The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
LR134228	Escherichia coli strain NCTC9699 genome assembly, chromosome: 1	4969847	685574	708018	4969847	tRNA,portal,integrase,terminase,protease	Escherichia_phage(25.0%)	21	691301:691321	708776:708796
VEC66230.1|685574_685907_+|tRNA	putative tRNA-binding protein	tRNA	NA	NA	NA	NA
VEC66232.1|685948_687439_-	putrescine--2-oxoglutarate aminotransferase	NA	A0A1V0SKB7	Klosneuvirus	28.6	2.2e-33
VEC66234.1|687745_689266_+	aerotaxis receptor protein	NA	A0A1B0V854	Salmonella_phage	51.5	3.1e-35
VEC66236.1|689419_690043_-	putative transcriptional regulator	NA	NA	NA	NA	NA
VEC66238.1|690330_691095_+	siderophore-interacting protein	NA	NA	NA	NA	NA
691301:691321	attL	ACGGTATCCTATAGGTATCCT	NA	NA	NA	NA
VEC66240.1|691374_692796_+|integrase	integrase	integrase	NA	NA	NA	NA
VEC66242.1|692788_693505_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEC66244.1|693866_694529_+	putative prophage protein	NA	NA	NA	NA	NA
VEC66246.1|694521_694842_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEC66248.1|694848_695148_+	putative prophage protein	NA	NA	NA	NA	NA
VEC66250.1|695144_696962_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	50.7	1.5e-129
VEC66252.1|697287_697539_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEC66254.1|697683_697845_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEC66256.1|697949_698489_+|protease	protease/scaffold protein	protease	A0A1W6JT88	Pseudomonas_phage	64.0	3.1e-38
VEC66258.1|698436_698862_+|integrase	putative integrase of prophage	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	45.5	8.1e-26
VEC66260.1|700647_701361_-	HEPN domain	NA	NA	NA	NA	NA
VEC66262.1|701506_701719_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEC66264.1|701715_703632_+|portal	phage portal protein, lambda family	portal	K7PKX4	Enterobacterial_phage	58.2	2.1e-214
VEC66266.1|704021_704912_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEC66268.1|705664_707275_+|portal	phage portal protein, lambda family	portal	S5M7Q8	Escherichia_phage	55.2	4.7e-175
VEC66270.1|707532_708018_+|terminase	bacteriophage DNA packaging protein; terminase, small subunit	terminase	A0A291AWV8	Escherichia_phage	66.9	1.3e-48
708776:708796	attR	ACGGTATCCTATAGGTATCCT	NA	NA	NA	NA
>prophage 2
LR134228	Escherichia coli strain NCTC9699 genome assembly, chromosome: 1	4969847	1127332	1137792	4969847	tRNA	Escherichia_phage(57.14%)	9	NA	NA
VEC67039.1|1127332_1128325_+	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
VEC67041.1|1128418_1129783_-	inner membrane permease YgbN	NA	NA	NA	NA	NA
VEC67043.1|1129871_1130648_-	hydroxypyruvate isomerase	NA	NA	NA	NA	NA
VEC67045.1|1130652_1131291_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
VEC67047.1|1131287_1132550_-|tRNA	paral putative tRNA synthase	tRNA	A0A077SLJ7	Escherichia_phage	61.0	8.3e-135
VEC67049.1|1132546_1133455_-	oxidoreductase YgbJ	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
VEC67051.1|1133650_1134418_+	DeoR family transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	2.5e-70
VEC67053.1|1134468_1135125_-	serine/threonine-specific protein phosphatase 2	NA	K7P7V3	Enterobacteria_phage	45.3	5.6e-50
VEC67055.1|1135230_1137792_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	2.3e-30
>prophage 3
LR134228	Escherichia coli strain NCTC9699 genome assembly, chromosome: 1	4969847	1217613	1227431	4969847	integrase	Enterobacteria_phage(87.5%)	11	1216601:1216614	1228801:1228814
1216601:1216614	attL	AATATCATTTATCC	NA	NA	NA	NA
VEC67208.1|1217613_1219947_-	putative prophage DNA primase	NA	Q7M2A8	Enterobacteria_phage	98.7	0.0e+00
VEC67210.1|1219961_1220282_-	P4 phage protein	NA	NA	NA	NA	NA
VEC67212.1|1220417_1220873_-	putative prophage protein	NA	Q7M298	Enterobacteria_phage	99.1	1.6e-64
VEC67214.1|1220865_1221153_-	prophage derepression protein	NA	Q7M2A0	Enterobacteria_phage	97.9	8.6e-48
VEC67216.1|1221145_1221343_-	regulator protein cI	NA	Q7M2A7	Enterobacteria_phage	98.5	8.9e-28
VEC67218.1|1221696_1221963_-	prophage regulatory protein	NA	Q7M299	Enterobacteria_phage	100.0	4.9e-45
VEC67220.1|1222515_1223250_+	glycoprotein 3	NA	Q7M2A2	Enterobacteria_phage	98.4	3.9e-129
VEC67222.1|1223246_1223747_+	transcriptional activator Ogr/delta	NA	NA	NA	NA	NA
VEC67224.1|1223820_1224393_+	prophage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	97.3	2.2e-95
VEC67226.1|1224591_1226229_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEC67228.1|1226225_1227431_-|integrase	putative phage integrase	integrase	A0A1B5FPC6	Escherichia_phage	50.2	2.0e-109
1228801:1228814	attR	GGATAAATGATATT	NA	NA	NA	NA
>prophage 4
LR134228	Escherichia coli strain NCTC9699 genome assembly, chromosome: 1	4969847	1748999	1758441	4969847		Enterobacteria_phage(85.71%)	10	NA	NA
VEC67813.1|1748999_1749926_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.8	2.8e-23
VEC67814.1|1749930_1750662_+	ABC transporter permease	NA	NA	NA	NA	NA
VEC67815.1|1750642_1750750_-	putative inner membrane protein	NA	NA	NA	NA	NA
VEC67816.1|1750809_1751541_-	MerR family transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
VEC67817.1|1751762_1753448_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
VEC67818.1|1753444_1754164_+	two-component response-regulatory protein YehT	NA	NA	NA	NA	NA
VEC67819.1|1754210_1754681_+	conserved protein, DUF1456 family	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
VEC67820.1|1754721_1755183_-	lipoprotein yehR	NA	Q9EYF5	Enterobacteria_phage	98.7	1.6e-75
VEC67821.1|1755307_1757308_-	zinc finger SWIM domain-containing protein	NA	Q9EYF6	Enterobacteria_phage	96.4	0.0e+00
VEC67822.1|1757304_1758441_-	von Willebrand factor type A domain protein YehP	NA	Q9EYF7	Enterobacteria_phage	97.7	1.9e-162
>prophage 5
LR134228	Escherichia coli strain NCTC9699 genome assembly, chromosome: 1	4969847	1774715	1840490	4969847	tRNA,integrase,tail,terminase,protease,capsid,plate,holin,lysis	Escherichia_phage(46.67%)	75	1801958:1801984	1836167:1836193
VEC67829.1|1774715_1776749_-|tRNA	methionyl-tRNA synthetase	tRNA	A0A1V0SDF2	Indivirus	27.8	1.0e-54
VEC67830.1|1776880_1777990_+	ATPase	NA	NA	NA	NA	NA
VEC67831.1|1778252_1778534_+	fimbrial-like adhesin protein	NA	NA	NA	NA	NA
VEC67832.1|1778826_1779369_+	fimbrial protein	NA	NA	NA	NA	NA
VEC67833.1|1779448_1779910_+	putative periplasmic pilin chaperone	NA	NA	NA	NA	NA
VEC67834.1|1780137_1782618_+	fimbrial outer membrane usher protein	NA	NA	NA	NA	NA
VEC67835.1|1782633_1783668_+	putative fimbrial adhesin	NA	NA	NA	NA	NA
VEC67836.1|1783749_1784088_-	periplasmic modulator of Ni and Co efflux	NA	NA	NA	NA	NA
VEC67837.1|1784306_1785131_-	nickel/cobalt efflux protein RcnA	NA	NA	NA	NA	NA
VEC67838.1|1785251_1785524_+	transcriptional repressor RcnR	NA	NA	NA	NA	NA
VEC67839.1|1785746_1786535_+	hydroxyethylthiazole kinase	NA	NA	NA	NA	NA
VEC67840.1|1786531_1787332_+	phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
VEC67841.1|1787396_1788215_+	1,4-beta-N-acetylmuramidase	NA	D0R7H8	Paenibacillus_phage	38.5	2.9e-24
VEC67842.1|1788266_1789013_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
VEC67843.1|1788986_1789952_-	putative carbohydrate/pyrimidine kinase	NA	NA	NA	NA	NA
VEC67844.1|1789948_1790953_-	putative ADP-ribosylglycohydrolase	NA	A0A1S6UB21	Serratia_phage	29.4	7.5e-14
VEC67845.1|1790949_1792005_-	major facilitator superfamily protein	NA	NA	NA	NA	NA
VEC67846.1|1792485_1793538_+	fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
VEC67847.1|1793845_1794700_+	tagatose-bisphosphate aldolase	NA	NA	NA	NA	NA
VEC67848.1|1794728_1795991_+	putative tagatose 6-phosphate kinase	NA	NA	NA	NA	NA
VEC67849.1|1796000_1796453_+	galactitol-specific PTS system EIIA component	NA	NA	NA	NA	NA
VEC67850.1|1796483_1796768_+	galactitol-specific PTS system EIIB component	NA	NA	NA	NA	NA
VEC67851.1|1796771_1798127_+	galactitol-specific PTS system EIIC component	NA	NA	NA	NA	NA
VEC67852.1|1798174_1799215_+	galactitol-1-phosphate 5-dehydrogenase	NA	NA	NA	NA	NA
VEC67853.1|1799314_1800094_+	galactitol utilization operon repressor	NA	NA	NA	NA	NA
VEC67854.1|1800175_1801075_-	lipid kinase	NA	A0A1V0SBJ0	Catovirus	29.0	1.7e-12
VEC67855.1|1801480_1801798_+	protein	NA	NA	NA	NA	NA
1801958:1801984	attL	AAAAAATAAGCCCGTGTAAGGGAGATT	NA	NA	NA	NA
VEC67856.1|1802063_1802681_-|integrase	phage integrase	integrase	Q83VS6	Escherichia_phage	99.0	2.2e-112
VEC67857.1|1802884_1803076_-|integrase	phage integrase	integrase	Q83VS6	Escherichia_phage	94.1	1.6e-10
VEC67858.1|1803190_1803490_-	immunity repressor	NA	Q1JS63	Enterobacteria_phage	100.0	2.5e-50
VEC67859.1|1803604_1803880_+	regulatory protein	NA	Q1JS62	Enterobacteria_phage	100.0	1.3e-48
VEC67860.1|1803890_1804061_+	Uncharacterised protein	NA	S4TNZ7	Salmonella_phage	100.0	6.1e-25
VEC67861.1|1804057_1804558_+	Phage protein B	NA	S4TTB7	Salmonella_phage	99.4	3.8e-91
VEC67862.1|1804621_1804846_+	Protein of uncharacterised function (DUF2732)	NA	S4TP68	Salmonella_phage	98.6	3.0e-32
VEC67863.1|1804845_1805148_+	Uncharacterised protein	NA	A0A0F7LDT6	Escherichia_phage	97.0	7.2e-45
VEC67864.1|1805147_1805372_+	C4-type zinc finger protein, DksA/TraR family	NA	S4TRY6	Salmonella_phage	100.0	2.9e-35
VEC67865.1|1805368_1805644_+	relication initiation protein	NA	Q858T5	Yersinia_virus	98.9	1.9e-44
VEC67866.1|1805633_1807907_+	Replication gene A protein (GpA)	NA	A0A0F7LBQ2	Escherichia_phage	97.2	0.0e+00
VEC67867.1|1808017_1808938_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEC67868.1|1808951_1809416_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEC67869.1|1809417_1811439_+	ATPase involved in DNA repair	NA	NA	NA	NA	NA
VEC67870.1|1811750_1812785_-|capsid	phage capsid protein	capsid	A0A0F7LDI7	Escherichia_phage	100.0	1.9e-201
VEC67871.1|1812784_1814557_-	Terminase, ATPase subunit (GpP)	NA	A0A0F7LCK3	Escherichia_phage	99.5	0.0e+00
VEC67872.1|1814730_1815585_+|capsid	phage capsid scaffolding protein	capsid	Q94MI4	Enterobacteria_phage	96.1	3.1e-133
VEC67873.1|1815643_1816717_+|capsid	major capsid protein	capsid	Q94MK2	Enterobacteria_phage	99.4	1.1e-199
VEC67874.1|1816720_1817470_+|terminase	small terminase subunit	terminase	Q94MJ2	Enterobacteria_phage	92.8	1.0e-119
VEC67875.1|1817569_1818079_+|capsid	capsid completion protein	capsid	U5N0S3	Enterobacteria_phage	100.0	1.1e-90
VEC67876.1|1818078_1818282_+|tail	phage tail protein X	tail	A0A0F7LCN2	Escherichia_phage	100.0	3.0e-31
VEC67877.1|1818285_1818567_+|holin,lysis	phage lysis holin	holin,lysis	A0A0F7LA12	Escherichia_phage	100.0	1.3e-43
VEC67878.1|1818566_1819064_+	phage lysin	NA	A0A0F7LBS0	Escherichia_phage	100.0	3.1e-93
VEC67879.1|1819078_1819504_+	LysA protein	NA	A0A0F7LDU9	Escherichia_phage	96.5	1.9e-59
VEC67880.1|1819491_1819917_+	LysB protein	NA	A0A0F7L9Y0	Escherichia_phage	97.2	2.1e-66
VEC67881.1|1819903_1820062_+|lysis	phage lysis protein	lysis	A0A0F7LCN5	Escherichia_phage	100.0	2.6e-22
VEC67882.1|1820024_1820492_+|tail	tail protein	tail	A0A0F7LA33	Escherichia_phage	98.1	2.5e-81
VEC67883.1|1820484_1820937_+|tail	tail protein	tail	A0A0F7LDR6	Escherichia_phage	99.3	2.4e-76
VEC67884.1|1821008_1821794_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEC67885.1|1821877_1822513_+|plate	Baseplate assembly protein V (GpV)	plate	U5N3F0	Enterobacteria_phage	96.7	9.3e-111
VEC67886.1|1822509_1822857_+|plate	phage baseplate protein	plate	A0A0F7L9X3	Escherichia_phage	100.0	1.7e-58
VEC67887.1|1822861_1823770_+|plate	baseplate assembly protein	plate	A0A0F7LCJ3	Escherichia_phage	99.3	4.4e-162
VEC67888.1|1823762_1824293_+|tail	tail protein I (GpI)	tail	A0A0F7LDF3	Escherichia_phage	100.0	1.0e-102
VEC67889.1|1824303_1826553_+|tail	putative tail fiber protein (GpH)	tail	U5N099	Enterobacteria_phage	56.2	3.5e-136
VEC67890.1|1826556_1827084_+|tail	tail assembly chaperone gp38	tail	U5N0T1	Enterobacteria_phage	93.7	2.9e-89
VEC67891.1|1827255_1827594_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEC67892.1|1827878_1828937_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEC67893.1|1829462_1830653_+|tail	major tail sheath protein FI	tail	A0A0F7LBW9	Escherichia_phage	99.2	1.8e-224
VEC67894.1|1830665_1831184_+|tail	phage major tail tube protein FII	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
VEC67895.1|1831240_1831516_+|tail	tail protein E (GpE)	tail	A0A0F7LDQ8	Escherichia_phage	100.0	5.7e-41
VEC67896.1|1831660_1834108_+|tail	phage related tail protein	tail	Q858U7	Yersinia_virus	95.6	0.0e+00
VEC67897.1|1834122_1834602_+	gpU phage protein	NA	Q7Y4C7	Escherichia_virus	96.2	6.2e-83
VEC67898.1|1834601_1835765_+	phage protein D	NA	U5N3V4	Enterobacteria_phage	99.5	2.4e-205
VEC67899.1|1835846_1836065_+	transcriptional activator Ogr/delta	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
VEC67900.1|1836337_1837699_-|protease	putative protease	protease	Q6DW11	Phage_TP	99.5	1.6e-216
1836167:1836193	attR	AAAAAATAAGCCCGTGTAAGGGAGATT	NA	NA	NA	NA
VEC67901.1|1837844_1838177_-	protein	NA	NA	NA	NA	NA
VEC67902.1|1838367_1839090_-	two-component response regulator	NA	W8CYM9	Bacillus_phage	33.6	3.7e-31
VEC67903.1|1839086_1840490_-	two-component sensor kinase	NA	W8CYF6	Bacillus_phage	29.0	3.0e-32
>prophage 6
LR134228	Escherichia coli strain NCTC9699 genome assembly, chromosome: 1	4969847	2339820	2456719	4969847	portal,integrase,tail,terminase,protease,head,transposase,lysis	Enterobacteria_phage(34.43%)	118	2405382:2405398	2451796:2451812
VEC68574.1|2339820_2340642_-|protease	putative protease	protease	NA	NA	NA	NA
VEC68575.1|2340917_2341226_-	acid shock protein	NA	NA	NA	NA	NA
VEC68576.1|2341649_2342903_-	major facilitator superfamily protein	NA	NA	NA	NA	NA
VEC68577.1|2343009_2343903_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
VEC68578.1|2344037_2345258_+	protein Mlc (making large colonies protein)	NA	NA	NA	NA	NA
VEC68579.1|2345382_2346078_+	dithiobiotin synthetase	NA	NA	NA	NA	NA
VEC68580.1|2346030_2347287_-	voltage-gated ClC-type chloride channel	NA	NA	NA	NA	NA
VEC68581.1|2347481_2348096_-	anaerobic dimethyl sulfoxide reductase maturation protein (twin-arginine leader-binding protein)	NA	A0A077SLS7	Escherichia_phage	36.3	8.7e-29
VEC68582.1|2348138_2348993_-	putative dimethyl sulfoxide reductase, anchor subunit	NA	NA	NA	NA	NA
VEC68583.1|2348994_2349612_-	anaerobic dimethyl sulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
VEC68584.1|2349622_2352019_-	putative dimethyl sulfoxide reductase, olydopterin dinucleotide binding subunit	NA	A0A077SK27	Escherichia_phage	48.6	8.2e-208
VEC68585.1|2352106_2354533_-	putative dimethyl sulfoxide reductase, oxidoreductase subunit	NA	A0A077SK27	Escherichia_phage	49.2	4.5e-214
VEC68586.1|2354731_2355037_-	protein	NA	NA	NA	NA	NA
VEC68587.1|2355108_2355855_+	lipoprotein	NA	NA	NA	NA	NA
VEC68588.1|2355857_2356418_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
VEC68589.1|2356452_2356794_-	protein	NA	NA	NA	NA	NA
VEC68590.1|2356928_2357255_+	inner membrane protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
VEC68591.1|2357460_2358675_+	starvation sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
VEC68592.1|2358686_2359706_+	dehydrogenase	NA	E3SJ82	Synechococcus_phage	25.9	3.7e-16
VEC68593.1|2359893_2361174_-|integrase	defective integrase; Qin prophage	integrase	B6DZ48	Enterobacteria_phage	62.3	6.6e-156
VEC68594.1|2361208_2361445_-	putative excisionase	NA	S4TND0	Salmonella_phage	50.7	6.1e-15
VEC68595.1|2361532_2364004_-	putative exonuclease from phage origin	NA	A0A192Y6E0	Salmonella_phage	56.7	8.5e-59
VEC68596.1|2364097_2364289_-	putative prophage protein	NA	NA	NA	NA	NA
VEC68597.1|2364285_2364474_-	division inhibition protein	NA	NA	NA	NA	NA
VEC68598.1|2364960_2365536_-	putative prophage protein	NA	NA	NA	NA	NA
VEC68599.1|2365537_2365693_-	putative prophage protein	NA	M4QQ57	Salicola_phage	51.1	8.8e-07
VEC68600.1|2365885_2366344_-	transcriptional repressor DicA	NA	I6PD69	Cronobacter_phage	46.2	2.8e-24
VEC68601.1|2366370_2366598_+	DNA-binding transcriptional regulator DicC	NA	NA	NA	NA	NA
VEC68602.1|2366581_2367103_+	YdfX	NA	NA	NA	NA	NA
VEC68603.1|2367083_2368049_+	ybl78	NA	U5P0A0	Shigella_phage	60.6	1.9e-54
VEC68604.1|2368089_2368509_+	exclusion protein	NA	A0A0U2QQN3	Escherichia_phage	93.4	1.3e-55
VEC68605.1|2368542_2369883_+|integrase,transposase	putative integrase/transposase	integrase,transposase	NA	NA	NA	NA
VEC68606.1|2370319_2370652_-	Qin prophage protein	NA	NA	NA	NA	NA
VEC68607.1|2371184_2371424_+	antitoxin of the RelE-RelB toxin-antitoxin system and transcriptional repressor of relBEF	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	54.4	1.6e-18
VEC68608.1|2371423_2371711_+	toxin of the RelE-RelB toxin-antitoxin system	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	66.0	1.4e-29
VEC68609.1|2371782_2371938_+	putative host cell-killing modulation protein	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
VEC68610.1|2372154_2372406_+	putative prophage protein	NA	NA	NA	NA	NA
VEC68611.1|2372752_2373802_+	putative prophage protein	NA	A0A291AWV9	Escherichia_phage	57.3	1.3e-112
VEC68612.1|2373815_2374568_+	lambdoid prophage Qin antitermination protein Q-like protein	NA	A0A192Y5X6	Salmonella_phage	92.8	7.1e-134
VEC68613.1|2374989_2375202_-	cold shock-like protein CspF	NA	NA	NA	NA	NA
VEC68614.1|2376480_2376687_+|lysis	phage lysis protein	lysis	A5LH82	Enterobacteria_phage	94.1	4.5e-30
VEC68615.1|2376691_2377003_+	Qin prophage protein	NA	K7PGU6	Enterobacteria_phage	64.6	2.0e-26
VEC68616.1|2376999_2377533_+	prophage lysozyme (endolysin)	NA	K7PLY1	Enterobacteria_phage	93.2	6.4e-97
VEC68617.1|2377529_2377976_+	Qin prophage protein	NA	A0A291LBG9	Klebsiella_phage	49.1	6.3e-05
VEC68618.1|2379275_2379449_+	GnsA/GnsB family transcriptional regulator	NA	NA	NA	NA	NA
VEC68619.1|2379600_2380011_-	putative envelope protein	NA	C6ZCX4	Enterobacteria_phage	89.0	2.1e-63
VEC68620.1|2380311_2380518_+	DLP12 prophage; predicted protein	NA	A0A0K2FJ18	Enterobacteria_phage	91.2	6.7e-26
VEC68621.1|2380538_2380706_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEC68622.1|2381090_2381618_+|terminase	putative terminase small subunit	terminase	A5LH26	Enterobacteria_phage	100.0	2.1e-92
VEC68623.1|2381626_2383726_+|terminase	terminase large subunit	terminase	A5LH27	Enterobacteria_phage	96.4	0.0e+00
VEC68624.1|2383722_2383935_+	prophage protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
VEC68625.1|2383934_2385443_+|head,tail,portal	portal protein (head-tail preconnector protein) from prophage	head,tail,portal	A5LH29	Enterobacteria_phage	100.0	3.1e-290
VEC68626.1|2385387_2386833_+|protease	ATP-dependent Clp protease proteolytic subunit	protease	A5LH30	Enterobacteria_phage	99.3	8.1e-235
VEC68627.1|2386835_2387414_+|protease	ATP-dependent Clp protease proteolytic subunit	protease	A5LH30	Enterobacteria_phage	100.0	1.4e-100
VEC68628.1|2387500_2387824_+	prophage protein	NA	A0A291AWX2	Escherichia_phage	100.0	8.5e-52
VEC68629.1|2387816_2388092_+	prophage protein	NA	K7PH43	Enterobacteria_phage	100.0	2.3e-45
VEC68630.1|2388103_2388682_+|tail	Minor tail protein Z (GPZ) of prophage	tail	A5LH33	Enterobacteria_phage	99.0	6.1e-101
VEC68631.1|2388678_2389080_+|tail	Minor tail protein U	tail	A0A291AWY2	Escherichia_phage	100.0	8.3e-73
VEC68632.1|2389091_2389835_+|tail	Major tail protein V	tail	A0A291AWU6	Escherichia_phage	100.0	7.8e-133
VEC68633.1|2389895_2390282_+|tail	minor tail component of prophage	tail	A0A291AWW5	Escherichia_phage	99.2	3.6e-65
VEC68634.1|2390290_2390620_+|tail	minor tail protein T of prophage	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
VEC68635.1|2390591_2393657_+|tail	putative tail length tape measure protein from putative prophage	tail	A0A291AWX1	Escherichia_phage	99.2	0.0e+00
VEC68636.1|2393656_2393986_+|tail	Minor tail protein M	tail	A5LH39	Enterobacteria_phage	100.0	1.7e-60
VEC68637.1|2393995_2394694_+|tail	phage minor tail protein	tail	A5LH40	Enterobacteria_phage	97.4	6.8e-131
VEC68638.1|2394698_2395442_+|tail	putative tail fiber component K of prophage	tail	K7PLW1	Enterobacteria_phage	98.4	9.2e-150
VEC68639.1|2395438_2395987_+	Tail assembly protein I from prophage	NA	A0A291AWV5	Escherichia_phage	100.0	1.1e-94
VEC68640.1|2396047_2399446_+	Host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	88.6	0.0e+00
VEC68641.1|2399512_2400112_+	outer membrane precursor Lom	NA	A0A0P0ZCF6	Stx2-converting_phage	97.5	1.3e-109
VEC68642.1|2400673_2401411_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEC68643.1|2401541_2403200_+|tail	tail fiber protein	tail	U5N099	Enterobacteria_phage	56.9	8.8e-76
VEC68644.1|2403872_2404463_-	putative DNA-invertase	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
VEC68645.1|2404780_2405014_-	Qin prophage DNA-binding transcriptional regulator	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
2405382:2405398	attL	CTACACGGATTGGGTTT	NA	NA	NA	NA
VEC68646.1|2405800_2407084_+	metabolite transport protein YdfJ	NA	NA	NA	NA	NA
VEC68647.1|2407172_2408633_+	putative sugar dehydrogenase	NA	H8ZJP8	Ostreococcus_tauri_virus	29.2	1.5e-42
VEC68648.1|2408668_2408872_-	selenium carrying protein	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
VEC68649.1|2409048_2409735_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
VEC68650.1|2409823_2410570_-	NADP-dependent L-serine/L-allo-threonine dehydrogenase	NA	NA	NA	NA	NA
VEC68651.1|2410706_2412752_+	dipeptidyl carboxypeptidase II	NA	NA	NA	NA	NA
VEC68652.1|2412795_2413314_-	competence damage-inducible protein A	NA	NA	NA	NA	NA
VEC68653.1|2413589_2413982_+	stress response protein	NA	NA	NA	NA	NA
VEC68654.1|2414236_2415127_+	putative signal transduction protein	NA	A0A127AWB9	Bacillus_phage	37.7	1.1e-19
VEC68655.1|2415567_2416755_-	major facilitator superfamily protein	NA	NA	NA	NA	NA
VEC68656.1|2416949_2417849_+	amino acid metabolite efflux	NA	NA	NA	NA	NA
VEC68657.1|2417878_2418097_-	multiple antibiotic resistance protein	NA	NA	NA	NA	NA
VEC68658.1|2418128_2418512_-	DNA-binding transcriptional activator MarA	NA	D0R0F8	Streptococcus_phage	32.3	4.7e-09
VEC68659.1|2418531_2418966_-	multiple antibiotic resistance regulatory protein	NA	NA	NA	NA	NA
VEC68660.1|2419177_2419843_+	multiple antibiotic resistance protein	NA	NA	NA	NA	NA
VEC68661.1|2419867_2421058_-	sugar efflux transporter	NA	NA	NA	NA	NA
VEC68662.1|2421207_2421456_-	protein	NA	NA	NA	NA	NA
VEC68663.1|2421418_2422324_-	protein	NA	NA	NA	NA	NA
VEC68664.1|2422401_2423283_-	transcriptional regulator YneJ	NA	NA	NA	NA	NA
VEC68665.1|2423383_2424772_+	succinate semialdehyde dehydrogenase	NA	NA	NA	NA	NA
VEC68666.1|2424835_2425762_+	glutaminase 2	NA	NA	NA	NA	NA
VEC68667.1|2425761_2426121_+	putative cytoplasmic protein	NA	NA	NA	NA	NA
VEC68668.1|2426232_2427180_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	36.1	9.6e-19
VEC68669.1|2427406_2428858_+	altronate oxidoreductase	NA	NA	NA	NA	NA
VEC68670.1|2429064_2429979_+	inner membrane protein	NA	NA	NA	NA	NA
VEC68671.1|2429982_2430741_-	trans-aconitate methyltransferase	NA	NA	NA	NA	NA
VEC68672.1|2430797_2431088_-	autoinducer-2 (AI-2) modifying protein LsrG	NA	NA	NA	NA	NA
VEC68673.1|2431111_2431987_-	putative aldolase	NA	NA	NA	NA	NA
VEC68674.1|2432013_2433036_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
VEC68675.1|2433047_2434040_-	ABC transporter permease	NA	NA	NA	NA	NA
VEC68676.1|2434039_2435068_-	ABC transporter permease	NA	NA	NA	NA	NA
VEC68677.1|2435061_2436597_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.4	1.7e-20
VEC68678.1|2436845_2437799_+	putative sugar-binding regulatory protein	NA	NA	NA	NA	NA
VEC68679.1|2437877_2439470_+	putative carbohydrate kinase	NA	NA	NA	NA	NA
VEC68680.1|2440000_2445421_+	lipoprotein/autotransporter domain-containing protein	NA	A0A2L1IV18	Escherichia_phage	38.2	2.1e-142
VEC68681.1|2445643_2445910_+	DNA-binding transcriptional regulator HipB	NA	NA	NA	NA	NA
VEC68682.1|2445909_2447232_+	protein hipA	NA	NA	NA	NA	NA
VEC68683.1|2447427_2448549_+|integrase	Phage integrase	integrase	A0A2L1IV26	Escherichia_phage	100.0	2.2e-06
VEC68684.1|2448483_2448861_-|transposase	IS1 transposase	transposase	Q71TF0	Escherichia_phage	99.2	3.8e-67
VEC68685.1|2448905_2449181_-|transposase	IS1 transposase	transposase	Q71TE9	Escherichia_phage	98.9	2.0e-46
VEC68686.1|2449334_2450285_-	magnesium and cobalt transport protein CorA	NA	NA	NA	NA	NA
VEC68687.1|2450654_2450969_+	protein	NA	NA	NA	NA	NA
VEC68688.1|2450997_2451273_+|transposase	IS1 transposase	transposase	Q71TE9	Escherichia_phage	98.9	2.0e-46
VEC68689.1|2451317_2451695_+|transposase	IS1 transposase	transposase	Q71TF0	Escherichia_phage	99.2	3.8e-67
VEC68690.1|2452038_2454489_-	RNA polymerase sigma factor	NA	NA	NA	NA	NA
2451796:2451812	attR	CTACACGGATTGGGTTT	NA	NA	NA	NA
VEC68691.1|2454490_2456719_-	Putative helicase	NA	Q9T1H9	Lactobacillus_phage	25.8	3.0e-23
>prophage 7
LR134228	Escherichia coli strain NCTC9699 genome assembly, chromosome: 1	4969847	2614140	2675961	4969847	tRNA,integrase,tail,terminase,coat,lysis	Escherichia_phage(50.0%)	68	2633594:2633609	2676313:2676328
VEC68817.1|2614140_2615274_+	outer membrane protein N (porin)	NA	Q1MVN1	Enterobacteria_phage	58.8	1.1e-117
VEC68818.1|2615414_2615849_+	putative universal stress protein	NA	A0A1W6JNV4	Morganella_phage	52.8	1.4e-28
VEC68819.1|2616807_2617041_+	Qin prophage DNA-binding transcriptional regulator	NA	A0A192Y6D5	Salmonella_phage	87.0	4.1e-32
VEC68820.1|2617357_2617948_+	putative DNA-invertase	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	2.8e-24
VEC68821.1|2618328_2618418_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEC68822.1|2618467_2619430_+	Mu prophage; Tail fiber protein	NA	A0A0A7NV63	Enterobacteria_phage	91.1	4.0e-174
VEC68823.1|2619433_2619961_+|tail	tail fiber assembly protein	tail	A0A077SK10	Escherichia_phage	98.3	1.9e-93
VEC68824.1|2619989_2620523_-|tail	tail fiber assembly protein (gpg)	tail	C9DGR0	Escherichia_phage	99.4	6.4e-97
VEC68825.1|2620525_2623495_-|tail	side tail fiber protein from lambdoid prophage	tail	Q1MVL8	Enterobacteria_phage	60.3	1.3e-202
VEC68826.1|2623559_2624159_-	membrane protein, Lom/All family	NA	H6WZM8	Escherichia_phage	95.0	1.6e-107
VEC68827.1|2624226_2627706_-	Host specificity protein J of prophage	NA	A0A291AWT4	Escherichia_phage	90.4	0.0e+00
VEC68828.1|2627766_2628309_-|tail	putative phage tail component	tail	A0A291AWV5	Escherichia_phage	81.9	5.4e-75
VEC68829.1|2628305_2628905_-|tail	tail component	tail	A5LH41	Enterobacteria_phage	97.5	5.7e-118
VEC68830.1|2629054_2629753_-|tail	phage minor tail protein	tail	A0A0K2FJ01	Enterobacteria_phage	93.5	1.1e-125
VEC68831.1|2629752_2630049_-|tail	putative phage minor tail protein	tail	H6WZM2	Escherichia_phage	52.0	1.8e-24
VEC68832.1|2630083_2632549_-|tail	putative phage tail length tape measure protein	tail	A0A2H4J9A1	uncultured_Caudovirales_phage	35.9	4.0e-109
2633594:2633609	attL	CGCAGCTTATCCAGCA	NA	NA	NA	NA
VEC68833.1|2633967_2634630_-|tail	putative phage tail protein	tail	NA	NA	NA	NA
VEC68834.1|2635103_2635553_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEC68835.1|2635613_2636576_-	Uncharacterised protein	NA	A0A059VG08	Pseudomonas_phage	39.2	4.5e-56
VEC68836.1|2636602_2636995_-	phage protein	NA	NA	NA	NA	NA
VEC68837.1|2636991_2637372_-	Uncharacterised protein	NA	A0A059VF88	Pseudomonas_phage	44.4	1.1e-18
VEC68838.1|2637372_2637756_-	Uncharacterised protein	NA	A0A0P0I456	Acinetobacter_phage	39.4	2.2e-14
VEC68839.1|2637755_2638151_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEC68840.1|2638154_2638331_-	Uncharacterised protein	NA	G8C7P8	Escherichia_phage	62.3	4.7e-12
VEC68841.1|2638373_2639513_-|coat	P22 coat protein - gene protein 5	coat	G8C7P7	Escherichia_phage	75.0	7.4e-159
VEC68842.1|2639611_2640376_-	Uncharacterised protein	NA	G8C7P6	Escherichia_phage	64.2	6.9e-84
VEC68843.1|2640480_2641596_-	phage protein	NA	I6PD76	Cronobacter_phage	54.4	4.2e-114
VEC68844.1|2641576_2642983_-	Uncharacterised protein	NA	G8C7P4	Escherichia_phage	69.0	3.0e-186
VEC68845.1|2642985_2643972_-|terminase	phage terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	56.4	1.2e-99
VEC68846.1|2644266_2645361_-|terminase	terminase small subunit	terminase	A0A0U2RXW9	Escherichia_phage	80.5	5.9e-113
VEC68847.1|2645364_2645574_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEC68848.1|2645551_2646484_-	Uncharacterised protein	NA	A0A1B1INP7	uncultured_Mediterranean_phage	54.5	9.3e-83
VEC68849.1|2646476_2647268_-	ParB-like nuclease	NA	R4TG31	Halovirus	40.2	3.7e-48
VEC68850.1|2647405_2648830_-	Rac prophage; potassium transporter subunit	NA	NA	NA	NA	NA
VEC68851.1|2649000_2649465_-|lysis	lysis protein	lysis	A0A0K2FJD0	Enterobacteria_phage	94.1	4.8e-72
VEC68852.1|2649461_2649959_-	phage lysozome	NA	M1FJA0	Enterobacteria_phage	96.4	9.3e-90
VEC68853.1|2649958_2650174_-|lysis	phage lysis protein	lysis	A5LH82	Enterobacteria_phage	94.4	1.3e-32
VEC68854.1|2650425_2650821_-	tolA protein (fragment) of prophage	NA	NA	NA	NA	NA
VEC68855.1|2650971_2651400_-	TolA protein (fragment) of prophage	NA	NA	NA	NA	NA
VEC68856.1|2652178_2652316_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEC68857.1|2652444_2652987_-	antitermination protein	NA	A0A0U2S606	Escherichia_phage	75.7	2.9e-76
VEC68858.1|2652983_2653274_-	phage protein	NA	A0A0U2KD41	Escherichia_phage	87.5	3.7e-46
VEC68859.1|2653273_2653873_-	phage protein	NA	A0A0U2RT94	Escherichia_phage	92.0	1.1e-105
VEC68860.1|2655066_2656116_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEC68861.1|2656643_2658326_-	Uncharacterized conserved protein	NA	NA	NA	NA	NA
VEC68862.1|2658616_2658994_-	putative prophage protein	NA	A0A0U2QQN3	Escherichia_phage	88.8	1.6e-54
VEC68863.1|2659009_2659771_-	transcription regulatory protein	NA	A0A0U2SAW4	Escherichia_phage	87.7	8.0e-117
VEC68864.1|2659793_2660540_-	putative phage DNA replication protein	NA	V5UQI5	Shigella_phage	78.9	3.8e-111
VEC68865.1|2660546_2661404_-	phage protein	NA	A0A0U2RT81	Escherichia_phage	84.5	8.3e-70
VEC68866.1|2661416_2661839_-	Protein of uncharacterised function (DUF1019)	NA	A0A0U2RXZ9	Escherichia_phage	95.0	1.5e-69
VEC68867.1|2661861_2662158_-	Rac prophage; putative DNA-binding transcriptional regulator	NA	A0A0R6PH31	Moraxella_phage	44.9	9.6e-10
VEC68868.1|2662281_2662758_+	Rac prophage; putative DNA-binding transcriptional regulator	NA	A0A2D1GNH0	Pseudomonas_phage	53.4	2.2e-11
VEC68869.1|2663067_2663202_+	Rac prophage protein	NA	NA	NA	NA	NA
VEC68870.1|2663212_2663368_+	Rac prophage; predicted protein	NA	M4QQ57	Salicola_phage	55.3	6.1e-08
VEC68871.1|2663364_2663976_-	prophage CP-933R superinfection exclusion protein	NA	NA	NA	NA	NA
VEC68872.1|2664294_2664516_+	FtsZ inhibitor protein	NA	A0A0U2RTC4	Escherichia_phage	98.6	2.0e-36
VEC68873.1|2664515_2664686_+	Rac prophage; zinc-binding protein	NA	A0A0U2SHB5	Escherichia_phage	71.4	3.6e-17
VEC68874.1|2664760_2665036_+	putative bacteriophage protein	NA	A0A0U2QW85	Escherichia_phage	96.7	1.4e-42
VEC68875.1|2665137_2667738_+	exonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	63.5	3.9e-248
VEC68876.1|2667730_2668540_+	recombination and repair protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	8.8e-106
VEC68877.1|2668783_2668993_+	gydaC	NA	A0A0U2QL97	Escherichia_phage	98.4	6.1e-27
VEC68878.1|2669071_2669287_+	excisionase	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
VEC68879.1|2669288_2670524_+|integrase	phage integrase	integrase	A0A0U2JGI6	Escherichia_phage	98.5	1.6e-239
VEC68880.1|2670575_2671511_+|tRNA	C32 tRNA thiolase	tRNA	A0A0U2S5Z2	Escherichia_phage	98.8	5.9e-146
VEC68881.1|2671639_2673013_-	ATP-independent RNA helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
VEC68882.1|2673042_2673216_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEC68883.1|2673490_2674474_-	zinc transport protein	NA	NA	NA	NA	NA
VEC68884.1|2674728_2675961_+	putative signaling protein	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
2676313:2676328	attR	CGCAGCTTATCCAGCA	NA	NA	NA	NA
>prophage 8
LR134228	Escherichia coli strain NCTC9699 genome assembly, chromosome: 1	4969847	2875887	2927845	4969847	tRNA,portal,integrase,tail,terminase,protease,capsid,head,transposase	Escherichia_phage(45.45%)	61	2884178:2884192	2927947:2927961
VEC69081.1|2875887_2876994_+|tRNA	tRNA-specific 2-thiouridylase MnmA	tRNA	NA	NA	NA	NA
VEC69082.1|2877029_2877671_+	putative lysogenization regulator	NA	NA	NA	NA	NA
VEC69083.1|2877674_2879045_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	1.2e-107
VEC69084.1|2879212_2879884_+	two-component response regulator	NA	NA	NA	NA	NA
VEC69085.1|2879883_2881344_+	two-component sensor kinase	NA	NA	NA	NA	NA
VEC69086.1|2881419_2882541_+	cupin superfamily protein family	NA	NA	NA	NA	NA
VEC69087.1|2882686_2883916_-	peptidase T	NA	NA	NA	NA	NA
VEC69088.1|2884165_2885302_+	spermidine/putrescine ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	39.8	9.4e-29
2884178:2884192	attL	AAAAAATTGAATAAA	NA	NA	NA	NA
VEC69089.1|2885285_2886149_+	spermidine/putrescine ABC transporter membrane protein	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
VEC69090.1|2886580_2887780_-|tail	tail fiber protein (modular protein)	tail	A0A0P0ZCC1	Stx2-converting_phage	69.6	1.6e-39
VEC69091.1|2887842_2888442_-	membrane protein, Lom/All family	NA	H6WZM8	Escherichia_phage	93.5	1.6e-104
VEC69092.1|2888509_2891989_-	Host specificity protein J of prophage	NA	A0A291AWT4	Escherichia_phage	88.7	0.0e+00
VEC69093.1|2892049_2892598_-	Tail assembly protein I from prophage	NA	A0A291AWV5	Escherichia_phage	97.3	1.5e-93
VEC69094.1|2892594_2893194_-|tail	tail component	tail	K7PLW1	Enterobacteria_phage	98.0	2.3e-119
VEC69095.1|2893342_2894041_-|tail	phage minor tail protein	tail	A0A1B5FP81	Escherichia_phage	96.6	7.6e-130
VEC69096.1|2894040_2894382_-|tail	prophage minor tail protein	tail	A0A0P0ZDL9	Stx2-converting_phage	66.4	1.2e-40
VEC69097.1|2894374_2897602_-|tail	phage-related minor tail protein	tail	A0A1B5FPE2	Escherichia_phage	95.1	0.0e+00
VEC69098.1|2897647_2897938_-	prophage protein	NA	A0A1B5FP87	Escherichia_phage	98.9	1.7e-43
VEC69099.1|2897949_2898321_-|tail	tail assembly chaperone	tail	A0A1B5FP91	Escherichia_phage	100.0	6.5e-64
VEC69100.1|2898335_2899091_-|tail	phage major tail subunit	tail	A0A1B5FP82	Escherichia_phage	96.2	1.2e-117
VEC69101.1|2899099_2899444_-	putative prophage protein	NA	A0A1B5FP84	Escherichia_phage	100.0	4.2e-57
VEC69102.1|2899440_2899887_-	prophage protein	NA	S4TR46	Salmonella_phage	80.4	2.3e-63
VEC69103.1|2899886_2900225_-|head,tail	putative prophage head-tail adaptor	head,tail	A0A1B5FP90	Escherichia_phage	99.1	1.6e-56
VEC69104.1|2900233_2900539_-	phage protein	NA	A0A1B5FP86	Escherichia_phage	100.0	9.2e-40
VEC69105.1|2900550_2900739_-	phage protein	NA	A0A1B5FP98	Escherichia_phage	100.0	7.2e-27
VEC69106.1|2900790_2901996_-|capsid	major capsid protein	capsid	U5P0G9	Shigella_phage	99.0	8.5e-222
VEC69107.1|2902010_2902661_-|head,protease	pro-head protease	head,protease	U5P4H2	Shigella_phage	100.0	2.5e-119
VEC69108.1|2902638_2903880_-|portal	phage portal protein	portal	U5P411	Shigella_phage	99.3	1.3e-241
VEC69109.1|2903879_2904062_-	prophage protein	NA	A0A1B5FP99	Escherichia_phage	96.7	1.1e-24
VEC69110.1|2904073_2905831_-|terminase	phage terminase	terminase	A0A1B5FP96	Escherichia_phage	99.3	0.0e+00
VEC69111.1|2905830_2906313_-|terminase	putative prophage terminase, small subunit	terminase	A0A1B5FPA0	Escherichia_phage	97.5	5.7e-84
VEC69112.1|2906461_2906812_-	putative prophage endonuclease	NA	A0A1B5FP94	Escherichia_phage	98.3	4.3e-65
VEC69113.1|2906950_2907490_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEC69114.1|2907495_2907762_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEC69115.1|2907917_2908385_-	endopeptidase	NA	A5LH84	Enterobacteria_phage	90.3	2.1e-67
VEC69116.1|2908381_2908915_-	membrane-associated lysozyme; Qin prophage	NA	Q08J98	Stx2-converting_phage	94.4	4.8e-100
VEC69117.1|2908978_2909329_-	putative prophage protein	NA	K7PGU6	Enterobacteria_phage	94.0	1.4e-36
VEC69118.1|2909333_2909549_-	Lysis protein S	NA	M1FN85	Enterobacteria_phage	98.6	5.3e-34
VEC69119.1|2910361_2911051_-	Q antiterminator encoded by prophage CP-933P	NA	I6PDF8	Cronobacter_phage	51.1	2.8e-60
VEC69120.1|2911047_2911413_-	Holliday junction resolvase	NA	V5URS4	Shigella_phage	67.5	7.1e-39
VEC69121.1|2911413_2912541_-	phage protein	NA	U5P0K4	Shigella_phage	48.4	9.5e-90
VEC69122.1|2913581_2913737_-	putative host cell-killing modulation protein	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
VEC69123.1|2913808_2914096_-	toxin of the RelE-RelB toxin-antitoxin system	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	66.0	1.4e-29
VEC69124.1|2914095_2914335_-	antitoxin of the RelE-RelB toxin-antitoxin system and transcriptional repressor of relBEF	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	54.4	1.6e-18
VEC69125.1|2914867_2915200_+	Qin prophage protein	NA	NA	NA	NA	NA
VEC69126.1|2915636_2916977_-|integrase,transposase	putative integrase/transposase	integrase,transposase	NA	NA	NA	NA
VEC69127.1|2917677_2918487_+	Uncharacterised protein	NA	A0A0F7L9X0	Escherichia_phage	95.2	3.2e-156
VEC69128.1|2918633_2919056_-	phage protein	NA	A0A0U2QQN3	Escherichia_phage	89.2	9.7e-64
VEC69129.1|2919096_2920167_-	replication protein	NA	A0A088CD36	Shigella_phage	65.2	4.2e-63
VEC69130.1|2920238_2920664_-	phage regulatory protein	NA	NA	NA	NA	NA
VEC69131.1|2920660_2920876_-	putative antirepressor protein	NA	NA	NA	NA	NA
VEC69132.1|2920925_2921642_+	Putative SOS-response transcriptional repressor	NA	H9C160	Pectobacterium_phage	42.0	1.1e-51
VEC69133.1|2921833_2922070_+	putative prophage protein	NA	M4QQ57	Salicola_phage	53.2	4.6e-07
VEC69134.1|2922071_2922200_+	putative prophage protein	NA	NA	NA	NA	NA
VEC69135.1|2922229_2922448_+	putative prophage protein	NA	NA	NA	NA	NA
VEC69136.1|2922470_2922800_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEC69137.1|2922768_2923206_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEC69138.1|2923610_2923832_+	FtsZ inhibitor protein	NA	A0A0U2RTC4	Escherichia_phage	82.2	4.3e-31
VEC69139.1|2923955_2926427_+	exonuclease from phage origin	NA	K7PLW7	Enterobacteria_phage	60.3	8.5e-59
VEC69140.1|2926488_2926758_+	excisionase for prophage	NA	NA	NA	NA	NA
VEC69141.1|2926726_2927845_+|integrase	prophage lambda integrase	integrase	Q77Z04	Phage_21	44.2	7.7e-84
2927947:2927961	attR	AAAAAATTGAATAAA	NA	NA	NA	NA
>prophage 9
LR134228	Escherichia coli strain NCTC9699 genome assembly, chromosome: 1	4969847	3527411	3586678	4969847	portal,tRNA,integrase,tail,terminase,protease,capsid,head,coat,lysis	Enterobacteria_phage(53.7%)	69	3526942:3526988	3576482:3576528
3526942:3526988	attL	AATGGCGCGCCCTGCAGGATTCGAACCTGCGGCCCACGACTTAGAAG	NA	NA	NA	NA
VEC69853.1|3527411_3528365_+|protease	outer membrane protease	protease	NA	NA	NA	NA
VEC69855.1|3528837_3529353_-	DNA-binding transcriptional activator	NA	NA	NA	NA	NA
VEC69857.1|3530227_3530884_+	methylase	NA	NA	NA	NA	NA
VEC69859.1|3531522_3534750_-|tail	tail fiber protein	tail	X2KTY7	Enterobacteria_phage	58.8	6.4e-06
VEC69861.1|3534814_3535414_-	outer membrane precursor Lom	NA	A0A291AWV3	Escherichia_phage	97.5	2.6e-110
VEC69863.1|3535480_3538879_-	Host specificity protein J	NA	A0A0K2FI38	Escherichia_phage	88.2	0.0e+00
VEC69865.1|3538938_3539511_-|tail	phage tail assembly protein	tail	A0A0K2FJB0	Escherichia_phage	97.9	6.3e-82
VEC69867.1|3539507_3540107_-|tail	putative tail fiber component K of prophage	tail	A0A291AWX4	Escherichia_phage	96.5	1.4e-116
VEC69869.1|3540256_3540955_-|tail	phage minor tail protein	tail	A0A0K2FJ01	Enterobacteria_phage	97.8	8.9e-131
VEC69871.1|3540954_3541284_-|tail	Minor tail protein M	tail	A0A0K2FIE9	Enterobacteria_phage	98.2	8.1e-58
VEC69873.1|3541280_3543842_-|tail	tail component of prophage	tail	A0A2R9YJM8	Escherichia_phage	90.3	0.0e+00
VEC69875.1|3543834_3544269_-|tail	minor tail protein T	tail	A0A0K2FJB3	Enterobacteria_phage	99.2	2.0e-64
VEC69876.1|3544250_3544673_-|tail	phage minor tail protein	tail	A0A0K2FIQ8	Enterobacteria_phage	96.4	8.2e-71
VEC69878.1|3544688_3545429_-|tail	Major tail protein V	tail	A0A0K2FJ05	Enterobacteria_phage	98.0	6.1e-130
VEC69880.1|3545436_3545832_-|tail	phage minor tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	99.2	5.0e-70
VEC69882.1|3545828_3546407_-|tail	minor tail protein	tail	A0A2R9YJK4	Escherichia_phage	97.9	5.9e-80
VEC69884.1|3546418_3546772_-|capsid	minor capsid protein	capsid	A0A2R9YJJ5	Escherichia_phage	99.1	1.5e-62
VEC69886.1|3546783_3547179_-	DNA packaging protein from bacteriophage origin	NA	A0A2R9YJP4	Escherichia_phage	93.2	2.4e-56
VEC69888.1|3547220_3548246_-|head,coat	phage major head protein (major coat protein)	head,coat	C6ZCY2	Enterobacteria_phage	97.4	9.0e-188
VEC69890.1|3548301_3548634_-	Head decoration protein from bacteriophage origin	NA	A0A2R9YJN3	Escherichia_phage	99.1	6.5e-55
VEC69892.1|3548643_3549963_-|capsid	minor capsid protein C from bacteriophage origin	capsid	A0A2I6TC87	Escherichia_phage	97.9	3.8e-231
VEC69894.1|3549943_3551545_-|capsid,portal	phage portal protein (minor capsid protein)	capsid,portal	A0A0K2FJC0	Enterobacteria_phage	99.2	1.1e-309
VEC69896.1|3551541_3551748_-|head,tail	head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
VEC69898.1|3551744_3553670_-|terminase	phage terminase large subunit	terminase	A0A0K2FJ14	Enterobacteria_phage	99.7	0.0e+00
VEC69900.1|3553644_3554190_-	prophage qsr' DNA packaging protein NU1-like protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	2.3e-94
VEC69902.1|3554868_3555279_+	phage protein	NA	C6ZCX4	Enterobacteria_phage	76.3	1.3e-52
VEC69904.1|3555324_3555489_+|tRNA	Arginyl-tRNA synthetase	tRNA	NA	NA	NA	NA
VEC69906.1|3555630_3555783_-	bacteriophage protein (Gene 65)	NA	K7PKL2	Enterobacteria_phage	96.0	3.1e-20
VEC69908.1|3555770_3556238_-	Endopeptidase from phage origin (Lysis protein Rz)	NA	A0A2D1GLQ7	Escherichia_phage	96.1	1.1e-73
VEC69910.1|3556234_3556732_-	phage lysozome	NA	M1FJA0	Enterobacteria_phage	95.2	5.6e-87
VEC69912.1|3556731_3556947_-|lysis	phage lysis protein	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
VEC69914.1|3557520_3558603_+	outer membrane porin protein NmpC	NA	Q1MVN1	Enterobacteria_phage	78.4	6.8e-162
VEC69916.1|3558791_3559175_-	lambdoid prophage DLP12 antitermination protein Q	NA	A0A088CD47	Shigella_phage	83.3	4.4e-55
VEC69918.1|3559260_3559398_-	DLP12 prophage; small protein	NA	K7PHH3	Enterobacteria_phage	70.7	1.1e-08
VEC69920.1|3559397_3559760_-	endodeoxyribonuclease RUS	NA	K7PM48	Enterobacteria_phage	96.5	4.3e-60
VEC69922.1|3559756_3560047_-	DLP12 prophage	NA	K7PGZ6	Enterobacteria_phage	92.7	2.8e-46
VEC69924.1|3560039_3560210_-	prophage protein NinE	NA	K7P7K0	Enterobacteria_phage	69.8	1.4e-13
VEC69926.1|3560209_3560665_-	DLP12 prophage; DNA base-flipping protein	NA	I6PD71	Cronobacter_phage	67.5	4.9e-61
VEC69928.1|3560852_3561209_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEC69930.1|3561670_3561994_-	antirepressor protein	NA	NA	NA	NA	NA
VEC69932.1|3562105_3563632_-	site-specific invertase; DLP12 prophage	NA	Q3HQV4	Burkholderia_phage	27.7	3.6e-31
VEC69934.1|3565327_3565534_-	multidrug efflux protein	NA	NA	NA	NA	NA
VEC69936.1|3565601_3565904_-	Ren protein from phage origin	NA	A0A0N6WES4	Escherichia_phage	93.5	1.7e-41
VEC69937.1|3565900_3566602_-	replication protein P of bacteriophage	NA	M1FJ72	Enterobacteria_phage	97.4	7.9e-127
VEC69939.1|3566598_3567603_-	replication protein O	NA	M1FN81	Enterobacteria_phage	67.6	2.3e-111
VEC69941.1|3567614_3568154_-	bacteriophage regulatory protein CII	NA	M9NZI6	Enterobacteria_phage	66.1	1.5e-61
VEC69943.1|3568184_3568412_-	represror Cro	NA	Q76H55	Enterobacteria_phage	69.0	2.9e-22
VEC69945.1|3568729_3569215_+	Regulatory protein CI from bacteriophage origin	NA	Q76H56	Enterobacteria_phage	90.4	7.0e-74
VEC69947.1|3569321_3570929_+	Uncharacterised protein	NA	A0A1S5SA14	Streptococcus_phage	49.0	6.9e-94
VEC69949.1|3571516_3571723_+	prophage Kil protein	NA	K7P6H3	Enterobacteria_phage	85.3	3.2e-28
VEC69951.1|3571798_3572095_+	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	100.0	1.6e-49
VEC69953.1|3572100_3572886_+	bacteriophage recombination protein	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
VEC69955.1|3572882_3573563_+	exonuclease	NA	Q6H9Z0	Enterobacteria_phage	100.0	1.2e-132
VEC69957.1|3573559_3573742_+	phage protein	NA	A0A0P0ZD61	Stx2-converting_phage	96.7	1.4e-27
VEC69959.1|3573714_3573906_+	phage protein	NA	A0A0P0ZC67	Stx2-converting_phage	100.0	7.3e-27
VEC69961.1|3573916_3574198_+	ybl17	NA	A0A0P0ZE02	Stx2-converting_phage	97.8	1.6e-46
VEC69963.1|3574517_3574850_+	phage related protein	NA	A5VWB6	Enterobacteria_phage	93.6	6.5e-47
VEC69965.1|3574827_3575106_+	bacteriophage protein	NA	M1FPC8	Enterobacteria_phage	96.7	1.1e-47
VEC69967.1|3575304_3576468_+|integrase	site-specific recombinase, phage integrase family protein	integrase	A0A088CD23	Shigella_phage	86.0	1.7e-198
VEC69969.1|3576802_3577435_+	two component transcriptional regulator, LuxR family	NA	NA	NA	NA	NA
3576482:3576528	attR	AATGGCGCGCCCTGCAGGATTCGAACCTGCGGCCCACGACTTAGAAG	NA	NA	NA	NA
VEC69971.1|3577437_3577953_-	fimbrial protein	NA	NA	NA	NA	NA
VEC69973.1|3577963_3578941_-	fimbrial protein	NA	NA	NA	NA	NA
VEC69975.1|3578982_3581592_-	fimbrial outer membrane usher protein	NA	NA	NA	NA	NA
VEC69977.1|3581622_3582315_-	fimbrial chaperone	NA	NA	NA	NA	NA
VEC69979.1|3582534_3583077_-	fimbrial-like protein	NA	NA	NA	NA	NA
VEC69981.1|3583547_3584414_+	5,10-methylene-tetrahydrofolate dehydrogenase	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
VEC69983.1|3584415_3584628_+	putative RNA-binding protein	NA	NA	NA	NA	NA
VEC69985.1|3584735_3585257_+	putative membrane-bound metal-dependent hydrolase	NA	NA	NA	NA	NA
VEC69987.1|3585292_3586678_-|tRNA	cysteinyl-tRNA synthetase	tRNA	M1PG92	Moumouvirus	34.8	3.9e-45
>prophage 10
LR134228	Escherichia coli strain NCTC9699 genome assembly, chromosome: 1	4969847	4289441	4336307	4969847	tRNA,integrase,transposase	Shigella_phage(21.05%)	42	4296126:4296141	4338935:4338950
VEC71230.1|4289441_4289717_+|transposase	IS1 transposase	transposase	Q71TE9	Escherichia_phage	100.0	3.1e-47
VEC71232.1|4289845_4290139_+	IS1 protein InsB	NA	U5P0U6	Shigella_phage	91.8	1.1e-45
VEC71234.1|4290149_4291130_-	deoxyguanosinetriphosphate triphosphohydrolase-like protein	NA	NA	NA	NA	NA
VEC71236.1|4291280_4292147_-|transposase	IS3 element transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	2.3e-51
VEC71238.1|4292143_4292449_-|transposase	putative transposase-related protein	transposase	NA	NA	NA	NA
VEC71240.1|4292590_4292800_-|transposase	IS1 transposase	transposase	U5P0U6	Shigella_phage	98.6	2.2e-32
VEC71242.1|4292800_4293094_-	IS1 protein InsB	NA	U5P0U6	Shigella_phage	89.0	4.2e-42
VEC71244.1|4293579_4294101_+	RNA polymerase sigma factor	NA	NA	NA	NA	NA
VEC71246.1|4294097_4295051_+	iron(III) dicitrate sensor protein	NA	NA	NA	NA	NA
VEC71248.1|4295137_4297462_+	iron(III) dicitrate TonB-dependent receptor	NA	NA	NA	NA	NA
4296126:4296141	attL	TCAACAGCCTGCTGCA	NA	NA	NA	NA
VEC71250.1|4297506_4298409_+	iron-dicitrate transporter substrate-binding subunit	NA	NA	NA	NA	NA
VEC71252.1|4298405_4299404_+	iron(III) dicitrate transport system, permease protein	NA	NA	NA	NA	NA
VEC71254.1|4299400_4300357_+	iron-dicitrate transporter subunit FecD	NA	A0A2H4IY97	uncultured_Caudovirales_phage	26.1	1.1e-17
VEC71256.1|4300357_4301125_+	iron(III) dicitrate transport system, ATP-binding protein	NA	G3M9Y6	Bacillus_virus	24.8	6.4e-13
VEC71258.1|4301533_4302685_-|transposase	IS30 transposase encoded within prophage CP-933T	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
VEC71260.1|4302977_4303655_+|transposase	IS911 transposase orfB	transposase	Q716C2	Shigella_phage	61.0	1.2e-79
VEC71262.1|4303647_4304652_-|transposase	IS66 family transposase orfB	transposase	A0A0P0ZEB3	Stx2-converting_phage	53.8	7.4e-86
VEC71264.1|4304671_4305019_-|transposase	transposase	transposase	A0A0P0ZDM8	Stx2-converting_phage	75.7	4.4e-46
VEC71266.1|4305018_4305669_-|transposase	putative transposase subunit	transposase	A0A0P0ZCV4	Stx2-converting_phage	43.6	3.1e-16
VEC71268.1|4305960_4307325_-	transporter protein	NA	NA	NA	NA	NA
VEC71270.1|4307858_4308941_+	regulatory protein	NA	NA	NA	NA	NA
VEC71272.1|4308937_4310947_+	regulatory protein	NA	NA	NA	NA	NA
VEC71274.1|4310936_4312184_+	transport activator	NA	NA	NA	NA	NA
VEC71276.1|4312528_4313023_+|transposase	transposase	transposase	NA	NA	NA	NA
VEC71278.1|4314145_4314679_+	PixA protein	NA	NA	NA	NA	NA
VEC71280.1|4314764_4315352_+	PixH protein	NA	NA	NA	NA	NA
VEC71282.1|4315472_4317983_+	fimbrial usher protein PixC	NA	NA	NA	NA	NA
VEC71284.1|4318051_4318783_+	PixD protein	NA	NA	NA	NA	NA
VEC71286.1|4318819_4319383_+	PixJ protein	NA	NA	NA	NA	NA
VEC71288.1|4319466_4319985_+	PixF protein	NA	NA	NA	NA	NA
VEC71290.1|4320007_4321000_+	PixG protein	NA	NA	NA	NA	NA
VEC71292.1|4321056_4321839_+	inner membrane protein	NA	NA	NA	NA	NA
VEC71294.1|4321890_4322268_-|transposase	IS1 transposase	transposase	Q71TF0	Escherichia_phage	100.0	1.3e-67
VEC71296.1|4322312_4322588_-|transposase	IS1 transposase	transposase	Q71TE9	Escherichia_phage	100.0	3.1e-47
VEC71298.1|4324192_4325458_-|integrase	phage integrase family site specific recombinase	integrase	Q7M297	Enterobacteria_phage	38.0	2.2e-79
VEC71300.1|4325924_4326944_+	oxidoreductase	NA	A0A0G2Y405	Acanthamoeba_polyphaga_mimivirus	30.7	1.4e-44
VEC71302.1|4327073_4328576_+	ATPase	NA	A0A248XCZ8	Klebsiella_phage	44.6	1.8e-83
VEC71304.1|4328694_4329777_-	putative permease	NA	NA	NA	NA	NA
VEC71306.1|4329776_4330877_-	putative permease	NA	NA	NA	NA	NA
VEC71308.1|4331143_4332655_+	cytosol aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	38.0	6.0e-47
VEC71310.1|4333008_4333452_+	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
VEC71312.1|4333451_4336307_+|tRNA	valyl-tRNA synthetase	tRNA	A0A1V0SK04	Klosneuvirus	36.7	1.3e-140
4338935:4338950	attR	TCAACAGCCTGCTGCA	NA	NA	NA	NA
>prophage 11
LR134228	Escherichia coli strain NCTC9699 genome assembly, chromosome: 1	4969847	4558346	4605694	4969847	tail,tRNA,plate	Burkholderia_virus(30.0%)	49	NA	NA
VEC71718.1|4558346_4559384_-|tRNA	tRNA-dihydrouridine synthase A	tRNA	NA	NA	NA	NA
VEC71720.1|4559744_4560737_-	yjbL	NA	NA	NA	NA	NA
VEC71722.1|4561054_4561570_+	zinc uptake regulation protein	NA	NA	NA	NA	NA
VEC71723.1|4561611_4561821_-	putative general stress response protein	NA	NA	NA	NA	NA
VEC71725.1|4561936_4563262_-	DNA-damage-inducible SOS response protein	NA	NA	NA	NA	NA
VEC71727.1|4563334_4563943_-	LexA repressor	NA	Q9G0C2	Lactococcus_phage	38.0	1.0e-13
VEC71729.1|4564052_4564421_-	diacylglycerol kinase	NA	NA	NA	NA	NA
VEC71731.1|4564591_4567015_+	glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
VEC71733.1|4567169_4568042_-	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
VEC71735.1|4568054_4568552_-	chorismate lyase	NA	NA	NA	NA	NA
VEC71737.1|4568774_4570103_-	putative type III effector protein	NA	NA	NA	NA	NA
VEC71739.1|4570160_4570355_-	putative type III effector protein	NA	NA	NA	NA	NA
VEC71741.1|4570456_4570609_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEC71743.1|4570583_4571504_-	maltose regulon periplasmic protein	NA	NA	NA	NA	NA
VEC71745.1|4571746_4573087_-	maltoporin (maltose-inducible porin)	NA	NA	NA	NA	NA
VEC71747.1|4573158_4574274_-	maltose/maltodextrin transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	31.7	4.3e-18
VEC71749.1|4574450_4574546_+	sugar ABC transporter	NA	NA	NA	NA	NA
VEC71751.1|4574638_4575829_+	maltose transport system, substrate-binding protein	NA	NA	NA	NA	NA
VEC71753.1|4575982_4577527_+	maltose transporter membrane protein	NA	NA	NA	NA	NA
VEC71755.1|4577541_4578432_+	maltose transporter permease	NA	NA	NA	NA	NA
VEC71757.1|4578803_4580279_+	D-xylose transporter XylE	NA	NA	NA	NA	NA
VEC71759.1|4580322_4580733_-	protein psie	NA	NA	NA	NA	NA
VEC71761.1|4581327_4583424_-	putative lipoprotein	NA	NA	NA	NA	NA
VEC71763.1|4583423_4584161_-	group 4 capsule (G4C) polysaccharide, YmcB	NA	NA	NA	NA	NA
VEC71765.1|4584157_4584796_-	lipoprotein yjbF	NA	NA	NA	NA	NA
VEC71767.1|4584909_4585152_-	protein	NA	NA	NA	NA	NA
VEC71769.1|4585650_4587300_-	glucosephosphate isomerase	NA	NA	NA	NA	NA
VEC71771.1|4587824_4589174_+	lysine-sensitive aspartokinase III	NA	NA	NA	NA	NA
VEC71773.1|4589235_4589577_-	putative transcriptional regulator	NA	Q6QIE8	Burkholderia_phage	48.1	2.2e-21
VEC71775.1|4590113_4590401_+	putative inner membrane protein	NA	Q6QIC8	Burkholderia_phage	48.6	1.8e-16
VEC71777.1|4590403_4591009_+	soluble lytic murein transglycosylase	NA	Q5ZQZ1	Pseudomonas_phage	58.2	6.7e-58
VEC71779.1|4591021_4591336_+	putative inner membrane protein	NA	Q5ZQY8	Pseudomonas_phage	43.2	9.2e-19
VEC71781.1|4591482_4591938_+	phage-related protein Gp37-like protein	NA	NA	NA	NA	NA
VEC71783.1|4591934_4592132_+	phage-like protein	NA	NA	NA	NA	NA
VEC71785.1|4592121_4593546_+|tail	putative phage tail sheath protein	tail	A4JWK5	Burkholderia_virus	70.4	1.9e-191
VEC71787.1|4593545_4594070_+|tail	phage tail core protein	tail	A4JWK6	Burkholderia_virus	69.0	1.2e-68
VEC71789.1|4594120_4594438_+	putative phage-like protein	NA	NA	NA	NA	NA
VEC71791.1|4594627_4597003_+|tail	putative phage tail protein	tail	A4JWL0	Burkholderia_virus	25.5	1.1e-58
VEC71793.1|4597002_4597956_+	putative phage P2 GpU family protein	NA	A4JWL1	Burkholderia_virus	50.8	5.6e-35
VEC71795.1|4597955_4598165_+|tail	putative phage tail protein	tail	A4JWL2	Burkholderia_virus	58.8	3.7e-16
VEC71797.1|4598152_4599193_+	putative control protein for phage late genes expression	NA	A4JWL3	Burkholderia_virus	44.2	4.4e-73
VEC71799.1|4599202_4599904_+|plate	putative phage baseplate component	plate	A0A067ZIM2	Vibrio_phage	36.3	6.4e-12
VEC71801.1|4600002_4600362_+|plate	putative phage baseplate protein	plate	Q6QIA0	Burkholderia_phage	64.2	4.7e-35
VEC71803.1|4600352_4601468_+|plate	putative phage baseplate protein	plate	Q6QI99	Burkholderia_phage	51.7	3.4e-100
VEC71805.1|4601460_4601820_+|tail	phage tail protein	tail	Q6QI98	Burkholderia_phage	52.1	5.1e-21
VEC71807.1|4602178_4603759_+|tail	putative side tail phage protein	tail	A0A0M3ULH6	Salmonella_phage	41.1	2.0e-85
VEC71809.1|4603755_4604463_+|tail	putative phage tail fiber assembly protein	tail	A0A0E3JQ06	Enterobacteria_phage	43.5	9.1e-14
VEC71811.1|4604459_4604915_+	Uncharacterised protein	NA	F6MIM0	Haemophilus_phage	43.3	3.0e-26
VEC71813.1|4604929_4605694_-	nucleotidyltransferase	NA	Q8SCS5	Pseudomonas_phage	44.4	9.7e-46
