	transposase	transposase	U5P4I9	Shigella_phage	76.7	2.3e-16
VEC93392.1|3230347_3230620_+|transposase	transposase	transposase	U5P429	Shigella_phage	86.8	2.8e-32
